Complete elimination of estrogen receptor α by PROTAC estrogen receptor α degrader ERD-148 in breast cancer cells.

PURPOSE: Estrogen Receptor α (ERα) is a well-established therapeutic target for Estrogen Receptor (ER)-positive breast cancers. Both Selective Estrogen Receptor Degraders (SERD) and PROTAC ER degraders are synthetic compounds suppressing the ER activity through the degradation of ER. However, the differences between SERD and PROTAC ER degraders are far from clear. METHODS: The effect of PROTAC ER degrader ERD-148 and SERD fulvestrant on protein degradation was evaluated by western blot analysis. The cell proliferation was tested by WST-8 assays and the gene expressions were assessed by gene microarray and real-time RT-PCR analysis after the compound treatment. RESULTS: ERD-148 is a potent and selective PROTAC ERα degrader. It degrades not only unphosphorylated ERα but also the phosphorylated ERα in the cells. In contrast, the SERD fulvestrant showed much-reduced degradation potency on the phosphorylated ERα. The more complete degradation of ERα by ERD-148 translates into a greater maximum cell growth inhibition. However, ERD-148 and fulvestrant share a similar gene regulation profile except for the variation of regulation potency. Further studies indicate that ERD-148 degrades the ERα in fulvestrant-resistant cells. CONCLUSION: PROTAC ER degrader has a different mechanism of action compared to SERD which may be used in treating fulvestrant-resistant cancers.

In silico analysis of intestinal microbial instability and symptomatic markers in mice during the acute phase of severe burns.

BACKGROUND: Severe burns may alter the stability of the intestinal flora and affect the patient's recovery process. Understanding the characteristics of the gut microbiota in the acute phase of burns and their association with phenotype can help to accurately assess the progression of the disease and identify potential microbiota markers. METHODS: We established mouse models of partial thickness deep III degree burns and collected faecal samples for 16 S rRNA amplification and high throughput sequencing at two time points in the acute phase for independent bioinformatic analysis. RESULTS: We analysed the sequencing results using alpha diversity, beta diversity and machine learning methods. At both time points, 4 and 6 h after burning, the Firmicutes phylum content decreased and the content of the Bacteroidetes phylum content increased, showing a significant decrease in the Firmicutes/Bacteroidetes ratio compared to the control group. Nine bacterial genera changed significantly during the acute phase and occupied the top six positions in the Random Forest significance ranking. Clustering results also clearly showed that there was a clear boundary between the communities of burned and control mice. Functional analyses showed that during the acute phase of burn, gut bacteria increased lipoic acid metabolism, seleno-compound metabolism, TCA cycling, and carbon fixation, while decreasing galactose metabolism and triglyceride metabolism. Based on the abundance characteristics of the six significantly different bacterial genera, both the XGboost and Random Forest models were able to discriminate between the burn and control groups with 100% accuracy, while both the Random Forest and Support Vector Machine models were able to classify samples from the 4-hour and 6-hour burn groups with 86.7% accuracy. CONCLUSIONS: Our study shows an increase in gut microbiota diversity in the acute phase of deep burn injury, rather than a decrease as is commonly believed. Severe burns result in a severe imbalance of the gut flora, with a decrease in probiotics and an increase in microorganisms that trigger inflammation and cognitive deficits, and multiple pathways of metabolism and substance synthesis are affected. Simple machine learning model testing suggests several bacterial genera as potential biomarkers of severe burn phenotypes.

Image-registration-based solar meridian detection for accurate and robust polarization navigation.

Skylight polarization, inspired by the foraging behavior of insects, has been widely used for navigation for various platforms, such as robots, unmanned aerial vehicles, and others, owing to its stability and non-error-accumulation. Among the characteristics of skylight-polarized patterns, the angle of polarization (AOP) and the degree of polarization (DOP) are two of the most significant characteristics that provide abundant information regarding the position of the sun. In this study, we propose an accurate method for detecting the solar meridian for real-time bioinspired navigation through image registration. This method uses the AOP pattern to detect the solar meridian and eliminates the ambiguity between anti-solar meridian and solar meridian using the DOP pattern, resulting in an accurate heading of the observer. Simulation experiments demonstrated the superior performance of the proposed method compared to the alternative approaches. Field experiments demonstrate that the proposed method achieves real-time, robust, and accurate performance under different weather conditions with a root mean square error of 0.1° under a clear sky, 0.18° under an overcast sky with a thin layer of clouds, and 0.32° under an isolated thick cloud cover. Our findings suggest that the proposed method can be potentially used in skylight polarization for real-time and accurate navigation in GPS-denied environments.

