Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 5 de 5
Filtrar
1.
Diabet Med ; 39(6): e14813, 2022 06.
Artículo en Inglés | MEDLINE | ID: mdl-35179802

RESUMEN

AIM: Intermittent fasting, a dietary intervention of alternate eating and fasting, has gained popularity in people trying to lose weight. Intermittent fasting could provide an alternative to classic caloric restriction in people with type 2 diabetes mellitus. The aim of the study is to determine the impact of a 12-week intermittent fasting regimen compared with usual care in people with type 2 diabetes mellitus receiving insulin therapy. METHODS: This open, single-centre, randomized controlled trial investigates participants with type 2 diabetes mellitus on insulin therapy and a glycated haemoglobin A1c (HbA1c) of ≥53 mmol/mol (≥7.0%) and a minimum insulin dose of 0.3 IU/kg body weight per day. Participants are randomized in a 1:1 ratio to either 12 weeks of intermittent fasting or the standard care group. All participants receive dietary counselling, continuous glucose monitoring, measurement of the resting metabolic rate, an oral glucose tolerance test, body composition measurement via dual-energy X-ray absorptiometry and stool samples for microbiome analyses at the beginning and at the end of the intervention. Two co-primary outcomes (analysed in hierarchical order) were chosen for the study: (i) the difference in the change of HbA1c from baseline to 12 weeks and (ii) the difference in the number of participants achieving a combined end point encompassing a body weight reduction of at least 2%, an insulin dose reduction of at least 10% and an absolute HbA1c reduction of at least 3 mmol/mol (0.3%) between the two groups.


Asunto(s)
Diabetes Mellitus Tipo 2 , Glucemia/metabolismo , Automonitorización de la Glucosa Sanguínea , Diabetes Mellitus Tipo 2/tratamiento farmacológico , Ayuno , Hemoglobina Glucada/metabolismo , Humanos , Hipoglucemiantes/uso terapéutico , Insulina/metabolismo , Insulina/uso terapéutico , Ensayos Clínicos Controlados Aleatorios como Asunto
2.
Eur J Nutr ; 59(5): 1831-1844, 2020 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-31263983

RESUMEN

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.


Asunto(s)
Microbiota , Simbióticos , Animales , Antibacterianos , Heces , Masculino , Ratones , ARN Ribosómico 16S/genética
3.
Brain Behav Immun ; 56: 140-55, 2016 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-26923630

RESUMEN

Emerging evidence indicates that disruption of the gut microbial community (dysbiosis) impairs mental health. Germ-free mice and antibiotic-induced gut dysbiosis are two approaches to establish causality in gut microbiota-brain relationships. However, both models have limitations, as germ-free mice display alterations in blood-brain barrier and brain ultrastructure and antibiotics may act directly on the brain. We hypothesized that the concerns related to antibiotic-induced gut dysbiosis can only adequately be addressed if the effect of intragastric treatment of adult mice with multiple antibiotics on (i) gut microbial community, (ii) metabolite profile in the colon, (iii) circulating metabolites, (iv) expression of neuronal signaling molecules in distinct brain areas and (v) cognitive behavior is systematically investigated. Of the antibiotics used (ampicillin, bacitracin, meropenem, neomycin, vancomycin), ampicillin had some oral bioavailability but did not enter the brain. 16S rDNA sequencing confirmed antibiotic-induced microbial community disruption, and metabolomics revealed that gut dysbiosis was associated with depletion of bacteria-derived metabolites in the colon and alterations of lipid species and converted microbe-derived molecules in the plasma. Importantly, novel object recognition, but not spatial, memory was impaired in antibiotic-treated mice. This cognitive deficit was associated with brain region-specific changes in the expression of cognition-relevant signaling molecules, notably brain-derived neurotrophic factor, N-methyl-d-aspartate receptor subunit 2B, serotonin transporter and neuropeptide Y system. We conclude that circulating metabolites and the cerebral neuropeptide Y system play an important role in the cognitive impairment and dysregulation of cerebral signaling molecules due to antibiotic-induced gut dysbiosis.


