First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China.

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar：TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1，MZ555753.1, U42342.1）were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

Optimization of Weight Ratio for DSPE-PEG/TPGS Hybrid Micelles to Improve Drug Retention and Tumor Penetration.

PURPOSE: To enhance therapeutic efficacy and prevent phlebitis caused by Asulacrine (ASL) precipitation post intravenous injection, ASL-loaded hybrid micelles with size below 40 nm were developed to improve drug retention and tumor penetration. METHODS: ASL-micelles were prepared using different weight ratios of 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethyleneglycol-2000 (DSPE-PEG2000) and D-α-tocopheryl polyethylene glycol 1000 succinate (TPGS) polymers. Stability of micelles was optimized in terms of critical micelle concentration (CMC) and drug release properties. The encapsulation efficiency (EE) and drug loading were determined using an established dialysis-mathematic fitting method. Multicellular spheroids (MCTS) penetration and cytotoxicity were investigated on MCF-7 cell line. Pharmacokinetics of ASL-micelles was evaluated in rats with ASL-solution as control. RESULTS: The ASL-micelles prepared with DSPE-PEG2000 and TPGS (1:1, w/w) exhibited small size (~18.5 nm), higher EE (~94.12%), better sustained in vitro drug release with lower CMC which may be ascribed to the interaction between drug and carriers. Compared to free ASL, ASL-micelles showed better MCTS penetration capacity and more potent cytotoxicity. Pharmacokinetic studies demonstrated that the half-life and AUC values of ASL-micelles were approximately 1.37-fold and 3.49-fold greater than that of free ASL. CONCLUSIONS: The optimized DSPE-PEG2000/TPGS micelles could serve as a promising vehicle to improve drug retention and penetration in tumor.

Optimization of the formation of embedded multicellular spheroids of MCF-7 cells: How to reliably produce a biomimetic 3D model.

To obtain a multicellular MCF-7 spheroid model to mimic the three-dimensional (3D) of tumors, the microwell liquid overlay (A) and hanging-drop/agar (B) methods were first compared for their technical parameters. Then a method for embedding spheroids within collagen was optimized. For method A, centrifugation assisted cells form irregular aggregates but not spheroids. For method B, an extended sedimentation period of over 24 h for cell suspensions and increased viscosity of the culture medium using methylcellulose were necessary to harvest a dense and regular cell spheroid. When the number was less than 5000 cells/drop, embedded spheroids showed no tight cores and higher viability than the unembedded. However, above 5000 cells/drop, cellular viability of embedded spheroids was not significantly different from unembedded spheroids and cells invading through the collagen were in a sun-burst pattern with tight cores. Propidium Iodide staining indicated that spheroids had necrotic cores. The doxorubicin cytotoxicity demonstrated that spheroids were less susceptible to DOX than their monolayer cells. A reliable and reproducible method for embedding spheroids using the hanging-drop/agarose method within collagen is described herein. The cell culture model can be used to guide experimental manipulation of 3D cell cultures and to evaluate anticancer drug efficacy.

A novel magnetic graphene-loaded biochar gel for the remediation of arsenic- and antimony-contaminated mining soil.

Metalloid co-contamination such as arsenic (As) and antimony (Sb) in soils has posed a significant threat to ecological balance and human well-being. In this study, a novel magnetic graphene-loaded biochar gel (FeBG) was developed, and its remediation potential for the reclamation of AsSb spoiled soil was assessed through a six-month soil incubation experiment. Results showed that the incorporation of iron substances and graphene imparted FeBG with enhanced surface characteristics, such as the formation of a new FeO bond and an enlarged surface area compared to the pristine biochar (BC) (80.5 m2 g-1 vs 57.4 m2 g-1). Application of FeBG significantly decreased Na2HPO4-extractable concentration of As in soils by 9.9 %, whilst BC addition had a non-significant influence on As availability, compared to the control. Additionally, both BC (8.2 %) and FeBG (16.4 %) treatments decreased the Na2HPO4-extractable concentration of Sb in soils. The enhanced immobilization efficiency of FeBG for As/Sb could be attributed to FeBG-induced electrostatic attraction, complexation (Fe-O(H)-As/Sb), and π-π electron donor-acceptor coordination mechanisms. Additionally, the FeBG application boosted the activities of sucrase (9.6 %) and leucine aminopeptidase (7.7 %), compared to the control. PLS-PM analysis revealed a significant negative impact of soil physicochemical properties on the availability of As (ß = -0.611, P < 0.01) and Sb (ß = -0.848, P < 0.001) in soils, in which Sb availability subsequently led to a suppression in soil enzyme activities (ß = -0.514, P < 0.01). Overall, the novel FeBG could be a potential amendment for the simultaneous stabilization of As/Sb and the improvement of soil quality in contaminated soils.