Targeting the SPHK1/S1P/S1PR2 axis ameliorates GH-secreted pituitary adenoma progression.

BACKGROUND: Growth hormone-secreted pituitary adenoma (GHPA) is a prominent subtype of pituitary adenoma (PA) associated with progressive somatic disfigurement, various complications, and elevated mortality rates. Existing treatment options have limited efficacy, highlighting the urgent need for novel pharmacological interventions. Previous studies have revealed that sphingosine kinase 1 (SphK1)/sphingosine-1-phosphate (S1P)/S1P receptors (S1PRs) signalling have critical roles in the tumour microenvironment, but their role in GHPA remains unclear. METHODS: We performed integrative analyses including bioinformatics analyses, functional studies, and clinical validation to investigate the pathological roles of SPHK1/S1P and evaluated the effectiveness of the S1P receptor 2 (S1PR2) inhibitor JTE-013 in GHPA treatment. RESULTS: SPHK1/S1P signalling is abnormally expressed in patients with GHPA. Knockdown of SPHK1 suppresses S1P-mediated cell proliferation in GH3 Cells. Mechanistically, S1P inhibits apoptosis and autophagy while promoting the secretion of Growth Hormone (GH) by binding to the S1P receptor subtype 2 (S1PR2) in GH3 cells. Moreover, the function of S1PR2 in GH3 cells is mediated by the downstream Akt-Creb pathway. We then identify the S1PR2 as a novel target for therapeutic intervention in GHPA. Systemic administration of the potent and selective S1PR2 antagonist, JTE-013, significantly reduces both tumour size and GH secretion. Importantly, we identify preoperative serum S1P levels as a biomarker predicting poor prognosis in GHPA patients at follow-up. CONCLUSION: Our study shows that blocking SPHK1/S1P/S1PR2 axis can ameliorate the progression of GHPA, providing evidence of a promising therapeutic target for GHPA.

Coronary sodium [18F]fluoride activity predicts outcomes post-CABG: a comparative evaluation with conventional metrics.

PURPOSE: The value of preoperative multidisciplinary approach remains inadequately delineated in forecasting postoperative outcomes of patients undergoing coronary artery bypass grafting (CABG). Herein, we aimed to ascertain the efficacy of multi-modality cardiac imaging in predicting post-CABG cardiovascular outcomes. METHODS: Patients with triple coronary artery disease underwent cardiac sodium [18F]fluoride ([18F]NaF) positron emission tomography/computed tomography (PET/CT), coronary angiography, and CT-based coronary artery calcium scoring before CABG. The maximum coronary [18F]NaF activity (target-to-blood ratio [TBR]max) and the global coronary [18F]NaF activity (TBRglobal) was determined. The primary endpoint was perioperative myocardial infarction (PMI) within 7-day post-CABG. Secondary endpoint included major adverse cardiac and cerebrovascular events (MACCEs) and recurrent angina. RESULTS: This prospective observational study examined 101 patients for a median of 40 months (interquartile range: 19-47 months). Both TBRmax (odds ratio [OR] = 1.445; p = 0.011) and TBRglobal (OR = 1.797; P = 0.018) were significant predictors of PMI. TBRmax>3.0 (area under the curve [AUC], 0.65; sensitivity, 75.0%; specificity, 56.8%; p = 0.036) increased PMI risk by 3.661-fold, independent of external confounders. Kaplan-Meier test revealed a decrease in MACCE survival rate concomitant with an escalating TBRmax. TBRmax>3.6 (AUC, 0.70; sensitivity, 76.9%; specificity, 73.9%; p = 0.017) increased MACCEs risk by 5.520-fold. Both TBRmax (hazard ratio [HR], 1.298; p = 0.004) and TBRglobal (HR = 1.335; p = 0.011) were significantly correlated with recurrent angina. No significant associations were found between CAC and SYNTAX scores and between PMI occurrence and long-term MACCEs. CONCLUSION: Quantification of coronary microcalcification activity via [18F]NaF PET displayed a strong ability to predict early and long-term post-CABG cardiovascular outcomes, thereby outperforming conventional metrics of coronary macrocalcification burden and stenosis severity. TRIAL REGISTRATION: The trial was registered with the Chinese Clinical Trial Committee (number: ChiCTR1900022527; URL: www.chictr.org.cn/showproj.html?proj=37933 ).