Asunto(s)
Antibacterianos/efectos adversos , Encéfalo/metabolismo , Disfunción Cognitiva , Colon/metabolismo , Disbiosis , Microbioma Gastrointestinal/efectos de los fármacos , Reconocimiento en Psicología , Memoria Espacial , Animales , Disfunción Cognitiva/etiología , Disfunción Cognitiva/metabolismo , Disfunción Cognitiva/fisiopatología , Modelos Animales de Enfermedad , Disbiosis/inducido químicamente , Disbiosis/complicaciones , Disbiosis/metabolismo , Masculino , Metabolómica , Ratones , Ratones Endogámicos C57BL
4.
Front Neurosci ; 13: 359, 2019.
Artículo en Inglés | MEDLINE | ID: mdl-31057355

RESUMEN

Intermitted fasting and other forms of calorie restriction are increasingly demonstrated to exert potential health benefits. Interestingly, restricted feeding is also able to mitigate sickness in response to bacterial factors stimulating Toll-like receptor 4 (TLR4). However, little is known about how fasting modifies the activity of virus-associated molecular patterns. We therefore analyzed the impact of an intermittent fasting (IF) regimen on the immune and behavioral response to the TLR3 agonist and viral mimic polyinosinic:polycytidylic acid [Poly(I:C)] in mice. The effects of intraperitoneally injected Poly(I:C) (12 mg/kg) on plasma and cerebral cytokine expression and behavior (locomotion, exploration, and ingestion) were examined in male C57BL/6N mice under control conditions and following a 9 days period of intermittent (alternate day) fasting (IF). Poly(I:C) increased the circulating levels of cytokines (TNF-α, MCP-1, IL-6, IL-10, IFN-α, IFN-γ), an effect amplified by IF. In addition, IF aggravated sickness behavior in response to Poly(I:C), while cerebral cytokine expression was enhanced by application of Poly(I:C) in the absence of a significant effect of IF. Furthermore, IF augmented the expression of neuropeptide Y (NPY) mRNA in the hypothalamus and increased the plasma levels of corticosterone, while Poly(I:C) had little effect on these readouts. Our data show that IF does not abate, but exaggerates the immune and sickness response to the viral mimic Poly(I:C). This adverse effect of IF occurs despite increased hypothalamic NPY expression and enhanced plasma corticosterone. We therefore propose that the effects of IF on the immune and behavioral responses to viral and bacterial factors are subject to different neuronal and neuroendocrine control mechanisms.

5.
Front Immunol ; 8: 1613, 2017.
Artículo en Inglés | MEDLINE | ID: mdl-29213271

RESUMEN

Stress refers to a dynamic process in which the homeostasis of an organism is challenged, the outcome depending on the type, severity, and duration of stressors involved, the stress responses triggered, and the stress resilience of the organism. Importantly, the relationship between stress and the immune system is bidirectional, as not only stressors have an impact on immune function, but alterations in immune function themselves can elicit stress responses. Such bidirectional interactions have been prominently identified to occur in the gastrointestinal tract in which there is a close cross-talk between the gut microbiota and the local immune system, governed by the permeability of the intestinal mucosa. External stressors disturb the homeostasis between microbiota and gut, these disturbances being signaled to the brain via multiple communication pathways constituting the gut-brain axis, ultimately eliciting stress responses and perturbations of brain function. In view of these relationships, the present article sets out to highlight some of the interactions between peripheral immune activation, especially in the visceral system, and brain function, behavior, and stress coping. These issues are exemplified by the way through which the intestinal microbiota as well as microbe-associated molecular patterns including lipopolysaccharide communicate with the immune system and brain, and the mechanisms whereby overt inflammation in the GI tract impacts on emotional-affective behavior, pain sensitivity, and stress coping. The interactions between the peripheral immune system and the brain take place along the gut-brain axis, the major communication pathways of which comprise microbial metabolites, gut hormones, immune mediators, and sensory neurons. Through these signaling systems, several transmitter and neuropeptide systems within the brain are altered under conditions of peripheral immune stress, enabling adaptive processes related to stress coping and resilience to take place. These aspects of the impact of immune stress on molecular and behavioral processes in the brain have a bearing on several disturbances of mental health and highlight novel opportunities of therapeutic intervention.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA