Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 31
Filtrar
1.
J Biol Chem ; 300(1): 105487, 2024 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-37995941

RESUMEN

Oligodendrocyte precursor cells are present in the adult central nervous system, and their impaired ability to differentiate into myelinating oligodendrocytes can lead to demyelination in patients with multiple sclerosis, accompanied by neurological deficits and cognitive impairment. Exosomes, small vesicles released by cells, are known to facilitate intercellular communication by carrying bioactive molecules. In this study, we utilized exosomes derived from human umbilical cord mesenchymal stem cells (HUMSCs-Exos). We performed sequencing and bioinformatics analysis of exosome-treated cells to demonstrate that HUMSCs-Exos can stimulate myelin gene expression in oigodendrocyte precursor cells. Functional investigations revealed that HUMSCs-Exos activate the Pi3k/Akt pathway and regulate the Tbr1/Wnt signaling molecules through the transfer of miR-23a-3p, promoting oligodendrocytes differentiation and enhancing the expression of myelin-related proteins. In an experimental autoimmune encephalomyelitis model, treatment with HUMSCs-Exos significantly improved neurological function and facilitated remyelination. This study provides cellular and molecular insights into the use of cell-free exosome therapy for central nervous system demyelination associated with multiple sclerosis, demonstrating its great potential for treating demyelinating and neurodegenerative diseases.


Asunto(s)
Exosomas , Células Madre Mesenquimatosas , MicroARNs , Esclerosis Múltiple , Remielinización , Adulto , Humanos , Diferenciación Celular/genética , Exosomas/metabolismo , Células Madre Mesenquimatosas/citología , Células Madre Mesenquimatosas/metabolismo , MicroARNs/metabolismo , MicroARNs/farmacología , MicroARNs/uso terapéutico , Esclerosis Múltiple/genética , Esclerosis Múltiple/terapia , Esclerosis Múltiple/metabolismo , Fosfatidilinositol 3-Quinasas/metabolismo , Remielinización/efectos de los fármacos , Remielinización/genética , Cordón Umbilical/citología , Cordón Umbilical/metabolismo , Vía de Señalización Wnt/efectos de los fármacos , Transducción de Señal/efectos de los fármacos , Transducción de Señal/genética , Proteínas de Dominio T Box/metabolismo , Modelos Animales de Enfermedad , Células Cultivadas
2.
Hum Genomics ; 17(1): 38, 2023 04 25.
Artículo en Inglés | MEDLINE | ID: mdl-37098594

RESUMEN

BACKGROUND: At present, the methods generally used to detect α-thalassemia mutations are confined to detecting common mutations, which may lead to misdiagnosis or missed diagnosis. The single-molecule real-time (SMRT) sequencing enables long-read single-molecule sequencing with high detection accuracy, and long-length DNA chain reads in high-fidelity read mode. This study aimed to identify novel large deletions and complex variants in the α-globin locus in Chinese population. METHODS: We used SMRT sequencing to detect rare and complex variants in the α-globin locus in four individuals whose hematological data indicated microcytic hypochromic anemia. However, the conventional thalassemia detection result was negative. Multiplex ligation-dependent probe amplification and droplet digital polymerase chain reaction were used to confirm SMRT sequencing results. RESULTS: Four novel large deletions were observed ranging from 23 to 81 kb in the α-globin locus. One patient also had a duplication of upstream of HBZ in the deletional region, while another, with a 27.31-kb deletion on chromosome 16 (hg 38), had abnormal hemoglobin Siriraj (Hb Siriraj). CONCLUSION: We first identified the four novel deletions in the α-globin locus using SMRT sequencing. Considering that the conventional methods might lead to misdiagnosis or missed diagnosis, SMRT sequencing proved to be an excellent method to discover rare and complex variants in thalassemia, especially in prenatal diagnosis.


Asunto(s)
Pueblos del Este de Asia , Globinas alfa , Humanos , Globinas alfa/genética , Talasemia alfa/genética , Anemia Hipocrómica/genética , Pueblos del Este de Asia/genética , Mutación
3.
Hum Genomics ; 17(1): 111, 2023 Dec 08.
Artículo en Inglés | MEDLINE | ID: mdl-38062488

RESUMEN

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.


Asunto(s)
Talasemia beta , Embarazo , Femenino , Humanos , Talasemia beta/genética , Globinas beta/genética , Diagnóstico Prenatal , Eliminación de Secuencia/genética , China , Mutación
4.
J Neurochem ; 165(6): 759-771, 2023 06.
Artículo en Inglés | MEDLINE | ID: mdl-37095635

RESUMEN

Ferroptosis is a newly discovered programmed cell death caused by intracellular iron excess and glutathione (GSH) system imbalance, resulting in fatal lipid peroxidation. It is different from necrosis, apoptosis, autophagy, and other forms of cell death. Accumulating evidences suggest that brain iron overload is involved in the pathogenesis of demyelinating diseases of the central nervous system (CNS), such as multiple sclerosis (MS), neuromyelitis optica (NMO), and acute disseminated encephalomyelitis (ADEM). The study of ferroptosis may provide a new understanding of demyelinating diseases and provide a novel therapeutic target for clinical treatment. Herein, we reviewed recent discoveries on mechanisms of ferroptosis, the effects of metabolic pathways on ferroptosis, and its involvement in CNS demyelinating diseases.


Asunto(s)
Enfermedades del Sistema Nervioso Central , Ferroptosis , Sobrecarga de Hierro , Esclerosis Múltiple , Neuromielitis Óptica , Humanos , Sistema Nervioso Central
5.
Hemoglobin ; 46(4): 245-248, 2022 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-36210651

RESUMEN

ß-Thalassemia (ß-thal), a highly prevalent disease in tropical and subtropical regions of Southern China, is caused mainly by point mutations in the ß-globin gene cluster. However, large deletions have also been found to contribute to some types of ß-thal. We identified a novel 5 kb deletion in the ß-globin cluster in a Chinese patient using multiplex ligation-dependent probe amplification (MLPA), and characterized it with single molecule real-time (SMRT) sequencing, gap-polymerase chain reaction (gap-PCR) and Sanger sequencing. The deletion was located between positions 5226189 and 5231091 on chromosome 11 (GRCh38), extending from 4 kb upstream of the 5' untranslated region (5'UTR) to the second intron of the ß-globin gene. The patient with this deletion presented with microcytosis and hypochromic red cells, as well as relatively high Hb F and Hb A2 levels. Our research indicated that SMRT sequencing is a useful tool for accurate detection of large deletions. Our study broadens the spectrum of deletional ß-thalassemias and provides a perspective for further study of the function of the ß-globin cluster.


Asunto(s)
Globinas beta , Talasemia beta , Humanos , Globinas beta/genética , Talasemia beta/diagnóstico , Talasemia beta/genética , Eliminación de Gen , Familia de Multigenes , Reacción en Cadena de la Polimerasa Multiplex , Eliminación de Secuencia
6.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 32(2): 226-8, 2015 Apr.
Artículo en Zh | MEDLINE | ID: mdl-25863092

RESUMEN

OBJECTIVE: Diagnosis and prenatal diagnosis to a family of hemoglobin variant with α-thalassemia. METHODS: Whole blood cell analysis, hemoglobin analysis by capillary zone electrophoresis (CZE), Gap-PCR, polymerase chain reaction-reverse dot blot (PCR-RDB) assay and DNA sequencing. RESULTS: Hb Zurich Albisrieden with α°-thalassemia lead to severe anemia. The genotype of fetus is also Hb Zurich Albisrieden with α°-thalassemia. CONCLUSION: Abnormal hemoglobin with α-thalassemia may lead to severe anemia, Prenatal diagnosis of thalassemia has the vital significance for eugenic birth.


Asunto(s)
Enfermedades Fetales/genética , Hemoglobinas Anormales/genética , Talasemia alfa/genética , Adulto , Secuencia de Bases , Preescolar , Femenino , Enfermedades Fetales/sangre , Enfermedades Fetales/diagnóstico , Hemoglobinas Anormales/metabolismo , Humanos , Masculino , Datos de Secuencia Molecular , Embarazo , Diagnóstico Prenatal , Adulto Joven , Talasemia alfa/sangre , Talasemia alfa/diagnóstico , Talasemia alfa/embriología
7.
Sci Rep ; 14(1): 6682, 2024 03 20.
Artículo en Inglés | MEDLINE | ID: mdl-38509195

RESUMEN

Abnormal hemoglobin anti-Lepore Hong Kong is a rare ßδ fusion variants resulting from non-homologous crossover during meiosis. Anti-Lepore Hong Kong is known to consistently exhibit significantly increased level of HbA2. In this study, we used multiplex ligation-dependent probe amplification (MLPA) and single molecular real-time (SMRT) sequencing, as well as Sanger sequencing, to identify variants in five unrelated families with abnormal elevated HbA2 level. All probands in these five families were found to be heterozygous for anti-Lepore Hong Kong. Among them, two families showed co-occurrence of ß0-thalassemia and α-thalassemia (-SEA/ or αCSα/). Heterozygotes for anti-Lepore Hong Kong displayed an average HbA2 level of 17.7% and behaved normal. However, when combined with ß0-thalassemia and α-thalassemia, the probands exhibited higher HbA2 level (30.2-40.8%) and behaved with ß-thalassemia trait. Furthermore, determination of the α/ß-mRNA ratio revealed a slight downregulation of ß-globin, similar to that of ß-thalassemia minor. Our study is the first to identify compound heterozygotes for anti-Lepore Hong Kong, ß0-thalassemia and α-thalassemia, provide valuable information for prenatal counseling.


Asunto(s)
Hemoglobinas Anormales , Talasemia alfa , Talasemia beta , Humanos , Embarazo , Femenino , Talasemia alfa/genética , Hemoglobinas Anormales/genética , Talasemia beta/genética , Globinas beta/genética
8.
Hematology ; 28(1): 2184118, 2023 12.
Artículo en Inglés | MEDLINE | ID: mdl-36867091

RESUMEN

OBJECTIVE: In the present study, two unrelated cases of Hb Q-Thailand heterozygosity unlinked with the (-α4.2/) α+-thalassemia deletion allele were identified by long-read single molecule real-time (SMRT) sequencing in southern China. The aim of this study was to report the hematological and molecular features as well as diagnostic aspects of the rare manifestation. METHODS: Hematological parameters and hemoglobin analysis results were recorded. A suspension array system for routine thalassemia genetic analysis and long-read SMRT sequencing were applied in parallel for thalassemia genotyping. Traditional methods, including Sanger sequencing, multiplex gap-polymerase chain reaction (gap-PCR) and multiplex ligation-dependent probe amplification (MLPA), were used together to confirm the thalassemia variants. RESULTS: Long-read SMRT sequencing was used to diagnose two Hb Q-Thailand heterozygous patients for whom the hemoglobin variant was unlinked to the (-α4.2/) allele for the first time. The hitherto undescribed genotypes were verified by traditional methods. Hematological parameters were compared with those of Hb Q-Thailand heterozygosity linked with the (-α4.2/) deletion allele in our study. For the positive control samples, long-read SMRT sequencing revealed a linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele. CONCLUSIONS: Identification of the two patients confirms that the linkage relationship between the Hb Q-Thailand allele and the (-α4.2/) deletion allele is a common possibility but not a certainty. Remarkably, as it is superior to traditional methods, SMRT technology may eventually serve as a more comprehensive and precise method that holds promising prospects in clinical practice, especially for rare variants.


Asunto(s)
Hemoglobinas Anormales , Talasemia alfa , Humanos , Alelos , Heterocigoto
9.
Hematology ; 27(1): 826-830, 2022 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-35916627

RESUMEN

OBJECTIVE: The 3.7 kb deletion (-α3.7) in the α-globin cluster, which characterizes α+-thalassemia, has been reported to have a carrier rate of 4.78% in southern China. Three -α3.7 subtypes have been identified worldwide. However, the -α3.7 III subtype has not previously been identified in China. Herein, we reported identification of the -α3.7 III subtype in a Chinese patient. METHODS: We used gap-PCR and a liquid chip system to detect α-thalassemia mutations. Multiple ligation-dependent probe amplification was performed to detect the large deletion. We finally used Sanger sequencing and single molecule real-time sequencing to characterize and confirm the genotype. RESULTS: The proband, characterized as -α3.7 III heterozygous, showed microcytosis and hypochromic red cells, with a mean corpuscular volume of 78 fL and mean corpuscular hemoglobin of 25.4 pg. The proband's mutation was inherited from her father, who had normal blood parameters. CONCLUSION: We first identified the -α3.7 III subtype in China. Consequently, all -α3.7 subtypes have now been identified in the Chinese population. Therefore, attention should be paid to -α3.7 III in clinical prenatal diagnosis, given that commonly used methods such as gap-PCR may lead to misdiagnosis or missed diagnosis.


Asunto(s)
Talasemia alfa , China , Femenino , Genotipo , Heterocigoto , Humanos , Embarazo , Globinas alfa/genética , Talasemia alfa/diagnóstico , Talasemia alfa/genética
10.
Hematology ; 27(1): 198-203, 2022 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-35100090

RESUMEN

BACKGROUND: The α-thalassemia is a highly prevalent disease in tropical and subtropical regions, including southern China, and is mainly caused by deletion in α-globin genes (HBA1 and HBA2). The clinical manifestation of α-thalassemia is highly correlated with the copy number of α-globin genes. The decrease in copy number results in α-thalassemia, while duplication or triplication compounded with ß-thalassemia may aggravate the clinical manifestation. However, the common methods used to measure the copy number variants can only detect the three common types: -SEA, -α3.7, and -α4.2, and may easily miss the rare deletional type and duplication or triplication cases. Therefore, a new method that allows the detection of different copy number variants in α-globin genes simultaneously and accurately needs to be established. METHODS: A total of 428 peripheral-blood and fetal chorionic villus or amniotic fluid samples were used in this study. We employed a pair of primers and two probes, one for HBA1 and another for HBA2, to perform droplet digital polymerase chain reaction (ddPCR). Each reaction needed the ddPCR of RPP30 as a reference gene to calculate the copy number. RESULTS: We accurately detected the copy number variants in α-globin genes, including the common form α-thalassemia, triplications such as αααanti4.2, and trisomy 16, by performing only two reactions. The accuracy rate for detecting the copy number of α-globin genes was up to 100%. CONCLUSION: In conclusion, ddPCR served as an accurate and rapid method for detecting copy number variations in the clinical screening for α-thalassemia.


Asunto(s)
Variaciones en el Número de Copia de ADN , Reacción en Cadena de la Polimerasa/métodos , Globinas alfa/genética , Dosificación de Gen , Humanos , Talasemia alfa/genética , Talasemia beta/genética
11.
Hematology ; 27(1): 867-873, 2022 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-35938954

RESUMEN

OBJECTIVES: Here we report two rare α-globin chain variants in two unrelated families: Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C] and Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. Notably, HBA2: c.400A > C is an unreported new variant in the third exon of the α2 gene, and simple heterozygous unstable Hb Dongguan haematological characteristics are proposed for the first time. METHODS: Hb analysis was performed by using capillary electrophoresis (CE). Twenty-three common mutations were detected using a suspension array system. Mutations were identified by DNA sequencing. RESULTS: The CE results showed an abnormal peak with incomplete separation from Hb A at zone 8 in two members of Family 1. DNA sequencing confirmed the presence of Hb Val de Marne [α133(H16) Ser > Arg (AGC > CGC); HBA2: c.400A > C]. Five members of Family 2 exhibited an abnormal peak at zone 11, and DNA sequencing confirmed the presence of Hb Dongguan [α52(E6) Ser > Cys (TCT > TGT); HBA1: c.158C > G]. CONCLUSIONS: The discovery of HBA2: C.400A > C expands the existing spectrum of α-globin variants. The carriers of simple heterozygous Hb Dongguan generally do not have obvious clinical symptoms. The information in this study will help clinicians understand the screening, molecular diagnosis and clinical significance of Hb variants.


Asunto(s)
Hemoglobinas Anormales , Talasemia alfa , Sustitución de Aminoácidos , China , Genotipo , Hemoglobina Glucada/genética , Hemoglobina A2 , Hemoglobinas Anormales/genética , Heterocigoto , Humanos , Mutación , Globinas alfa/genética , Talasemia alfa/genética
12.
Hematology ; 27(1): 258-262, 2022 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-35192774

RESUMEN

Hemoglobin Santa Ana [ß88(F4)Leu→Pro (CTG > CCG) HBB: c.266T > C] is an unstable hemoglobin variant characterized by a substitution of the amino acid leucine by proline at the 88th position of the ß-globin chain. We for the first time identified this hemoglobin variant in a Chinese patient by capillary electrophoresis (CE). The proband was an 8-year-old boy with chronic anemia, brown urine and splenomegaly. He had been affected by moderate anemia, twice approaching a severe degree, that was attributed to infection. The CE result revealed an abnormal hemoglobin peak at electrophoretic zone 4 that correspond to the hemoglobin Santa Ana peak, and a CTG > CCG mutation at codon 88 of the ß-globin gene was confirmed by DNA sequencing. To avoid misdiagnosis and genetic risks, a literature review of other unstable hemoglobins that migrate similarly to the hemoglobin Santa Ana was performed. Our findings indicate that hemoglobin Santa Ana can be clearly separated by CE, with accurate diagnosis depending on molecular analysis. This information will be useful for providing appropriate genetic counselling and for prenatal diagnosis.


Asunto(s)
Anemia/diagnóstico , Electroforesis Capilar/métodos , Hemoglobinas Anormales/genética , Niño , China , Hemoglobinas Anormales/análisis , Humanos , Masculino
13.
Neurosci Lett ; 746: 135650, 2021 02 16.
Artículo en Inglés | MEDLINE | ID: mdl-33485991

RESUMEN

OBJECTIVE: Serum creatinine (SCR) has been shown to be associated with many neurodegenerative diseases. In this study, we investigated the relationship between SCR levels and the incidence of psychiatric symptoms in patients with anti-N-methyl-d-aspartate receptor (anti-NMDAR) encephalitis. METHODS: The SCR levels were tested in 69 patients with anti-NMDAR encephalitis at admission. Clinical characteristics and blood and CSF parameters were compared between the group of patients with psychiatric symptoms (P + group) and the group of those without psychiatric symptoms (P- group). The association between SCR and the incidence of psychiatric symptoms was determined by multivariate-adjusted linear regression analyses. RESULTS: The SCR levels in the P + group were significantly lower than those in the P- group (P < 0.001). In the female subgroup, the SCR levels in the P + group were significantly lower compared to the P- group (P < 0.001), whereas in the male subgroup, the SCR levels did not differ between the two groups (P = 0.084). Furthermore, the highest SCR tercile overall had a significantly lower incidence of psychiatric symptoms than the lowest tercile (P < 0.001), and a significant negative correlation between the SCR levels and the occurrence of psychiatric symptoms was observed (r = -0.392, P < 0.001). Multivariate logistic regression analysis showed that the association was independent after adjusting for age, cystatin C and the modified Rankin Scale (mRS) score (P = 0.001). A similar result was found in the female subgroup (P = 0.010), but not in the male subgroup (P = 0.225). CONCLUSION: Our study indicated that the SCR level was negatively correlated with incidence of psychiatric symptoms in female patients, and higher SCR level could be a protective factor for psychiatric symptoms in female patients with anti-NMDAR encephalitis.


Asunto(s)
Encefalitis Antirreceptor N-Metil-D-Aspartato/sangre , Encefalitis Antirreceptor N-Metil-D-Aspartato/psicología , Creatinina/sangre , Trastornos Mentales/sangre , Trastornos Mentales/psicología , Caracteres Sexuales , Adolescente , Adulto , Encefalitis Antirreceptor N-Metil-D-Aspartato/diagnóstico , Biomarcadores/sangre , Estudios Transversales , Femenino , Humanos , Masculino , Trastornos Mentales/diagnóstico , Persona de Mediana Edad , Adulto Joven
14.
Sci Rep ; 11(1): 3844, 2021 02 15.
Artículo en Inglés | MEDLINE | ID: mdl-33589684

RESUMEN

The aim of this study was to retrospectively compare hematological parameters among normal, α-, and ß-thalassemia fetuses between 17 and 38 weeks of gestation. Pregnant women at risk of having fetuses with thalassemia major and underwent cordocentesis for prenatal diagnosis were recruited. Fetal cord blood samples were collected from 249 fetuses for hematological and DNA analysis. Fetuses were divided into subgroups according to thalassemia DNA genotypes. The average and gestational age of subjects were 27.95 ± 5.78 years and 27.78 ± 3.57 weeks, respectively. The distribution of α-thalassemia, ß-thalassemia, and normal cases was 67.87%, 19.68%, and 12.45%, respectively. Significant differences in almost all the hematological parameters (HbF, HbA, Hb, HCT, MCV, MCH, MCHC, RDW, and NBRCs) were observed in three groups (P < 0.001, except for RBC, P = 0.446). These differences were also observed in four α-thalassemia subgroups (P < 0.001) and were associated with the number of defected genes. Similarly, in five ß-thalassemia genotypes, HbF, HbA, RBC, MCV, MCH and NBRCs were presented differently (P < 0.05). Additionally, the trends in RBC, Hb, and HCT changes in three α-thalassemia subgroups (silent carrier, trait, and major) and ß+/ß+ fetuses' MCV, MCH, and RDW levels with gestation age were opposite to those of normal fetuses. We compared the distribution of hematological parameters in fetuses affected by most genotypes of thalassemia, as well as their trends in relation to gestational age for the first time, which is a good reference for future studies and prenatal diagnostic practices. The investigated hematological parameters are also valuable in diagnosing and differentiating thalassemia.


Asunto(s)
Biomarcadores/sangre , Índices de Eritrocitos , Sangre Fetal , Talasemia alfa/sangre , Talasemia alfa/epidemiología , Talasemia beta/sangre , Talasemia beta/epidemiología , Adulto , Alelos , Estudios de Casos y Controles , Femenino , Genotipo , Edad Gestacional , Humanos , Mutación , Embarazo , Adulto Joven , Globinas alfa/genética , Talasemia alfa/genética , Globinas beta/genética , Talasemia beta/genética
15.
Mol Genet Genomic Med ; 9(9): e1699, 2021 09.
Artículo en Inglés | MEDLINE | ID: mdl-34398528

RESUMEN

INTRODUCTION: Although over 1000 hemoglobin (Hb) variants were identified so far, Hb Port Phillip compound with α-thalassemia deletion had no reported before. METHODS: Two patients and the associated families from Guangdong province in China were recruited. Hematological parameters were determined by blood routine examination and hemoglobin electrophoresis. Genotyping was performed by Gap-PCR and Sanger sequencing. RESULTS: One patient was diagnosed as Hb Port Phillip, while her daughter was compounded with -α4.2 deletion, with normal Hb level (150 g/L), mean corpuscular volume (MCV) 108.4 fl and mean corpuscular hemoglobin (MCH) (30.5 pg). Another patient was diagnosed as compound Hb Port Phillip and --SEA deletion. This proband presented with more severe α-thalassemia trait than the patient compounded with -α4.2 deletion, with hemoglobin 80 g/L, MCV 61.7 fl, and MCH 18.7 pg. CONCLUSION: Here we first time identified two patients compound with Hb Port Phillip and -α4.2 and --SEA deletions, respectively, which had never been reported. Our study widens the genotypes of hemoglobinopathy and provides reference for genetic counselling and prenatal diagnosis in this population.


