First Report of a Phytoplasma Strain in the Elm Yellows Group (16SrV) associated with Virginia Creeper in Maryland, USA.

Virginia creeper (Parthenocissus quinquefolia [L.] Planch.) is a deciduous flowering vine in the Vitaceae family. Native to eastern North America, it is often used ornamentally as a climbing vine or as ground cover due to its rapid growth and foliage color in the fall. In July of 2022, along exterior walls of a private property in Lanham, MD, two Virginia creeper (VC) vines were observed displaying symptoms of yellow mottling and premature reddening of leaves. To investigate the cause of these symptoms, two symptomatic leaf samples and one asymptomatic leaf samples from a third vine in the same vicinity were collected for further analysis. A Qiagen DNeasy Plant Mini Kit was used to extract total DNA from leaf tissues according to the manufacturer's instructions. A phytoplasma-specific real-time PCR (Hodgetts et al. 2009) was used to test the DNA extracts, which detected the presence of phytoplasmas in the two DNA samples derived from symptomatic vines. The near full-length of the 16S ribosomal RNA gene was then amplified by seminested PCR from these samples with primers P1/16S-SR followed by P1A/16S-SR (Deng, and Hiruki 1991; Lee et al. 2004) and Sanger sequenced using primers P1A and 16S-SR. Analysis of the obtained 16S rDNA sequences revealed no variation between the two plant samples, and one sequence was deposited in GenBank representing the phytoplasma strain named VC-MD1 (GenBank PP746981). A BLASTn search of the 16S rRNA gene sequence in the NCBI nucleotide database, showed 99.93% sequence identity with the phytoplasma strain AldY-WA1 (GenBank MZ557341) from red alder in Washington, a phytoplasma associated with VC plants in southern Florida (GenBank AF305198) (Harrison et al. 2001), and other strains detected in grapevines in Europe described as "flavescence dorée" phytoplasma (GenBank AF176319) (Davis, and Dally 2001). The virtual restriction fragment length polymorphism pattern derived from iPhyClassifier (Zhao et al. 2009), indicated that VC-MD1 is indeed a member of the 16SrV-C phytoplasma subgroup. To confirm the identification, the partial spc operon and the partial tuf gene were amplified as previously described (Lee et al. 2010; Makarova et al. 2012). Specifically, the spc operon region was amplified using a nested PCR approach with primer set L15F1A-a/MapR1 followed by L15F1A-b/MapR1A-b. Sequence data obtained from the two loci were deposited to GenBank with accession numbers PP746982 (spc) and PP746983 (tuf). BLAST searches querying the nucleotide sequences of the spc operon and tuf gene showed 95.39% and 99.05% identity, respectively, to the corresponding loci of 'Candidatus Phytoplasma rubi' strain RS (GenBank CP114006) and hemp dogbane yellows phytoplasma strain HD1 (GenBank FR686506). Phylogenetic analysis based on secY and tuf gene sequences suggest that the VC-MD1 strain is evolutionary closest to 16SrV-C phytoplasma strains detected in various hosts in the United States, including HD1 and AldY-WA1. These North American strains cluster together on a distinct branch within the elm yellows group phytoplasmas. For the State of Maryland, this detection represents the first report of a phytoplasma strain member of the16SrV-C subgroup infecting VC plants. A phytoplasma of the same subgroup was previously detected in Florida in asymptomatic VC vines (Harrison et al. 2001). The 16S rRNA gene sequences of the two VC phytoplasma strains are nearly identical, differing by just a single nucleotide. The disease transmission vectors of the VC-MD1 strain and the prevalence of the disease in the region remains undetermined.

Genetic Analysis of the Emerging Citrus Yellow Vein Clearing Virus Reveals a Divergent Virus Population in American Isolates.

Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

First report of Passion fruit green spot virus in yellow Passion fruit (Passiflora edulis f. flavicarpa) in Casanare, Colombia.

Passiflora edulis, commonly known as passion fruit, is a vine species of passionflower native to South America. In Colombia, yellow passion fruit (P. edulis f. flavicarpa) is the most important species in terms of net production and local consumption. Recently two brevipalpus transmitted cileviruses, (i) passion fruit green spot virus (PfGSV) and (ii) hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) were detected in passion fruit in Brazil and Hawaii, respectively (Ramos-González et al., 2020, Olmedo-Velarde et al., 2022). CiLV-C2H infects both citrus and hibiscus in Colombia (Roy et al., 2015, 2018) but there was no report of PfGSV elsewhere apart from Brazil and Paraguay (Costa-Rodrigues et al., 2022). Apart from emerging begomovirus diseases, five major viruses are known to infect passion fruit in Colombia: soybean mosaic virus (SMV), cowpea aphid-borne mosaic virus, passion fruit yellow mosaic virus, cucumber mosaic virus, and a tentative Gulupa bacilliform badnavirus A (Cardona et al., 2022). Current findings of CiLV-C2H in passion fruit and PfGSV in hibiscus motivated us to investigate the possibilities of cilevirus infection in passion fruit in Colombia. During surveys, along with healthy yellow passion fruit leaves, five symptomatic plant samples from Meta and three from Casanare were collected before sent to the Molecular Plant Pathology Laboratory at Beltsville, MD under APHIS permit. Passion fruit samples from Meta showed leaf mottling, rugose mosaic, and leaf distortion, whereas leaf variegation, chlorotic spots, yellowing, green spots in senescent leaves and green vein banding were observed in the Casanare samples (Supp. Fig. 1). Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, USA). To know the potential cilevirus infection in these samples, three PfGSV specific (Ramos-González et al. 2020) and a CiLV-C2 generic primer pairs (Olmedo-Velarde et al. 2021) were used in the RT-PCR assays. All five passion fruit samples from Meta failed to produce either CiLV-C2 or CiLV-C2H or PfGSV amplicon whereas all three Casanare samples successfully amplified 321, 244 and 299 nts of PfGSV-RNA1 and -RNA2 amplicons using C13F/C13R, C6F/C6R and C8F/C8R primers, respectively. Bi-directional amplicon sequencing followed by BlastN analysis revealed ≥99% nt identity with the PfGSV-RNA1 (MK804173) and -RNA2 (MK804174) genome sequences. An optimized ribo-depleted library preparation protocol was utilized to prepare two cDNA libraries using the RNA extracts of a PfGSV suspected positive (Casanare) and a negative (Meta) samples (Chellappan et al., 2022). HTS libraries of Casanare and Meta samples resulted in 22.7 to 29.5 million raw reads, respectively. After adapter trimming and filtering, clean reads were mapped to the Arabidopsis thaliana reference genome and unmapped reads were de novo assembled (Chellappan et al., 2022). BlastN analysis from the assembled contigs identified 1-3 contigs corresponding to PfGSV-RNA1 and -RNA2, respectively, from Casanare sample whereas 3 contigs of SMV were identified in Meta passion fruit sample. No other virus sequence was obtained from either of the libraries. Assembled contigs covered 99.33% of the RNA1 and 94.42% of the RNA2 genome, with read depths of 64,474 and 119,549, respectively. Meta sample contigs (OP564897) covered >99% of the SMV genome, which shared >99% nt identity with the Colombian SMV isolates (KY249378, MW655827). Both RNA-1 (OP564895) and -2 (OP564896) segments of the Casanare isolate shared 99% nt identity with PfGSV isolate (MK804173-74). Our discovery identified PfGSV in Colombia, for the first-time outside Brazil and Paraguay. The findings of PfGSV in yellow passion fruit increases the potential threat and possibility of PfGSV movement via Brevipalpus sp. from passion fruit to other hosts.

First report of the hibiscus strain of citrus leprosis virus C2 infecting passionfruit (Passiflora edulis).

In Hawaii, passionfruit (Passiflora edulis; Passifloraceae) is grown primarily in residential properties and community gardens (CG). In 2019, passionfruit plants displaying chlorotic spots on young leaves, and green spots in senescing leaves were observed at two CG in Honolulu. Symptoms resembled those of passionfruit green spot virus (PfGSV) infection in Passiflora spp. (Ramos-González et al. 2020) and of the hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) infection in hibiscus in Hawaii (Melzer et al. 2013). Both viruses belong to the genus Cilevirus, family Kitaviridae. Total RNA was extracted from two sample pools comprised of 40 symptomatic leaves collected from both the CG following a CTAB-based procedure (Li et al. 2008). To identify the virus associated with the P. edulis infection, reverse transcription (RT)-polymerase chain reaction (PCR) was performed using CiLV-C2 (Olmedo-Velarde et al. 2021) and PfGSV specific primers (Ramos-González et al. 2020). RT-PCR assay amplified the CiLV-C2 amplicon but failed to produce the PfGSV amplicon from infected leaves. Amplicon sequencing followed by a BLASTn search showed the nucleotide sequence had >99% identity with the CiLV-C2H-RNA1 (KC626783). A ribo-depleted RNA library created using the TruSeq Stranded Total RNA Library Prep kit (Illumina) underwent high throughput sequencing (HTS) on a NextSeq550 Illumina platform (2x75 cycles). The 6.5 million raw reads obtained were trimmed, filtered, and de novo assembled using Metaviral SPAdes v. 3.15.02 (Antipov et al. 2020). The resulting contigs were searched against an in-house database generated from GenBank virus and viroid sequences using BLASTn. This identified 12 and 3 contigs corresponding to CiLV-C2H and watermelon mosaic virus, respectively, with the latter being previously reported in passionfruit (Watanabe et al. 2016). RNA1 contigs covered 80.17% of the CiLV-C2H genome, whereas RNA2 contigs covered 94.5% with an average coverage depth of 31.660 and 57.121, respectively. To obtain the near complete genome of CiLV-C2H, gaps from the assembled HTS data were filled by overlapping RT-PCR followed by Sanger sequencing. RNA1 (8,536 nt, Acc. No. MW413437) and RNA2 (4,878 nt, MW413438) genome sequences shared 99.2% and 97.0% identity with CiLV-C2H-RNA1 (KC626783) and -RNA2 (KC626784). To further confirm the presence of CiLV-C2H in symptomatic P. edulis plants, 40 symptomatic leaf samples were individually tested by RT-PCR, and 30 samples were positive. Brevipalpus mites collected from CiLV-C2H-positive P. edulis leaves were transferred to common bean (Phaseolus vulgaris) seedlings (Garita et al. 2013). At 15-30 days post-transfer, RNA extracted from lesions observed in recipient plants tested positive for CiLV-C2H by RT-PCR. Total RNA from individual Brevipalpus mites was isolated, and cDNA was prepared to tentatively identify the mite species involved in CiLV-C2H transmission in passionfruit (Druciarek et al 2019, Olmedo-Velarde et al. 2021). CiLV-C2H was detected in individual mites, and the 28S ribosomal mite RNA sequence (MZ478051) shared 99-100% nucleotide identity with B. yothersi (MK293678 and MT812697), a vector of CiLV-C2 (Roy et al. 2013). CiLV-C2 currently has a host range limited to the families Malvaceae, Araceae, and Rutaceae (Roy et al. 2015). CiLV-C2H infects hibiscus alone and citrus in mixed infection with CiLV-C2 (Roy et al; 2018) which is responsible for causing citrus leprosis disease. Detection of CiLV-C2H in passionfruit expands the number of host families of CiLV-C2H.

Smilax auriculata: A new host for Orchid fleck dichorhavirus identified in Florida, USA.

In June 2020, Orchid fleck virus (OFV) was detected in a species of Liriope in Leon and Alachua County, Florida (Fife et al; 2021). In October of the same year, four adjacent dune/ear-leaf greenbrier vines, Smilax auriculata (Smilaceae: Liliales), showed yellowing and mottling symptoms (Figure 1). Infected and healthy S. auriculata leaves samples were collected in Alachua County by the Florida Department of Agriculture and Consumer Services, Gainesville, Florida. OFV primers successfully detected in four Smilax samples by conventional RT-PCR assay. Amplicon sequences (Acc. No. MZ645935 and MZ645938) shared 99% nucleotide identity with OFV infecting orchids (LC222629) and citrus (MK522804). The OFV subgroup I (OFV-Orc1) and subgroup II (OFV-Orc2) specific primers (Kondo et al 2017) were utilized to confirm the presence of OFV type strains infecting Smilax. Sanger sequencing of subgroup I specific amplicons (MZ645934) shared 99% nucleotide identity with OFV-Orc1 (LC222629) whereas subgroup II specific amplicon sequence (MZ645930) shared 98-99 % nucleotide identity with OFV-Orc2 (AB244417). Further confirmation was done by USDA-APHIS-PPQ-Plant Pathogen Confirmatory Diagnostics Laboratory utilizing optimized conventional RT-PCR protocols (Roy et al. 2020) and deep sequencing on a on a NextSeq550 Illumina platform. Assembled reads identified seven non-overlapping viral contigs. Five RNA1 and two RNA2 contigs covered more than 97% of the bipartite OFV genome with average coverage depth of 5297.61 and 5186.04, respectively. Contigs of RNA1 and RNA2 shared 98-99% nt identity to OFV-Orc2-RNA1 (AB244417) and OFV-Orc-RNA2 (AB244418 and LC222630). No other pathogen sequences were identified. This is the first time the genus Smilax has been identified as a natural host of OFV. Very recent findings of OFV-Orc in Florida in Liriope, Aspidistra, and Ophiopogon among the Asparagaceae family members (Fife et al; 2021) and now in the Smilacaceae suggest a broader host range of the virus than previously known; further research should be conducted to better characterize the potential risk of introduction into citrus in Florida.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Genome Resource for the Huanglongbing Causal Agent 'Candidatus Liberibacter asiaticus' Strain AHCA17 from Citrus Root Tissue in California, USA.

'Candidatus Liberibacter asiaticus' is the unculturable causative agent of citrus huanglongbing disease. Here, we report the first citrus root metagenome sequence containing the draft genome of 'Ca. L. asiaticus' strain AHCA17, obtained from a pummelo tree in California. The assembled genome was 1.2 Mbp and resulted in 37 contigs (N50 = 158.7 kbp) containing 1,057 predicted open reading frames and 45 RNA-coding genes. This draft genome will provide a valuable resource in further study of 'Ca. L. asiaticus' genome diversity and pathogen epidemiology.

Estimation of contemporary effective population size and population declines using RAD sequence data.

Large genomic data sets generated with restriction site-associated DNA sequencing (RADseq), in combination with demographic inference methods, are improving our ability to gain insights into the population history of species. We used a simulation approach to examine the potential for RADseq data sets to accurately estimate effective population size (N e) over the course of stable and declining population trends, and we compare the ability of two methods of analysis to accurately distinguish stable from steadily declining populations over a contemporary time scale (20 generations). Using a linkage disequilibrium-based analysis, individual sampling (i.e., n ≥ 30) had the greatest effect on N e estimation and the detection of population size declines, with declines reliably detected across scenarios ~10 generations after they began. Coalescent-based inference required fewer sampled individuals (i.e., n = 15), and instead was most influenced by the size of the SNP data set, with 25,000-50,000 SNPs required for accurate detection of population trends and at least 20 generations after decline began. The number of samples available and targeted number of RADseq loci are important criteria when choosing between these methods. Neither method suffered any apparent bias due to the effects of allele dropout typical of RAD data. With an understanding of the limitations and biases of these approaches, researchers can make more informed decisions when designing their sampling and analyses. Overall, our results reveal that demographic inference using RADseq data can be successfully applied to infer recent population size change and may be an important tool for population monitoring and conservation biology.

Genomic data detect corresponding signatures of population size change on an ecological time scale in two salamander species.

Understanding the demography of species over recent history (e.g. <100 years) is critical in studies of ecology and evolution, but records of population history are rarely available. Surveying genetic variation is a potential alternative to census-based estimates of population size, and can yield insight into the demography of a population. However, to assess the performance of genetic methods, it is important to compare their estimates of population history to known demography. Here, we leveraged the exceptional resources from a wetland with 37 years of amphibian mark-recapture data to study the utility of genetically based demographic inference on salamander species with documented population declines (Ambystoma talpoideum) and expansions (A. opacum), patterns that have been shown to be correlated with changes in wetland hydroperiod. We generated ddRAD data from two temporally sampled populations of A. opacum (1993, 2013) and A. talpoideum (1984, 2011) and used coalescent-based demographic inference to compare alternate evolutionary models. For both species, demographic model inference supported population size changes that corroborated mark-recapture data. Parameter estimation in A. talpoideum was robust to our variations in analytical approach, while estimates for A. opacum were highly inconsistent, tempering our confidence in detecting a demographic trend in this species. Overall, our robust results in A. talpoideum suggest that genome-based demographic inference has utility on an ecological scale, but researchers should also be cognizant that these methods may not work in all systems and evolutionary scenarios. Demographic inference may be an important tool for population monitoring and conservation management planning.

Patterns of amphibian infection prevalence across wetlands on the Savannah River Site, South Carolina, USA.

Amphibian diseases, such as chytridiomycosis caused by Batrachochytrium dendrobatidis (Bd) and ranaviral disease caused by ranaviruses, are often linked to global amphibian population declines, yet the ecological dynamics of both pathogens are poorly understood. The goal of our study was to determine the baseline prevalence, pathogen loads, and co-infection rate of Bd and ranavirus across the Savannah River Site (SRS) in South Carolina, USA, a region with rich amphibian diversity and a history of amphibian-based research. We tested over 1000 individuals, encompassing 21 amphibian species from 11 wetlands for both Bd and ranavirus. The prevalence of Bd across individuals was 9.7%. Using wetland means, the mean (±SE) Bd prevalence was 7.9 ± 2.9%. Among toad species, Anaxyrus terrestris had 95 and 380% greater odds of being infected with Bd than Scaphiopus holbrookii and Gastrophryne carolinensis, respectively. Odds of Bd infection in adult A. terrestris and Lithobates sphenocephalus were 75 to 77% greater in metal-contaminated sites. The prevalence of ranavirus infections across all individuals was 37.4%. Mean wetland ranavirus prevalence was 29.8 ± 8.8% and was higher in post-metamorphic individuals than in aquatic larvae. Ambystoma tigrinum had 83 to 85% higher odds of ranavirus infection than A. opacum and A. talpoideum. We detected a 4.8% co-infection rate, with individuals positive for ranavirus having a 5% higher occurrence of Bd. In adult Anaxyrus terrestris, odds of Bd infection were 13% higher in ranavirus-positive animals and odds of co-infection were 23% higher in contaminated wetlands. Overall, we found the pathogen prevalence varied by wetland, species, and life stage.

Go west: Population genomics reveals unexpected population fluctuations and little gene flow in Western hemisphere populations of the predatory lady beetle, Hippodamia convergens.

Hippodamia convergens-the convergent lady beetle, has been used extensively in augmentative biological control of aphids, thrips, and whiteflies across its native range in North America, and was introduced into South America in the 1950s. Overwintering H. convergens populations from its native western range in the United States are commercially collected and released across its current range in the eastern USA, with little knowledge of the effectiveness of its augmentative biological control. Here we use a novel ddRADseq-based SNP/haplotype discovery approach to estimate its range-wide population diversity, differentiation, and recent evolutionary history. Our results indicate (1) significant population differentiation among eastern USA, western USA, and South American populations of H. convergens, with (2) little to no detectable recent admixture between them, despite repeated population augmentation, and (3) continued recent population size expansion across its range. These results contradict previous findings using microsatellite markers. In light of these new findings, the implications for the effectiveness of augmentative biological control using H. convergens are discussed. Additionally, because quantifying the non-target effects of augmentative biological control is a difficult problem in migratory beetles, our results could serve as a cornerstone in improving and predicting the efficacy of future releases of H. convergens across its range.

Meta-Transcriptomic Analysis Uncovers the Presence of Four Novel Viruses and Multiple Known Virus Genera in a Single Hibiscus rosa-sinensis Plant in Colombia.

Hibiscus is not native to Colombia but well suited to its arid soil and dry climates. A single hibiscus plant from Risaralda, showing black spots on upper and lower sides of its leaves, was collected for virome analysis using meta-transcriptomic high-throughput sequencing technology. Bioinformatic analysis identified 12.5% of the total reads in the Ribo-Zero cDNA library which mapped to viral genomes. BLAST searches revealed the presence of carlavirus, potexvirus, and of known members of the genera Betacarmovirus, Cilevirus, Nepovirus, and Tobamovirus in the sample; confirmed by RT-PCR with virus-specific primers followed by amplicon sequencing. Furthermore, in silico analysis suggested the possibility of a novel soymovirus, and a new hibiscus strain of citrus leprosis virus C2 in the mixed infection. Both RNA dependent RNA polymerase and coat protein gene sequences of the potex and carla viruses shared less than 72% nucleotide and 80% amino acid identities with any alphaflexi- and betaflexi-virus sequences available in GenBank, identifying three novel carlavirus and one potexvirus species in the Hibiscus rosa-sinensis plant. The detection of physalis vein necrosis nepovirus and passion fruit green spot cilevirus in hibiscus are also new reports from Colombia. Overall, the meta-transcriptome analysis identified the complex virome associated with the black spot symptoms on hibiscus leaves and demonstrated the diversity of virus genera tolerated in the mixed infection of a single H. rosa-sinensis plant.

Characterization of 42 polymorphic microsatellite loci in Mimulus ringens (Phrymaceae) using Illumina sequencing.

PREMISE OF THE STUDY: Microsatellite markers were isolated and characterized in Mimulus ringens (Phrymaceae), a herbaceous wetland perennial, to facilitate studies of mating patterns and population genetic structure. • METHODS AND RESULTS: A total of 42 polymorphic loci were identified from a sample of 24 individuals from a single population in Ohio, USA. The number of alleles per locus ranged from two to nine, and median observed heterozygosity was 0.435. • CONCLUSIONS: This large number of polymorphic loci will enable researchers to quantify male fitness, patterns of multiple paternity, selfing, and biparental inbreeding in large natural populations of this species. These markers will also permit detailed study of fine-scale patterns of genetic structure.

Development and characterization of microsatellite markers for Berberis thunbergii (Berberidaceae).

PREMISE OF THE STUDY: Microsatellite markers were isolated and characterized in Berberis thunbergii, an invasive and ornamental shrub in the eastern United States, to assess genetic diversity among populations and potentially identify horticultural cultivars. METHODS AND RESULTS: A total of 12 loci were identified for the species. Eight of the loci were polymorphic and were screened in 24 individuals from two native (Tochigi and Ibaraki prefectures, Japan) and one invasive (Connecticut, USA) population and 21 horticultural cultivars. The number of alleles per locus ranged from three to seven, and observed heterozygosity ranged from 0.048 to 0.636. CONCLUSIONS: These new markers will provide tools for examining genetic relatedness of B. thunbergii plants in the native and invasive range, including phylogeographic studies and assessment of rapid evolution in the invasive range. These markers may also provide tools for examining hybridization with other related species in the invasive range.

High-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex.

Citrus leprosis (CiL) is one of the destructive emerging viral diseases of citrus in the Americas. Leprosis syndrome is associated with two taxonomically distinct groups of Brevipalpus-transmitted viruses (BTVs), that consist of positive-sense Cilevirus, Higrevirus, and negative-sense Dichorhavirus. The localized CiL symptoms observed in multiple citrus species and other alternate hosts indicates that these viruses might have originated from the mites and eventually adopted citrus as a secondary host. Genetic diversity in the genomes of viruses associated with the CiL disease complex have complicated current detection and diagnostic measures that prompted the application of High-Throughput Sequencing (HTS) protocols for improved detection and diagnosis. Two cileviruses are known to infect citrus, and among them only citrus leprosis virus C2 (CiLV-C2) hibiscus strain (CiLV-C2H) has been reported in hibiscus and passion fruit in the US. Based on our current CiL disease complex hypothesis, there is a high probability that CiL disease is associated with more viruses/strains that have not yet been identified but exist in nature. To protect the citrus industry, a Ribo-Zero HTS protocol was utilized for detection of cileviruses infecting three different hosts: Citrus spp., Swinglea glutinosa, and Hibiscus rosa-sinensis. Real-time RT-PCR assays were used to identify plants infected with CiLV-C2 or CiLV-C2H or both in mixed infection in all the above-mentioned plant genera. These results were further confirmed by bioinformatic analysis using HTS generated data. In this study, we utilized HTS assay in confirmatory diagnostics to screen BTVs infecting Dieffenbachia sp. (family: Araceae), Passiflora edulis (Passifloraceae), and Smilax auriculata (Smilacaceae). Through the implementation of HTS and downstream data analysis, we detected not only the known cileviruses in the studied hosts but also discovered a new strain of CiLV-C2 in hibiscus from Colombia. Phylogenetically, the new hibiscus strain is more closely related to CiLV-C2 than the known hibiscus strain, CiLV-C2H. We propose this strain to be named as CiLV-C2 hibiscus strain 2 (CiLV-C2H2). The findings from the study are critical for citrus growers, industry, regulators, and researchers. The possible movement of CiLV-C2H2 from hibiscus to citrus by the Brevipalpus spp. warrants further investigation.

Comparative Analysis of Tomato Brown Rugose Fruit Virus Isolates Shows Limited Genetic Diversity.

Tomato is an important vegetable in the United States and around the world. Recently, tomato brown rugose fruit virus (ToBRFV), an emerging tobamovirus, has impacted tomato crops worldwide and can result in fruit loss. ToBRFV causes severe symptoms, such as mosaic, puckering, and necrotic lesions on leaves; other symptoms include brown rugose and marbling on fruits. More importantly, ToBRFV can overcome resistance in tomato cultivars carrying the Tm-22 locus. In this study, we recovered ToBRFV sequences from tomato seeds, leaves, and fruits from the U.S., Mexico, and Peru. Samples were pre-screened using a real-time RT-PCR assay prior to high-throughput sequencing. Virus draft genomes from 22 samples were assembled and analyzed against more than 120 publicly available genomes. Overall, most sequenced isolates were similar to each other and did not form a distinct population. Phylogenetic analysis revealed three clades within the ToBRFV population. Most of the isolates (95%) clustered in clade 3. Genetic analysis revealed differentiation between the three clades indicating minor divergence occurring. Overall, pairwise identity showed limited genetic diversity among the isolates in this study with worldwide isolates, with a pairwise identity ranging from 99.36% and 99.97%. The overall population is undergoing high gene flow and population expansion with strong negative selection pressure at all ToBRFV genes. Based on the results of this study, it is likely that the limited ToBRFV diversity is associated with the rapid movement and eradication of ToBRFV-infected material between countries.

Mutations in a Novel Cadherin Gene Associated with Bt Resistance in Helicoverpa zea.

Transgenic corn and cotton produce crystalline (Cry) proteins derived from the soil bacterium Bacillus thuringiensis (Bt) that are toxic to lepidopteran larvae. Helicoverpa zea, a key pest of corn and cotton in the U.S., has evolved widespread resistance to these proteins produced in Bt corn and cotton. While the genomic targets of Cry selection and the mutations that produce resistant phenotypes are known in other lepidopteran species, little is known about how selection by Cry proteins shape the genome of H. zea We scanned the genomes of Cry1Ac-selected and unselected H. zea lines, and identified twelve genes on five scaffolds that differed between lines, including cadherin-86C (cad-86C), a gene from a family that is involved in Cry1A resistance in other lepidopterans. Although this gene was expressed in the H. zea larval midgut, the protein it encodes has only 17 to 22% identity with cadherin proteins from other species previously reported to be involved in Bt resistance. An analysis of midgut-expressed cDNAs showed significant between-line differences in the frequencies of putative nonsynonymous substitutions (both SNPs and indels). Our results indicate that cad-86C is a likely target of Cry1Ac selection in H. zea It remains unclear, however, whether genomic changes at this locus directly disrupt midgut binding of Cry1Ac and cause Bt resistance, or indirectly enhance fitness of H. zea in the presence of Cry1Ac by some other mechanism. Future work should investigate phenotypic effects of these nonsynonymous substitutions and their impact on fitness of H. zea larvae that ingest Cry1Ac.

Complete Genome Sequence of a Tomato Brown Rugose Fruit Virus Isolated in the United States.

The complete genome sequence of a U.S. isolate of a Tomato brown rugose fruit virus (ToBRFV) (CA18-01) was obtained through Illumina and MinION sequencing. The U.S. ToBRFV isolate shared a high nucleic acid sequence identity (>99%) with known ToBRFV isolates. Phylogenetic analysis revealed a tight cluster for ToBRFV isolates throughout the world, suggesting a short evolutionary history.