Pristine and Fe-functionalized biochar for the simultaneous immobilization of arsenic and antimony in a contaminated mining soil.

This study examined the effectiveness of pristine biochar (BC) and Fe-functionalized biochar (FBC) in remediating As-Sb co-contaminated soil, and revealed the resulting impact on soil enzymatic activities and bacterial communities. Results from incubation experiments showed that the 1.5% FBC treatment reduced the bioavailable As and Sb concentration by 13.5% and 27.1%, respectively, in compared to the control, and reduced the proportion of specifically adsorbed and amorphous Fe-Mn oxide-bound metal(loid) fractions in the treated soil. Among the BC treatments, only the 1.5% BC treatment resulted in a reduction of bioavailable As by 11.7% and Sb by 21.4%. The 0.5% BC treatment showed no significant difference. The FBC achieved high As/Sb immobilization efficiency through Fe-induced electrostatic attraction, π-π electron donor-acceptor coordination, and complexation (Fe-O(H)-As/Sb) mechanisms. Additionally, the 1.5% FBC treatment led to a 108.2% and 367.4% increase in the activities of N-acetyl-ß-glucosaminidase and urease in soils, respectively, compared to the control. Furthermore, it significantly increased the abundance of Proteobacteria (15.2%), Actinobacteriota (37.0%), Chloroflexi (21.4%), and Gemmatimonadota (43.6%) at the phylum level. Co-occurrence network analysis showed that FBC was better than BC in increasing the complexity of bacterial communities. Partial least squares path modeling further indicated that the addition of biochar treatments can affect soil enzyme activities by altering soil bacterial composition. This study suggests that FBC application offers advantages in simultaneous As and Sb immobilization and restructuring the bacterial community composition in metal(loid)-contaminated soil.

Activation of peroxymonosulphate using a highly efficient and stable ZnFe2O4 catalyst for tetracycline degradation.

Tetracycline (TC) is a widely used antibiotic that adversely affects ecosystems and, therefore, must be removed from the environment. Owing to their strong ability to oxidise pollutants, including antibiotics, and selectivity for these pollutants, an improved oxidation method based on sulphate radicals (SO4·-) has gained considerable interest. In this study, a novel technique for removing TC was developed by activating peroxymonosulphate (PMS) using a ZnFe2O4 catalyst. Using the co-precipitation method, a ZnFe2O4 catalyst was prepared by doping zinc into iron-based materials, which increased the redox cycle, while PMS was active and facilitated the production of free radicals. According to electron paramagnetic resonance spectroscopy results, a ZnFe2O4 catalyst may activate PMS and generate SO4·-, HO·, O2·-, and 1O2 to eliminate TC. This research offers a new method for creating highly effective heterogeneous catalysts that can activate PMS and destroy antibiotics. The study proposes the following degradation pathways: hydroxylation and ring-opening of TC based on the products identified using ultra-performance liquid chromatography-mass spectrometry. These results illustrated that the prepared ZnFe2O4 catalyst effectively removed TC and exhibited excellent catalytic performance.

Root-knot nematode infections and soil characteristics significantly affected microbial community composition and assembly of tobacco soil microbiota: a large-scale comparison in tobacco-growing areas.

Introduction: Tobacco root-knot nematode (RKN) is a highly destructive soil-borne disease worldwide. However, there is a lack of research on the relationship between RKN and tobacco root microbial community composition under large-scale geographical conditions in China. Methods: In this study, we collected 65 samples from 28 main tobacco-growing areas across 10 provinces in China and conducted 16S rDNA sequencing to investigate the dynamic microbial changes in tobacco soil infected by RKN compared to healthy tobacco soil. Based on the analysis of rhizosphere soil bacterial communities, changes after RKN infection, and soil environmental factors. Results: We found the 28 tobacco-growing areas could be divided into two distinct groups with different microbial compositions and varying responses to RKN infection. In group1 of the provinces of Anhui, Henan, Shanxi, and Heilongjiang, Vicinamibacteria dominated the bacterial community, while Acidobacteriae was present in low abundance. In contrast, group2 of the other six provinces (Yunnan, Guizhou, Chongqing, Guangxi, Hubei, and Shandong) exhibited an opposite pattern. After infected by RKN, the genera Chitinophaga increased significant in group 1, while the genera Rhodococcus in group 2 exhibited a substantial increase. Alpha-diversity analysis revealed that RKN-infected tobacco exhibited a richer and more diverse rhizosphere soil bacterial community compared to healthy tobacco in most growing areas. A total of 12 kinds of soil environmental factors were measured in healthy and RKN-infected tobacco soil, and based on the co-occurrence and correlation analysis between environmental factors and microbial species, the pH level, calcium (Ca), magnesium (Mg), phosphorus (P), iron (Fe), and sodium (Na) were identified as key environmental factors influencing the population composition of rhizosphere microorganisms during RKN infection. We observed that RKN infection further increased the pH in weakly alkaline group 1 soil, while weakly acidic group 2 soil experienced a further decrease in pH. Furthermore, we identified three genera as potential biocontrol or plant growth-promoting bacteria for tobacco. Discussion: These findings provide valuable reference data for managing RKN disease in different tobacco-growing areas and contribute to the exploration of new and effective biological control methods.

Biochar-extracted liquor stimulates nitrogen related gene expression on improving nitrogen utilization in rice seedling.

Introduction: Biochar has been shown to be an effective soil amendment for promoting plant growth and improving nitrogen (N) utilization. However, the physiological and molecular mechanisms behind such stimulation remain unclear. Methods: In this study, we investigated whether biochar-extracted liquor including 21 organic molecules enhance the nitrogen use efficiency (NUE) of rice plants using two N forms (NH4 +-N and NO3 --N). A hydroponic experiment was conducted, and biochar-extracted liquor (between 1 and 3% by weight) was applied to rice seedlings. Results: The results showed that biochar-extracted liquor significantly improved phenotypic and physiological traits of rice seedlings. Biochar-extracted liquor dramatically upregulated the expression of rice N metabolism-related genes such as OsAMT1.1, OsGS1.1, and OsGS2. Rice seedlings preferentially absorbed NH4 +-N than NO3 --N (p < 0.05), and the uptake of NH4 +-N by rice seedlings was significantly increased by 33.60% under the treatment of biochar-extracted liquor. The results from molecular docking showed that OsAMT1.1protein can theoretically interact with 2-Acetyl-5-methylfuran, trans-2,4-Dimethylthiane, S, S-dioxide, 2,2-Diethylacetamide, and 1,2-Dimethylaziridine in the biochar-extracted liquor. These four organic compounds have similar biological function as the OsAMT1.1 protein ligand in driving NH4 +-N uptakes by rice plants. Discussion: This study highlights the importance of biochar-extracted liquor in promoting plant growth and NUE. The use of low doses of biochar-extracted liquor could be an important way to reduce N input in order to achieve the purpose of reducing fertilizer use and increasing efficiency in agricultural production.

Performance and microbial community evaluation of full-scale two-phase anaerobic digestion of waste activated sludge.

"Temperature Staging and Biological Phasing" (TSBP) is an improved two-phase anaerobic digestion (AD) technology. This technology hydrolyzes waste activated sludge (WAS) at 45 °C and converts methane at mesophilic temperature (35-38 °C), with hydraulic retention times of 3-5 d and 14-17 d, respectively. In this study, the performance and microbial community dynamics of full-scale TSBP-based sludge anaerobic digestion system were studied, and the technology was evaluated by energy balance and ecological benefit analysis. The stable operation for 390 d showed that the cumulative biogas yield was about 349,041 m3, the maximum biogas yield rate was 563.68 L/kg VS, and the VS degradation rate of organic matters in the sludge was 47.19%. Proteobacteria and Firmicutes were found to be the dominant bacteria in both thermophilic and mesophilic reactors. Methanobacterium and Methanosarcina were the two most abundant methanogenic genera in the AD samples. The aceticlastic methanogenesis was likely the predominant production pathway of methane in AD processes based on metagenomics. The TSBP system operated stably, and the recovered energy could achieve energy self-sufficiency, which provided technical reference for the anaerobic treatment of sludge.

An exploration of manure derived N in soils using 15N after the application of biochar, straw and a mix of both.

It is common practice to apply manure onto soil as an effective way to increase soil fertility. However, the impact of different carbon sources on the transformation and fate of manure derived nitrogen (N) remains poorly understood. This study investigated the mineralization and immobilization turnover (MIT) of various manure-N fractions using sequential extractions and 15N tracing techniques combined after soil amendment with biochar, straw and mixtures thereof. Soil N was fractionated into mineral nitrogen (NH4+ and NO3-), microbial biomass nitrogen (MBN), hot water extractable organic nitrogen (HWDON), hydrochloric acid extractable organic nitrogen (HCl-N), and residual nitrogen (RN). Results showed that biochar addition increased the 15NH4+ content by 45% during the early stage. However, the high pH and labile C absence of biochar inhibited the remineralization of microbial immobilization N during the mid-to-late stage. Straw addition enhanced 15NH4+ assimilation by 10% to form HCl-15N. After that, microbial cellular structures and secondary metabolites were remineralized to meet crop N requirements. Adding carbon source mixtures with the organic fertilizer manifested the relationship between biochar and straw. The labile C content of the carbon sources rather than the C/N ratio was the critical factor regulating the N-MIT process. Overall, these findings offer new insights into the N transformation approaches using the co-application technique of organic amendments.

Optimizing dry anaerobic digestion at pilot scale for start-up strategy and long-term operation: Organic loading rate, temperature and co-digestion.

Dry anaerobic digestion (AD) with high total solid content might upgrade conventional wet AD by enhancing digestion and reducing liquid digestate generation, which was not so popular due to lack of adequate knowledge and perceived operational complexity. In this study long term (447 days) pilot scale investigation was performed for various feedstocks including pig manure, corn straw and sludge. It was found dry method was more suitable for reactor start-up than wet method with relieved inhibition. Volatile fatty acid (VFA)/alkalinity (0.1 ~ 0.4) was effective as dry AD system stability indicator. Organic loading rate of 4.8 kg/(m3·d) and temperature of 48 °C was optimized. Co-digestion achieved better volatile solid removal and system stability. Both hydrogenotrophic and acetoclastic methanogens stably existed in rector while hydrogenotrophic obtained higher abundance. This research contributed to understanding of reactor start-up, system stability indicator and optimized operational conditions (organic loading rate and temperature) during dry AD process.

Effect of Biochar on the Production of L-Histidine From Glucose Through Escherichia coli Metabolism.

The organic compounds from biochar play a role of hormone analogs, stimulating the expression of metabolites by controlling related gene and protein. In this experiment, we reported the L-histidine biosysthesis was promoted by biochar treatment in E. coli unlike genetic engineering of the traditional method. The related results indicated the most optimal concentration was found to be 3%, and 7% is the lethal dose. E. coli was inhibited in the high-concentration treatment. On the other hand, docking technology was usually used as drug screening, basing on Lock-and-key model of protein in order to better understand mechanisms. So the organic compounds of biochar from GC-MS analysis that acted as ligands were connected to HisG protein controlling L-histidine biosysthesis in E. coli. The result showed that the three organic molecules interacted with HisG protein by hydrogen bond. So we considered that these three compounds play regulatory roles in L-histidine biosysthesis, and the hisG gene expression fully supports this conclusion.

Multiseed liposomal drug delivery system using micelle gradient as driving force to improve amphiphilic drug retention and its anti-tumor efficacy.

To improve drug retention in carriers for amphiphilic asulacrine (ASL), a novel active loading method using micelle gradient was developed to fabricate the ASL-loaded multiseed liposomes (ASL-ML). The empty ML were prepared by hydrating a thin film with empty micelles. Then the micelles in liposomal compartment acting as 'micelle pool' drove the drug to be loaded after the outer micelles were removed. Some reasoning studies including critical micelle concentration (CMC) determination, influencing factors tests on entrapment efficiency (EE), structure visualization, and drug release were carried out to explore the mechanism of active loading, ASL location, and the structure of ASL-ML. Comparisons were made between pre-loading and active loading method. Finally, the extended drug retention capacity of ML was evaluated through pharmacokinetic, drug tissue irritancy, and in vivo anti-tumor activity studies. Comprehensive results from fluorescent and transmission electron microscope (TEM) observation, encapsulation efficiency (EE) comparison, and release studies demonstrated the formation of ML-shell structure for ASL-ML without inter-carrier fusion. The location of drug mainly in inner micelles as well as the superiority of post-loading to the pre-loading method , in which drug in micelles shifted onto the bilayer membrane was an additional positive of this delivery system. It was observed that the drug amphiphilicity and interaction of micelles with drug were the two prerequisites for this active loading method. The extended retention capacity of ML has been verified through the prolonged half-life, reduced paw-lick responses in rats, and enhanced tumor inhibition in model mice. In conclusion, ASL-ML prepared by active loading method can effectively load drug into micelles with expected structure and improve drug retention.

[To explore the safety testing evaluation index of breast-feeding by hepatitis B-positive mothers].

OBJECTIVE: To explore the safety testing evaluation index of breast-feeding by hepatitis B-positive mothers. METHODS: HBV DNA from serum and breast milk of 252 hepatitis B-positive mothers were detected with the real-time quantitative PCR. RESULTS: The total positive rate of HBV DNA in serum had no difference with that in breast milk in hepatitis B-positive mothers (P > 0.05). The positive rate of HBV DNA in serum and breast milk of positive HBeAg were significantly higher than that of hepatitis B-positive mothers with negative HBeAg (P < 0.01). CONCLUSION: To detecte HBeAg and HBV DNA in serum and breast milk have important significance for guiding of breast feeding of hepatitis B-positive mothers.