Asunto(s)
Hemoglobinas/genética , Fragmentos de Péptidos/genética , Talasemia/genética , Adulto , Femenino , Eliminación de Gen , Humanos , Masculino , Linaje , Talasemia/patología
16.
J Int Med Res ; 49(7): 3000605211031429, 2021 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-34334003

RESUMEN

We report on a fetus with cardiomegaly and increased middle cerebral artery-peak systolic velocity at 25 weeks of gestation. Severe fetal anemia (hemoglobin (Hb) level 37 g/L) was confirmed by cordocentesis. Hb analysis showed that Hb Bart's was 9% in cord blood. Molecular analysis of the proband's family found that the mother was a carrier of Hb Quong Sze (Hb QS, HBA2:c.377T>C), the father was a carrier of Hb Zurich-Albisrieden (Hb ZA, HBA2:c.178G>C), and the fetus was a compound heterozygote for Hb ZA and Hb QA. Despite intrauterine blood transfusions, the fetus experienced problems including oligohydramnios, growth retardation, placental thickening, and heart enlargement in the third trimester. The couple chose to terminate the pregnancy, and fetal autopsy confirmed the above diagnosis. This is the first report of a case of Hb ZA compounded with Hb QS, and provides a reference for genetic counselling and prenatal diagnosis in the Chinese population.


Asunto(s)
Anemia , Hidropesía Fetal , Anemia/diagnóstico , Anemia/genética , Femenino , Feto , Hemoglobinas Anormales , Humanos , Hidropesía Fetal/diagnóstico , Hidropesía Fetal/genética , Placenta , Embarazo
17.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 29(4): 1247-1250, 2021 Aug.
Artículo en Zh | MEDLINE | ID: mdl-34362510

RESUMEN

OBJECTIVE: To analyze the hematological characteristics of Chinese Gγ+(Aγδß)0-thalassemia,SEA-HPFH and Taiwan type ß-thalassemia. METHODS: Hemoglobin electrophoresis and blood routine test were used to analyze the hematological indexes of all peripheral blood samples,PCR-Flow fluorescent hybridization and Gap-PCR were used to detect the globin gene mutations and the data were analyzed statistically. RESULTS: The 3 types of deletion ß- Thalassemia patients were showed as hypochromic small cell anemia. The MCH and MCV values of Taiwan type ß-thalassemia patients were the lowest. The results of hemoglobin electrophoresis showed that the increasing of HbF was found in all of the 3 types. Except for the decreasing of Hb A2 in Chinese Gγ+(Aγδß)0-thalassemia,the levels of Hb A2 in the other two deletion ß-thalassemia patients were significantly increased. Except for Hb, there were significant differences in MCV, MCH, Hb A2 and HbF between Chinese Gγ+(Aγδß)0-thalassemia and SEA-HPFH(P<0.001). CONCLUSION: Through analyze the hematological characteristics, it can be provide that the guidance for the differential diagnosis and genetic consultation of the three commonest deletion ß-thalassemia in Chinese.


Asunto(s)
Talasemia , Talasemia beta , China , Diagnóstico Diferencial , Hemoglobina Fetal , Humanos , Mutación , Talasemia beta/diagnóstico , Talasemia beta/genética
18.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 29(4): 1271-1274, 2021 Aug.
Artículo en Zh | MEDLINE | ID: mdl-34362515