Noninvasive Evaluation of Tumoral PD-L1 Using a Novel 99mTc-Labeled Nanobody Tracer with Rapid Renal Clearance.

The expression level of PD-L1 in tumor tissue is considered one of the effective biomarkers to guide PD-1/PD-L1 therapy. Quantifying whole-body PD-L1 expression by SPECT imaging may help in selecting patients that potentially respond to PD-1/PD-L1 therapy. Nanobody is the smallest antibody fragment with antigen-binding ability that is well suited for radionuclide imaging. Nevertheless, high retention of radioactivity in the kidney may limit its clinical translation. The present study aimed to screen, design, and prepare a nanobody-based SPECT probe with rapid renal clearance to evaluate the PD-L1 expression level in vivo noninvasively. A phage library was constructed by immunizing alpaca with recombinant human PD-L1 protein, and 17 anti-PD-L1 nanobodies were screened by the phage display technique. After sequence alignment and flow cytometry analysis, APN09 was selected as the candidate nanobody, and a GGGC chelator was attached to its C-terminus for 99mTc labeling to prepare a SPECT imaging probe. The affinity and specificity of 99mTc-APN09 were evaluated by protein and cell-binding experiments, and SPECT imaging and biodistribution were performed in a mouse model with bilateral transplantation of A549 and A549PD-L1 tumors. The ability of 99mTc-APN09 to quantify the PD-L1 expression level in vivo was validated in tumor models with different PD-L1 expression levels. 99mTc-APN09 had a radiochemical purity higher than 99% and a binding equilibrium dissociation constant of 21.44 ± 1.65 nM with hPD-L1, showing high affinity. SPECT imaging results showed that 99mTc-APN09 could efficiently detect PD-L1-positive tumors within 0.5 h, and the quantitative results of SPECT were well correlated with the expression level of PD-L1 in cell lines. SPECT imaging and biodistribution results also showed that 99mTc-APN09 was rapidly cleared from the kidney in 2 h postinjection. 99mTc-APN09 was a simple and stable tool for visualizing PD-L1 expression in the whole body. In addition, due to its significant reduction in renal retention, it has better prospects for clinical translation.

Translocator Protein 18 kDa Tracer 18F-FDPA PET/CTA Imaging for the Evaluation of Inflammation in Vulnerable Plaques.

Inflammation induced by activated macrophages within vulnerable atherosclerotic plaques (VAPs) constitutes a significant risk factor for plaque rupture. Translocator protein (TSPO) is highly expressed in activated macrophages. This study investigated the effectiveness of TSPO radiotracers, 18F-FDPA, in detecting VAPs and quantifying plaque inflammation in rabbits. 18 New Zealand rabbits were divided into 3 groups: sham group A, VAP model group B, and evolocumab treatment group C. 18F-FDPA PET/CTA imaging was performed at 12, 16, and 24 weeks in all groups. Optical coherence tomography (OCT) was performed on the abdominal aorta at 24 weeks. The VAP was defined through OCT images, and ex vivo aorta PET imaging was also performed at 24 weeks. The SUVmax and SUVmean of 18F-FDPA were measured on the target organ, and the target-to-background ratio (TBRmax) was calculated as SUVmax/SUVblood pool. The arterial sections of the isolated abdominal aorta were analyzed by HE staining, CD68 and TSPO immunofluorescence staining, and TSPO Western blot. The results showed that at 24 weeks, the plaque TBRmax of 18F-FDPA in group B was significantly higher than in groups A and C. Immunofluorescence staining of CD68 and TSPO, as well as Western blot, confirmed the increased expression of macrophages and TSPO in the corresponding regions of group B. HE staining revealed an increased presence of the lipid core, multiple foam cells, and inflammatory cell infiltration in the area with high 18F-FDPA uptake. This indicates a correlation between 18F-FDPA uptake, inflammation severity, and VAPs. The TSPO-targeted tracer 18F-FDPA shows specific uptake in macrophage-rich regions of atherosclerotic plaques, making it a valuable tool for assessing inflammation in VAPs.

Improving energy efficiency: a highly efficient coaxial design for a laser ranging system with a splicing lens.

Light detection and ranging (LiDAR) systems have made significant contributions in different applications. The laser ranging (LR) system is one of the core components of LiDARs. However, existing coaxial LR systems suffer from low energy efficiency due to obstruction of the reflection mirror. In this study, we carefully design a laser transmitter and receiver subsystem and consequently propose a highly energy-efficient coaxial design for a time of light-based LR system, where a perforated mirror and splicing lens account for the promotion of energy efficiency. The small hole in the perforated mirror is located on the object focus of the focusing lens to ensure the laser beam will pass through the perforated mirror without obstructions. The ring-shape splicing lens, consisting of two parts, is used for laser collimation and laser reception simultaneously. Laboratory experiments proved that the proposed design eliminates the complex calibration process for noncoaxial LR systems while reaching a comparable energy efficiency, which is higher than 98%. We believe it is an economical yet efficient way to promote the energy efficiency of coaxial LR systems.

Regulating Charge Transport Dynamics at the Buried Interface and Bulk of Perovskites by Tailored-phase Two-dimensional Crystal Seed Layer.

Targeting the trap-assisted non-radiative recombination losses and photochemical degradation occurring at the interface and bulk of perovskite, especially the overlooked buried bottom interface, a strategy of tailored-phase two-dimensional (TP-2D) crystal seed layer has been developed to improve the charge transport dynamics at the buried interface and bulk of perovskite films. Using this approach, TP-2D layer constructed by TP-2D crystal seeds at the buried interface can induce the formation of homogeneous interface electric field, which effectively suppress the accumulation of charge carriers at the buried interface. Additionally, the presence of TP-2D crystal seed has a positive effect on the crystallization process of the upper perovskite film, leading to optimized crystal quality and thus promoted charge transport inside bulk perovskites. Ultimately, the best performing PSCs based on TP-2D layer deliver a power conversion efficiency of 24.58 %. The devices exhibit an improved photostability with 88.4 % of their initial PCEs being retained after aging under continuous 0.8-sun illumination for 2000 h in air. Our findings reveal how to regulate the charge transport dynamics of perovskite bulk and interface by introducing homogeneous components.

Calibration method for monocular laser speckle projection system.

This paper proposes a novel calibration method for the monocular laser speckle projection system. By capturing images of a calibration board with speckles under different poses, projector's optical axis is fitted and utilized to calibrate the rotation between the camera and projector. The translation is solved in closed form subsequently and projector's virtual image is recovered via homography. After calibration, the system can be regarded and operated as a binocular stereo vision system with speckle pattern. The proposed method is efficient and convenient, without need of reference image or high-precision auxiliary equipment. Validated by experiments on Astra-s and Astra-pro, it presents significant improvement in depth-estimation compared to the traditional method.

Preclinical evaluation and pilot clinical study of [68Ga]Ga-THP-APN09, a novel PD-L1 targeted nanobody radiotracer for rapid one-step radiolabeling and PET imaging.

PURPOSE: Programmed cell death protein-1/ligand-1 (PD-1/L1) blockade has been a breakthrough in the treatment of patients with non-small cell lung cancer (NSCLC), but there is still a lack of effective methods to screen patients. Here we report a novel 68 Ga-labeled nanobody [68 Ga]Ga-THP-APN09 for PET imaging of PD-L1 status in mouse models and a first-in-human study in NSCLC patients. METHODS: [68 Ga]Ga-THP-APN09 was prepared by site-specific radiolabeling, with no further purification. Cell uptake assays were completed in the human lung adenocarcinoma cell line A549, NSCLC cell line H1975 and human PD-L1 gene-transfected A549 cells (A549PD-L1). The imaging to image PD-L1 status and biodistribution were investigated in tumor-bearing mice of these three tumor cell types. The first-in-human clinical translational trial was registered as NCT05156515. The safety, radiation dosimetry, biodistribution, and correlations of tracer uptake with immunohistochemical staining and major pathologic response (MPR) were evaluated in NSCLC patients who underwent adjuvant immunotherapy combined with chemotherapy. RESULTS: Radiosynthesis of [68 Ga]Ga-THP-APN09 was achieved at room temperature and a pH of 6.0-6.5 in 10 min with a high radiochemical yield (> 99%) and 13.9-27.8 GBq/µmol molar activity. The results of the cell uptake study reflected variable levels of surface PD-L1 expression observed by flow cytometry in the order A549PD-L1 > H1975 > A549. In small-animal PET/CT imaging, H1975 and A549PD-L1 tumors were clearly visualized in an 8.3:1 and 2.2:1 ratios over PD-L1-negative A549 tumors. Ex vivo biodistribution studies showed that tumor uptake was consistent with the PET results, with the highest A549PD-L1 being taken up the most (8.20 ± 0.87%ID/g), followed by H1975 (3.69 ± 0.50%ID/g) and A549 (0.90 ± 0.16%ID/g). Nine resectable NSCLC patients were enrolled in the clinical study. Uptake of [68 Ga]Ga-THP-APN09 was mainly observed in the kidneys and spleen, followed by low uptake in bone marrow. The radiation dose is within a reliable range. Tumor uptake was positively correlated with PD-L1 expression TPS (rs = 0.8763, P = 0.019). Tumor uptake of [68 Ga]Ga-THP-APN09 (SUVmax) in MPR patients was higher than that in non-MPR patients (median SUVmax 2.73 vs. 2.10, P = 0.036, determined with Mann-Whitney U-test). CONCLUSION: [68 Ga]Ga-THP-APN09 has the potential to be transformed into a kit-based radiotracer for rapid, simple, one-step, room temperature radiolabeling. The tracer can detect PD-L1 expression levels in tumors, and it may make it possibility to predict the response of PD-1 immunotherapy combined with chemotherapy. Confirmation in a large number of cases is needed. TRIAL REGISTRATION: Clinical Trial (NCT05156515). Registered 12 December 2021.

Low Vitamin D Status Is Associated with Inflammation in Patients with Chronic Obstructive Pulmonary Disease.

Vitamin D deficiency is associated with increased risks of chronic obstructive pulmonary disease (COPD). Nevertheless, the mechanisms remain unknown. This study analyzed the correlations between vitamin D levels and inflammation in COPD patients. One hundred and one patients with COPD and 202 control subjects were enrolled. Serum 25(OH)D level and inflammatory cytokines were detected. Serum 25(OH)D was decreased and inflammatory cytokines were increased in COPD patients. According to forced expiratory volume in 1 s, COPD patients were divided into three grades. Furthermore, serum 25(OH)D was gradually decreased in COPD patients ranging from grade 1-2 to 4. Serum 25(OH)D was inversely associated with inflammatory cytokines in COPD patients. Further analysis found that NF-κB and AP-1 signaling were activated in COPD patients. Besides, inflammatory signaling was gradually increased in parallel with the severity of COPD. By contrast, pulmonary nuclear vitamin D receptor was decreased in COPD patients. In vitro experiments showed that 1,25(OH)2D3 inhibited LPS-activated inflammatory signaling in A549 cells (human lung adenocarcinoma cell). Mechanically, 1,25(OH)2D3 reinforced physical interactions between vitamin D receptor with NF-κB p65 and c-Jun. Our results indicate that vitamin D is inversely correlated with inflammatory signaling in COPD patients. Inflammation may be a vital mediator of COPD progress in patients with low vitamin D levels.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

An Efficient Method for Laser Welding Depth Determination Using Optical Coherence Tomography.

Online monitoring of laser welding depth is increasingly important, with the growing demand for the precise welding depth in the field of power battery manufacturing for new energy vehicles. The indirect methods of welding depth measurement based on optical radiation, visual image and acoustic signals in the process zone have low accuracy in the continuous monitoring. Optical coherence tomography (OCT) provides a direct welding depth measurement during laser welding and shows high achievable accuracy in continuous monitoring. Statistical evaluation approach accurately extracts the welding depth from OCT data but suffers from complexity in noise removal. In this paper, an efficient method coupled DBSCAN (Density-Based Spatial Clustering of Application with Noise) and percentile filter for laser welding depth determination was proposed. The noise of the OCT data were viewed as outliers and detected by DBSCAN. After eliminating the noise, the percentile filter was used to extract the welding depth. By comparing the welding depth determined by this approach and the actual weld depth of longitudinal cross section, an average error of less than 5% was obtained. The precise laser welding depth can be efficiently achieved by the method.

Identification of the Metabolites of Both Formononetin in Rat Hepatic S9 and Ononin in Rat Urine Samples and Preliminary Network Pharmacology Evaluation of Their Main Metabolites.

Astragalus membranaceus is a traditional Chinese medicine derived from the roots of Astragalus membranaceus (Fisch.) Bge., which has the same medicinal and edible uses in China. It is also widely used in daily food, and its pharmacological effects mainly include antioxidant effects, vascular softening effects, etc. Currently, it is increasingly widely used in the prevention of hypertension, cerebral ischemia, and stroke in China. Formononetin and its glucopyranoside (ononin) are both important components of Astragalus membranaceuss and may play important roles in the treatment of cardiovascular diseases (CVDs). This study conducted metabolic studies using formononectin and its glucopyranoside (ononin), including a combination of the in vitro metabolism of Formonetin using rat liver S9 and the in vivo metabolism of ononin administered orally to rats. Five metabolites (Sm2, 7, 9, 10, and 12) were obtained from the solution incubated with formononetin and rat hepatic S9 fraction using chromatographic methods. The structures of the five metabolites were elucidated as (Sm2)6,7,4'-trihydroxy-isoflavonoid; (Sm7)7,4'-dihydroxy-isoflavonoid; (Sm9)7,8,4'-trihydroxy-isoflavonoid; (Sm10)7,8,-dihydroxy-4'-methoxy-isoflavonoid; and (Sm12)6,7-dihydroxy-4'-methoxy- isoflavonoid on the basis of UV, NMR, and MS data. Totally, 14 metabolites were identified via HPLC-DAD-ESI-IT-TOF-MSn analysis, from which the formononetin was incubated with rat hepatic S9 fraction, and the main metabolic pathways were hydroxylation, demethylation, and glycosylation. Then, 21 metabolites were identified via HPLC-DAD-ESI-IT-TOF-MSn analysis from the urine samples from SD rats to which ononin was orally administered, and the main metabolic pathways were glucuronidation, hydroxylation, demethylation, and sulfonation. The main difference between the in vitro metabolism of formononetin and the in vivo metabolism of ononin is that ononin undergoes deglycemic transformation into Formonetin in the rat intestine, while Formonetin is absorbed into the bloodstream for metabolism, and the metabolic products also produce combined metabolites during in vivo metabolism. The six metabolites obtained from the aforementioned separation indicate the primary forms of formononetin metabolism, and due to their higher contents of similar isoflavone metabolites, they are considered the main active compounds that are responsible for pharmacological effects. To investigate the metabolites of the active ingredients of formononetin in the rat liver S9 system, network pharmacology was used to evaluate the cardiovascular disease (CVD) activities of the six primary metabolites that were structurally identified. Additionally, the macromolecular docking results of six main components and two core targets (HSP90AA1 and SRC) related to CVD showed that formononetin and its main metabolites, Sm10 and Sm12, may have roles in CVD treatment due to their strong binding activities with the HSP90AA1 receptor, while the Sm7 metabolite may have a role in CVD treatment due to its strong binding activity with the SRC receptor.

IgG-Binding Nanobody Capable of Prolonging Nanobody-Based Radiotracer Plasma Half-Life and Enhancing the Efficacy of Tumor-Targeted Radionuclide Therapy.

Nanobodies have been developed rapidly as targeted probes for molecular imaging owing to their high affinity, outstanding tissue penetration, and rapid blood clearance. However, the short retention time at the tumor site limits their application in targeted radionuclide therapy. In this study, we designed a dual-targeting nanobody referred to as MIRC213-709, which can specifically bind to the HER2 receptor in tumor cell lines with high affinity (by nanobody MIRC213) and endogenous IgG in plasma to prolong the half-life by the MIRC213 C-terminal fusion nanobody, MIRC709. The nanobodies were site-specifically radiolabeled with 99mTc and 177Lu, and radiochemical purity was >95% after purification. The long blood circulation time and tumor retention property of 99mTc/177Lu-MIRC213-709 were confirmed by a blood clearance assay, single-photon emission computed tomography (SPECT), and a biodistribution study. The blood clearance assay showed that the distribution phase half-life (T1/2α) and elimination phase half-life (T1/2ß) of 99mTc-MIRC213-709 were 6.74- and 19.04-fold longer than those of 99mTc-MIRC213, respectively. The SPECT/CT and biodistribution results showed that the highest uptake of 177Lu-MIRC213 in the NCI-N87 model was 5.24 ± 0.95% ID/g at 6 h p.i., while the highest uptake of 177Lu-MIRC213-709 in the NCI-N87 model was 30.82 ± 7.29% ID/g at 48 h p.i. Compared with 177Lu-MIRC213, 177Lu-MIRC213-709 had a 16.9-fold increased tumor cumulative uptake (2606 ± 195.1 vs 153.9 ± 22.37% ID/g·h). The targeted radionuclide therapy assay was performed in the NCI-N87 tumor model, and treatment monitoring ended on day 32. The post-treatment/pretreatment tumor volumes were 12.99 ± 1.66, 3.58 ± 0.96, 1.26 ± 0.17, and 1.54 ± 0.50 in the 0, 9, and 18 MBq single-dose groups and the two 9 MBq divided dose group (14 days apart), respectively. All treatment groups showed significant therapeutic effects (P < 0.0001). Thus, fusion with the IgG-binding nanobody MIRC709 provides MIRC213 derivatives with improved metabolic properties for targeted radionuclide therapy.

Preclinical evaluation of [99mTc]Tc-labeled anti-EpCAM nanobody for EpCAM receptor expression imaging by immuno-SPECT/CT.

PURPOSE: Overexpression of epithelial cell adhesion molecule (EpCAM) plays essential roles in tumorigenesis and tumor progression in almost all epithelium-derived cancer. Monitoring EpCAM expression in tumors can be used for the diagnosis, staging, and prognosis of cancer patients, as well as guiding the individualized treatment of EpCAM-targeted drugs. In this study, we described the synthesis and evaluation of a site-specifically [99mTc]Tc-labeled EpCAM-targeted nanobody for the SPECT/CT imaging of EpCAM expression. METHODS: We first prepared the [99mTc]Tc-HYNIC-G4K; then, it was site-specifically connected to EpCAM-targeted nanobody NB4. The in vitro characteristics of [99mTc]Tc-NB4 were investigated in HT-29 (EpCAM positive) and HL-60 (EpCAM negative) cells, while the in vivo studies were performed using small-animal SPECT/CT in the subcutaneous tumor models and the lymph node metastasis model to verify the specific targeting capacity as well as the potential applications of [99mTc]Tc-NB4. RESULTS: [99mTc]Tc-NB4 displayed a high EpCAM specificity both in vitro and in vivo. SPECT/CT imaging revealed that [99mTc]Tc-NB4 was cleared rapidly from the blood and normal organs except for the kidneys, and HT-29 tumors were clearly visualized in contrast with HL-60 tumors. The uptake value of [99mTc]Tc-NB4 in HT-29 tumors was increased continuously from 3.77 ± 0.39%ID/g at 0.5 h to 5.53 ± 0.82%ID/g at 12 h after injection. Moreover, the [99mTc]Tc-NB4 SPECT/CT could clearly image tumor-draining lymph nodes. CONCLUSION: [99mTc]Tc-NB4 is a broad-spectrum, specific, and sensitive SPECT radiotracer for the noninvasive imaging of EpCAM expression in the epithelium-derived cancer and revealed a great potential for the clinical translation.

99mTc-CD3813: A Nanobody-Based Single Photon Emission Computed Tomography Radiotracer with Clinical Potential for Myeloma Imaging and Evaluation of CD38 Expression.

Daratumumab (DARA) is an anti-CD38 monoclonal antibody for the treatment of multiple myeloma (MM). The tumor CD38 expression level is one of the important factors in determining the efficacy of DARA treatment. Therefore, there is an urgent clinical need for a noninvasive tool to evaluate the CD38 levels in cancer patients before, during, and after DARA treatment. In this study, we prepared a new molecular imaging probe 99mTc-CD3813, the 99mTc-labeled nanobody CD3813, for noninvasive imaging of CD38 expression by single photon emission computed tomography (SPECT). We evaluated 99mTc-CD3813 for its CD38 affinity and specificity and its capacity to image the CD38 expression in the MM and lymphoma xenografts models. 99mTc-CD3813 SPECT/CT is able to visualize subcutaneous/orthotopic myeloma lesions in animal models and has advantages over 18F-fluorodeoxyglucose (18F-FDG) positron emission tomography. Excess DARA has less impact on its tumor uptake (3.14 ± 0.83 vs 2.29 ± 0.91 %ID/g, n.s.), strongly suggesting that there is no competition between 99mTc-CD3813 and DARA in binding to CD38. 99mTc-CD3813 SPECT/CT revealed significant reduction in CD38 expression in the Ramos-bearing mice under DARA treatment, as evidenced by their reduced tumor uptake (3.04 ± 0.70 vs 1.07 ± 0.28 %ID/cc, P < 0.001). 99mTc-CD3813 SPECT/CT was also able to detect the increased tumor uptake (0.79 ± 0.29 vs 2.12 ± 0.12 %ID/cc, P < 0.001) due to the upregulation of CD38 levels caused by all-trans retinoic acid infection. 99mTc-CD3813 is a promising SPECT radiotracer for imaging the CD38-positive tumors and has clinical potential as a molecular imaging tool for evaluation of the CD38 expression level in patients before, during, and after DARA treatment.

Experimental investigation and thermodynamic modeling of phase equilibria in the Ag-Ni-Zr ternary system.

The phase equilibria of the Ag-Ni-Zr ternary system were investigated based on the key experiments coupled with thermodynamic modeling. Thirty ternary alloys were prepared to determine the isothermal sections of the Ag-Ni-Zr system at 500, 700 and 900 °C, respectively, by means of X-ray diffraction (XRD) and scanning electron microscopy equipped with energy dispersive X-ray spectroscopy (SEM/EDS). Based on the thermodynamic descriptions of three binary systems available in the literature as well as the experimental phase equilibrium data obtained from the present work, ten three-phase regions were determined. No ternary compound was found. The maximum solubilities of Ag in the Ni-Zr binary compounds and Ni in the Ag-Zr binary compounds were measured. The substitutional model and sublattice model were used to describe the solution phases and intermediate phases, respectively. Based on the thermodynamic descriptions of three constituent binary systems as well as the experimental phase equilibrium data obtained from the present work, a thermodynamic assessment of the Ag-Ni-Zr system was carried out using the CALPHAD (CALculation of PHAse Diagrams) approach. A set of thermodynamic parameters were obtained and the isothermal sections of the Ag-Ni-Zr system were calculated. The calculated results agree well with the experimental data.

A population-based predictive model to identify patients with signet ring cell carcinoma of the stomach who are most suitable for primary tumor resection.

BACKGROUND: Though the survival benefit of primary tumor operation for patients with signet ring cell carcinoma of the stomach is known, the specific characteristics of those patients who would profit from the operation are yet to be determined. To this end, a predictive model was developed to identify the conjecture that the survival profit from primary tumor operation would only be obtained by patients. METHOD: The clinical data of the patients with signet ring cell carcinoma of the stomach were obtained from the Surveillance, Epidemiology, and End Results database, and then divided into operation and no-operation groups based on whether the patients underwent the primary tumor operation. To remove the confounding factors, propensity score matching was employed, and it was hypothesized that the patients who had been operated on and lived a longer life than the median cancer-specific survival time of those who hadn't must have profited from the surgery. To discuss the independent factors of cancer-specific survival time in the beneficial group and the non-beneficial group, the Cox model was used, and based on the various vital predictive factors, a nomogram was drawn using logistic regression. RESULT: The number of eligible patients was 12,484, with 43.9% (5483) of them having received surgery. After employing propensity score matching, the cancer-specific survival time of the operation group was found to be apparently longer (median: 21 vs. 5 months; p < 0.001) than the no-operation group. In the operation group, 4757 (86.7%) of the patients lived longer than five months (beneficial group). The six indexes (beneficial and non-beneficial group) included gender, age, Tumor Node Metastasis stage, histologic type, differentiation grade, and tumor position, and were used as predictors to draw the nomogram. The nomogram was used to divide the patients who had taken operations into two groups: the beneficial operation group and the non-beneficial operation group. The beneficial operation group, it was found, survived longer than the non-beneficial operation group (median cancer-specific survival time: 28 vs. 3 months, p < 0.001). Moreover, there was we could tell little difference in survival between the two groups (median cancer-specific survival time: 3 vs. 5 months). CONCLUSIONS: The predictive model created to select suitable candidates for surgical treatment from patients with signet ring carcinoma of the stomach could be adopted to identify certain patients benefiting from the primary tumor operation.