Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Fusarium pernambucanum Causing Peduncle Rot on Grape in Guangxi, China.

Grape (Vitis vinifera) is regarded as one of the most economically important fruit crops throughout the world and is widely cultivated in China. In March 2023, peduncle rot symptoms were observed on ripe grape (cv. Kyoho) of Guangxi Academy of Agricultural Sciences in Nanning, Guangxi Province (20°54' to 26°24' N, 104°26' to 112°04' E), causing severe shrink of infected grapes with incidence of 20 to 40%. Initially, a small portion of the grape peduncles turned from light brown to darker brown and gradually spread to the entire bunch of grape peduncles. Then the peduncles gradually dried up and became dark brown, resulting in necrosis and shedding of the fruits. Symptomatic peduncles were cut into small pieces (approximately 3 mm long), surface disinfected with 75% alcohol for 10 s, 1% NaOCl for 2 min followed by three washes in sterile distilled water and separately transferred to potato dextrose agar (PDA) plates. Forty-six Fusarium isolates were obtained from the seventy-five tissue pieces after 5 days of incubation at 25°C on PDA (average isolation frequency 61%). Based on the morphology, a representative isolate of Fusarium was selected for each of the three samples. Single spore isolates (PT1-1, PT3-1, and PT3-2) were selected for further study. The colonies produced abundant whitish to yellowish aerial mycelium on PDA after 7 days incubation at 25°C in the dark. Macroconidia cultured on carnation leaf agar (CLA) for 7 days were falcate, multiseptate, with a curved apical cell and foot-shaped basal cell, mostly 1-3-septate, measuring 21.3 ± 0.5 µm × 4.8 ± 0.1 µm, 24.3 ± 0.5 µm × 4.5 ± 0.1 µm, 21.9 ± 0.3 µm × 4.5 ± 0.1 µm (n=90) for PT1-1, PT3-1, and PT3-2, respectively. Microconidia were hyaline, fusoid or ovoid, 0- or 1-septate, measuring 10.5 ± 0.2 µm × 3.5 ± 0.1 µm, 10.4 ± 0.3 µm × 3.6 ± 0.1 µm, 10.0 ± 0.2 µm × 3.6 ± 0.1 µm (n=90) for PT1-1, PT3-1, and PT3-2, respectively. The internal transcribed spacer (ITS), translation elongation factor (TEF1), calmodulin (CAM) and partial RNA polymerase second largest subunit (RPB2) were amplified using primers ITS4/ITS1, EF1/EF2, CL1/CL2A, and 5F2/7cR, respectively (White et al. 1990; O'Donnell et al. 1998, 2000; Reeb et al. 2004; Liu et al. 1999). Sequences from the three isolates were deposited in GenBank (ITS: OR511756-OR511758; TEF1: OR535156-OR535158; CAM: OR535153-OR535155; RPB2: OR535159-OR535161). A maximum likelihood (ML) phylogenetic tree was constructed with RAxML version 8.2.10 based on the concatenated sequences (ITS, CAM, TEF1, RPB2). According to morphology and phylogenetic analysis, the isolates were identified as Fusarium pernambucanum (Santos et al. 2019). A pathogenicity test was performed with three isolates on twenty-four asymptomatic strings of grapes in a field in Nanning, Guangxi Province, China. On twelve strings of ripe grapes (cv. Kyoho), 3-mm-long wounds were made on the peduncle of each string of grapes with a sterile needle, followed by inoculation with conidial suspension (106spores/ml in 0.1% sterile Tween 20) by misting with an atomizer until runoff (Lorenz et al. 1995). Three isolates were separately inoculated onto three strings of grapes. Controls were inoculated with water containing 0.1% sterile Tween 20 under the same conditions. The same inoculation was applied to twelve strings of non-wound grapes. Plants were covered with polythene bags to maintain high humidity for 7 days. Typical dark brown lesions were observed on all inoculated peduncles with conidia. After 14 days, the necrotic lesions spread to the entire peduncles causing them to shrivel and die. No symptoms were observed on controls. Koch's postulates were completed by reisolating the fungus from the inoculated tissues. The results of morphological identification and multigene sequence analysis obtained by reisolation were consistent with original isolates. To our knowledge, this is the first report of F. pernambucanum causing peduncle rot on grape in China. These results will provide valuable information for prevention and management of peduncle rot on grape.

Constructing High-Performance Ternary Device Using Analogous Polymer Donors.

Both ternary copolymerization and ternary blending are effective methods to fine-tune polymer structure and manipulate thin-film morphology to improve device performance. In this work, three D-A-A-A (D: donor, A: acceptor) terpolymer donors (FY1, FY2, and FY3) are synthesized by introducing BDD (1,3-bis(2-ethylhexyl)-5,7-di(thiophen-2-yl)benzo[1,2-c:4,5-c']dithiophene-4,8-dione) units into the D-A alternating copolymer PM6 backbone. Owing to the promoted conjugated planarity and excellent absorption of BDD, the obtained terpolymers display an extended absorption range and enhanced π-π stacking orientation, which is a promising third component in ternary device. As a result, the optimal FY1:PM6:BTP-eC9-based ternary device afforded an impressive power conversion efficiency (PCE) as high as 18.52%, owing to the efficient charge transport, negligible energy loss, and suitable domain size. The result provides an efficient method to obtain high-performance polymer solar cells by using analogous polymer donors in ternary device.

Cytosolic DNA sensor activation inhibits HIV infection of macrophages.

Cytosolic recognition of microbial DNA in macrophages results in the activation of the interferon (IFN)-dependent antiviral innate immunity. Here, we examined whether activating DNA sensors in peripheral blood monocyte-derived macrophages (MDMs) can inhibit human immunodeficiency virus (HIV). We observed that the stimulation of MDMs with poly(dA:dT) or poly(dG:dC) (synthetic ligands for the DNA sensors) inhibited HIV infection and replication. MDMs treated with poly(dA:dT) or poly(dG:dC) expressed higher levels of both type I and type III IFNs than untreated cells. Activation of the DNA sensors in MDMs also induced the expression of the multiple intracellular anti-HIV factors, including IFN-stimulated genes (ISGs: ISG15, ISG56, Viperin, OAS2, GBP5, MxB, and Tetherin) and the HIV restriction microRNAs (miR-29c, miR-138, miR-146a, miR-155, miR-198, and miR-223). In addition, the DNA sensor activation of MDM upregulated the expression of the CC chemokines (RANTES, MIP-1α, MIP-1ß), the ligands for HIV entry coreceptor CCR5. These observations indicate that the cytosolic DNA sensors have a protective role in the macrophage intracellular immunity against HIV and that targeting the DNA sensors has therapeutic potential for immune activation-based anti-HIV treatment.

Activation of Toll-like receptor 3 inhibits HIV infection of human iPSC-derived microglia.

As a key immune cell in the brain, microglia are essential for protecting the central nervous system (CNS) from viral infections, including HIV. Microglia possess functional Toll-like receptor 3 (TLR3), a key viral sensor for activating interferon (IFN) signaling pathway-mediated antiviral immunity. We, therefore, studied the effect of poly (I:C), a synthetic ligand of TLR3, on the activation of the intracellular innate immunity against HIV in human iPSC-derived microglia (iMg). We found that poly (I:C) treatment of iMg effectively inhibits HIV infection/replication at both mRNA and protein levels. Investigations of the mechanisms revealed that TLR3 activation of iMg by poly (I:C) induced the expression of both type I and type III IFNs. Compared with untreated cells, the poly (I:C)-treated iMg expressed significantly higher levels of IFN-stimulated genes (ISGs) with known anti-HIV activities (ISG15, MxB, Viperin, MxA, and OAS-1). In addition, TLR3 activation elicited the expression of the HIV entry coreceptor CCR5 ligands (CC chemokines) in iMg. Furthermore, the transcriptional profile analysis showed that poly (I:C)-treated cells had the upregulated IFN signaling genes (ISG15, ISG20, IFITM1, IFITM2, IFITM3, IFITM10, APOBEC3A, OAS-2, MxA, and MxB) and the increased CC chemokine signaling genes (CCL1, CCL2, CCL3, CCL4, and CCL15). These observations indicate that TLR3 is a potential therapy target for activating the intracellular innate immunity against HIV infection/replication in human microglial cells. Therefore, further studies with animal models and clinical specimens are necessary to determine the role of TLR3 activation-driven antiviral response in the control and elimination of HIV in infected host cells.

The roles of critical pro-inflammatory cytokines in the drive of cytokine storm during SARS-CoV-2 infection.

In patients with severe COVID-19, acute respiratory distress syndrome (ARDS), multiple organ dysfunction syndrome (MODS), and even mortality can result from cytokine storm, which is a hyperinflammatory medical condition caused by the excessive and uncontrolled release of pro-inflammatory cytokines. High levels of numerous crucial pro-inflammatory cytokines, such as interleukin-1 (IL-1), IL-2, IL-6, tumor necrosis factor-α, interferon (IFN)-γ, IFN-induced protein 10 kDa, granulocyte-macrophage colony-stimulating factor, monocyte chemoattractant protein-1, and IL-10 and so on, have been found in severe COVID-19. They participate in cascade amplification pathways of pro-inflammatory responses through complex inflammatory networks. Here, we review the involvements of these critical inflammatory cytokines in SARS-CoV-2 infection and discuss their potential roles in triggering or regulating cytokine storm, which can help to understand the pathogenesis of severe COVID-19. So far, there is rarely effective therapeutic strategy for patients with cytokine storm besides using glucocorticoids, which is proved to result in fatal side effects. Clarifying the roles of key involved cytokines in the complex inflammatory network of cytokine storm will help to develop an ideal therapeutic intervention, such as neutralizing antibody of certain cytokine or inhibitor of some inflammatory signal pathways.

Terahertz broadband tunable chiral metamirror based on VO2-metal hybrid structure.

Aiming at the problems of narrow working bandwidth, low efficiency, and complex structure of existing terahertz chiral absorption, we propose a chiral metamirror composed of C-shaped metal split ring and L-shaped vanadium dioxide (VO2). This chiral metamirror is composed of three layers of structure, a gold substrate at the bottom, the first polyethylene cyclic olefin copolymer (Topas) dielectric layer and VO2-metal hybrid structure as the top. Our theoretical results led us to show that this chiral metamirror has a circular dichroism (CD) value greater than 0.9 at 5.70 to 8.55 THz and has a maximum value of 0.942 at f = 7.18 THz. In addition, by adjusting the conductivity of VO2, the CD value can be continuously adjustable from 0 to 0.942, which means that the proposed chiral metamirror supports the free switching of the CD response between the on and off states, and the CD modulation depth exceeds 0.99 in the range of 3 to 10 THz. Moreover, we discuss the influence of structural parameters and the change of incident angle on the performance of the metamirror. Finally, we believe that the proposed chiral metamirror has important reference value in the terahertz range for constructing chiral light detectors, CD metamirrors, switchable chiral absorbers and spin-related systems. This work will provide a new idea for improving the terahertz chiral metamirror operating bandwidth and promote the development of terahertz broadband tunable chiral optical devices.

Multidimensional tunable graphene chiral metasurface based on coherent control.

The deep application of chiral metasurfaces requires higher flexibility. Herein, we propose a multidimensional tunable chiral graphene metasurface, which uses coherent control to obtain more than 0.8 circular conversion dichroism (CCD) at 2.4 THz as a transmission structure. Its operating frequency can be changed in the 1.3-2.4 THz range, while the amplitude has almost perfect modulation depth in the range of 0-0.8. The mechanism of differential absorption was analyzed through numerical simulation. The device designed is easy to obtain reverse CCD, which is used for unit layout and proves its advantages in near-field imaging. Our work has broadened the path for the development of chiral metasurfaces towards higher degrees of freedom.

Adjustable strong circular dichroism based on a tricircular arc metasurface.

Circular dichroism has promising applications in biology, molecular chemistry, and other fields. The key to obtaining strong circular dichroism is to introduce symmetry breaking into the structure, which leads to a great difference in the response to different circularly polarized waves. Here, we propose a metasurface structure based on three circular arcs, which produces strong circular dichroism. The metasurface structure combines the split ring with the three circular arcs and increases the structural asymmetry by changing the relative torsional angle. The causes of the strong circular dichroism are analyzed in this paper, and the influence of metasurface parameters on it is discussed. According to the simulation data, the response of the proposed metasurface to different circularly polarized waves varies greatly, with absorption of up to 0.99 at 5.095 THz for a left-handed circularly polarized wave and a maximum circular dichroism of over 0.93. In addition, the incorporation of the phase change material vanadium dioxide on the structure allows flexible modulation of circular dichroism and modulation depths of up to 98.6%. The change of angle within a certain range has little effect on the structural performance. We believe that this flexible and angle robust chiral metasurface structure is suitable for complex reality, and large modulation depth is more practical.

Ultra-compact on-chip meta-waveguide phase modulator based on split ring magnetic resonance.

With the development of photonic integration technology, meta-waveguides have become a new research hotspot. They have broken through the theoretical diffraction limit by virtue of the strong electromagnetic manipulation ability of the metasurface and the strong electromagnetic field limitation and guidance ability of the waveguide. However, the reported meta-waveguides lack research on dynamic modulation. Therefore, we analyze the modulation effect of the metasurface on the optical field in the waveguide and design an ultra-compact on-chip meta-waveguide phase modulator using split ring magnetic resonance. It has a very short modulation length of only 3.65 µm, wide modulation bandwidth of 116.8 GHz, and low energy consumption of 263.49 fJ/bit. By optimizing the structure, the energy consumption can be further reduced to 90.69 fJ/bit. Meta-waveguides provide a promising method for the design of integrated photonic devices.

Nested micro-ring refractive index sensor based on a subwavelength grating waveguide and the Vernier effect.

In this paper, a nested micro-ring refractive index sensor based on a subwavelength grating waveguide and the Vernier effect is proposed. In this scheme, the nested micro-ring structure is combined with a subwavelength grating structure to enhance the contact area between the optical field and the analyte, and the wavelength offset is doubled through the Vernier effect. The proposed sensor can effectively increase sensing sensitivity, taking into account the improvement of the free spectral range. This structure enables the device to reach a sensitivity of 8030 nm/RIU near 1550 nm wavelength in a deionized water environment, with a detection limit of 5.659×10-5 RIU and free spectral range of 41.956 nm. The device suggested in this study has a greater reduced footprint than the conventional micro-ring resonant sensor, measuring just 35µm×25µm. Due to its high integration, high sensitivity, and large free spectral range compared to conventional micro-ring resonant sensors, such structures are of great value in biosensing and environmental monitoring.

Semi-embedded slot waveguide electro-optic modulator.

Electro-optic modulators are essential devices on silicon photonic chips in modern optical communication networks. This paper presents a compact, low-loss electro-optic modulator. The modulation efficiency is greatly improved by embedding the lower half of the slot waveguide into the buried oxide layer and inserting graphene at the junction. The interaction of graphene with an optical field in a waveguide is studied using the finite element method. The functions of phase modulation and absorption modulation are realized by changing the gate voltage to change the chemical potential of graphene. The semi-embedded slot waveguide optical modulator has a length of 50 µm. After simulation verification, it can be used as an electro-absorption modulator and can achieve a modulation depth of 26.38 dB and an insertion loss of 0.60 dB. When used as an electro-refractive modulator, it can be realized with a linear change of phase from zero to π; the total insertion loss is only 0.59 dB. The modulator has a modulation bandwidth of 79.6 GHz, and the energy consumption as electro-absorption and electro-refraction modulation are 0.51 and 1.92 pj/bit, respectively. Compared with common electro-optic modulators, the electro-optic modulator designed in this paper has a higher modulation effect and also takes into account the advantages of low insertion loss and low energy consumption. This research is helpful for the design of higher-performance optical communication network devices.

Umpolung Asymmetric 1,5-Conjugate Addition via Palladium Hydride Catalysis.

Electronically matched nucleophilic 1,6-conjugate addition has been well studied and widely applied in synthetic areas. In contrast, nucleophilic 1,5-conjugate addition represents an electronically forbidden process and is considered unfeasible. Here, we describe modular protocols for 1,5-conjugate addition reactions via palladium hydride catalysis. Both palladium and synergistic Pd/organocatalyst systems are developed to catalyze 1,5-conjugate reaction, followed by inter- or intramolecular [3+2] cyclization. A migratory 1,5-addition protocol is established to corroborate the feasibility of this umpolung concept. The 1,5-addition products are conveniently transformed into a series of privileged enantioenriched motifs, including polysubstituted tetrahydrofuran, dihydrofuran, cyclopropane, cyclobutane, azetidine, oxetane, thietane, spirocycle and bridged rings. Preliminary mechanistic studies corroborate the involvement of palladium hydride catalysis.

Selective halocyclization and iodosulfonylation of N-benzothiazol-2-yl alkynamides under mild conditions.

The selective halocyclization and iodosulfonylation of N-benzothiazol-2-yl alkynamides under mild conditions is described. An effective synthetic strategy to pyrimidobenzothiazoles via a 6-endo-dig halocyclization of N-benzothiazol-2-yl alkynamides was developed at room temperature with a broad substrate scope. Furthermore, several multisubstituted α,ß-enones were synthesized using the same starting materials.

A label-free electrochemical immunosensor based on a gold-vertical graphene/TiO2 nanotube electrode for CA125 detection in oxidation/reduction dual channels.

A label-free immunosensor was constructed in oxidation and reduction dual channel mode for the trace detection of cancer antigen 125 (CA125) in serum. The gold-vertical graphene/titanium dioxide (Au-VG/TiO2) electrode was used as the signal-amplification platform, and cytosine and dopamine were used as probes in the oxidation and reduction channels, respectively. VG nanosheets were synthesized on a TiO2 nanotube array via chemical vapor deposition (CVD), and Au nanoparticles were deeply embedded on the surface and in the root of the VG nanosheets via electrodeposition. The CA125 antibody was then directly immobilized onto the electrode surface, benefitting from its natural affinity for Au nanoparticles. In the oxidation and reduction channels the CA125 antibody-Au-VG/TiO2 immune electrode had the same response concentration range (0.01-1000 mU∙mL-1) for the determination of the CA125 antigen. However, the oxidation channel had a higher sensitivity (14.82 µA•(log(mU•mL-1))-1 at a working potential of ~ 1.25 V vs. SCE), lower detection limit (0.0001 mU∙mL-1), higher stability, and lower performance deviation than the reduction channel. This immunosensor was successfully used for CA125 detection in human serum. The recoveries of spiked serum samples ranged from 99.8 ± 0.5 to 100 ± 0.4%. The study on the difference in the sensing performance between oxidation and reduction channels provides a preliminary experimental reference for exploring dual-channel synchronous detection immunosensors and verifying the accuracy of the assay based on dual-channel data, which will promote the development of reliable electrochemical immunosensor technology.

Synthesis of Dihydrochromeno[2,3-b]indoles via an Fe(OTf)3-Catalyzed Cascade Reaction.

A tandem cyclization between 2-(2-aminophenyl)acetonitriles and 2-(hydroxy(aryl)methyl)phenols for the preparation of dihydrochromeno[2,3-b]indole derivatives was successfully developed. The transformation proceeded smoothly in the presence of a catalytic environmentally benign iron salt, and various multisubstituted dihydrochromeno[2,3-b]indoles were synthesized in moderate to high yields.

Radical bromination-induced ipso cyclization-ortho cyclization sequence of N-hydroxylethyl-N-arylpropiolamides.

A facile procedure is reported for the synthesis of various 2-bromo-1-phenyl-5,6-dihydro-3H,7aH-benzo[b]pyrrolo[2,1-c][1,4]oxazin-3-ones via a radical bromination-induced ipso cyclization-ortho cyclization sequence of N-arylpropiolamides in the presence of TBAB and oxone. The radical cyclization sequence involves a radical bromo α-addition into the alkyne, ipso-cyclization, and ortho-trapping of the spirocyclic intermediate.

Synthesis of Trifluoromethyl- and Ester Group-Substituted α-Carbolines via Iron-Catalyzed Tandem Cyclization Reaction.

An efficient approach to prepare trifluoromethyl-α-carbolines and ester group-substituted α-carbolines via the tandem cyclization reaction of 2-(2-aminophenyl)acetonitriles and trifluoromethyl 1,3-diones or ß,γ-unsaturated α-ketoesters was reported. The transformation proceeded smoothly in the presence of catalytic environmental-benign iron salts, which are used to prepare the desired products in moderate to good yields.

Palladium-Catalyzed C-4 Selective Coupling of 2,4-Dichloropyridines and Synthesis of Pyridine-Based Dyes for Live-Cell Imaging.

An alternative process of Pd-catalyzed C-4 selective coupling of 2,4-dichloropyridines with boronic esters was developed, which afforded 24 examples of C-4 coupled pyridines in moderate to good yields. After further arylation, 21 examples of C-2, C-4 diarylated pyridines with a significant photophysical property were obtained, which were applied as pyridine-based dyes into live-cell imaging with good biocompatibility and low toxicity.

Ortho-Hydroxylative ipso-Cyclization of N-arylpropiolamide.

A facile protocol for the tunable synthesis of 10-hydroxy-1-azaspiro[4.5]deca-3,6,8-trien-2-ones and benzo[b]pyrrolo[2,1-c][1,4]oxazin-3-ones is described. A tunable synthesis has been realized by the use of ZnBr2/oxone and tetra-n-butylammonium bromide (TBAB)/oxone. The reaction proceeds smoothly with high efficiency and a broad substrate scope. Mechanistic studies indicate that an N-protecting group-assisted ortho-trapping reaction is involved. In the transformation, the reaction undergoes α-addition, ipso-cyclization, and ortho-trapping of the resulting spirocyclic species.