RESUMEN

OBJECTIVE: To investigate whether ß-globin gene 3'UTR+101G>C (HBB:c.*233G>C) variant has genetic effect and provide basis for gene diagnosis and genetic counseling. METHOD: Whole blood cell analysis and capillary zone electrophoresis (CZE) were used to analyze the hematological indexes. The most frequent 23 mutations in southern Chinese individuals were routinely measured by PCR-flow fluorenscence immunmicrobeads assay. Sanger sequencing was used to detect the other variants of ß-globin gene (HBB). RESULTS: In 463 cases, a total of 7 cases with HBB:c.*233G>C variant were detected, among them 4 cases carried other pathogenic variants of HBB gene (2 cases were in trans, 2 cases were in cis), who had typical hematological characteristics of mild ß-thalassemia, and 3 cases also carried abnormal hemoglobin variation, but did not have hematological characteristics of ß-thalassemia. CONCLUSION: The study shows that HBB:c.*233G > C variant has no obvious genetic effect and should be a benign polymorphism.


Asunto(s)
Hemoglobinas Anormales , Talasemia beta , Regiones no Traducidas 3' , Hemoglobinas Anormales/genética , Humanos , Mutación , Globinas beta/genética , Talasemia beta/genética
19.
J Int Med Res ; 49(2): 300060521993642, 2021 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-33596700

RESUMEN

BACKGROUND: We describe 2 unusual haemoglobin (Hb) Bart's hydrops cases that could not be explained by traditional factors.Case presentation: Two families with a diagnosis or history of foetal hydrops were enrolled. A suspension-array system was used to detect the 23 most frequent mutations in southern China. Multiplex ligation-dependent probe amplification (MLPA) was used to screen for possible deletions. Precise characterisation of the breakpoints of the novel variants and uniparental disomy analysis were performed using a single nucleotide polymorphism (SNP) array. Quantitative fluorescence PCR was used to eliminate maternal cell contamination and nonpaternity. In case 1, the suspension-array system indicated a maternal heterozygous (-SEA/) deletion, and the paternal sample was negative. The foetal hydrops was caused by the maternal (-SEA/) deletion and a de novo α-globin gene deletion (-193). In case 2, the paternal sample had a heterozygous (-SEA/) deletion, and MLPA and SNP array analysis revealed a large maternal deletion (-227) that encompassed the α-globin gene, which explained the history of Hb Bart's foetal hydrops. CONCLUSIONS: Our cases describe 2 new α0-thalassaemia deletions and illustrate the importance of using a combination of methods to detect rare types of α-thalassaemia.


Asunto(s)
Talasemia alfa , China , Edema , Femenino , Eliminación de Gen , Hemoglobinas Anormales , Humanos , Hidropesía Fetal/diagnóstico , Hidropesía Fetal/genética , Familia de Multigenes , Embarazo , Diagnóstico Prenatal , Globinas alfa/genética , Talasemia alfa/diagnóstico , Talasemia alfa/genética
20.
J Int Med Res ; 48(8): 300060520951052, 2020 Aug.
Artículo en Inglés | MEDLINE | ID: mdl-32847435

RESUMEN

A normal disc-condyle relationship is crucial to the health and function of the temporomandibular joint. We herein introduce a novel technique that can precisely and rapidly restore the disc-condyle relationship. An initial bite rim was made, and the patient was instructed to wear this bite rim during magnetic resonance imaging (MRI) scanning. A quick MRI scan was performed, and the disc-condyle relationship and direction and vector of the displacement was measured. Adjustments to the mandible position were made on an articulator based on the measurements, after which a second bite rim was made. A second quick preview MRI scan was immediately performed, and the images were evaluated and measured again. Additional adjustments were made as needed, and the preview scan was repeated until an ideal disc-condyle relationship was achieved. Once a good disc-condyle relationship was acquired, the mandible position was recorded as the treatment mandible position, and a splint was fabricated. MRI visualization enabled precise and very fine adjustment of the disc-condyle relationship by articulating. This technique might help to simplify the clinical process and improve treatment effectiveness.


Asunto(s)
Luxaciones Articulares , Trastornos de la Articulación Temporomandibular , Humanos , Imagen por Resonancia Magnética , Cóndilo Mandibular , Disco de la Articulación Temporomandibular
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA