Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 534
Filtrar
Más filtros

Tipo del documento
Intervalo de año de publicación
1.
Nature ; 568(7752): 368-372, 2019 04.
Artículo en Inglés | MEDLINE | ID: mdl-30996320

RESUMEN

Complex topological configurations are fertile ground for exploring emergent phenomena and exotic phases in condensed-matter physics. For example, the recent discovery of polarization vortices and their associated complex-phase coexistence and response under applied electric fields in superlattices of (PbTiO3)n/(SrTiO3)n suggests the presence of a complex, multi-dimensional system capable of interesting physical responses, such as chirality, negative capacitance and large piezo-electric responses1-3. Here, by varying epitaxial constraints, we discover room-temperature polar-skyrmion bubbles in a lead titanate layer confined by strontium titanate layers, which are imaged by atomic-resolution scanning transmission electron microscopy. Phase-field modelling and second-principles calculations reveal that the polar-skyrmion bubbles have a skyrmion number of +1, and resonant soft-X-ray diffraction experiments show circular dichroism, confirming chirality. Such nanometre-scale polar-skyrmion bubbles are the electric analogues of magnetic skyrmions, and could contribute to the advancement of ferroelectrics towards functionalities incorporating emergent chirality and electrically controllable negative capacitance.

2.
N Engl J Med ; 383(26): 2514-2525, 2020 12 24.
Artículo en Inglés | MEDLINE | ID: mdl-33095526

RESUMEN

BACKGROUND: The safety and efficacy of antenatal glucocorticoids in women in low-resource countries who are at risk for preterm birth are uncertain. METHODS: We conducted a multicountry, randomized trial involving pregnant women between 26 weeks 0 days and 33 weeks 6 days of gestation who were at risk for preterm birth. The participants were assigned to intramuscular dexamethasone or identical placebo. The primary outcomes were neonatal death alone, stillbirth or neonatal death, and possible maternal bacterial infection; neonatal death alone and stillbirth or neonatal death were evaluated with superiority analyses, and possible maternal bacterial infection was evaluated with a noninferiority analysis with the use of a prespecified margin of 1.25 on the relative scale. RESULTS: A total of 2852 women (and their 3070 fetuses) from 29 secondary- and tertiary-level hospitals across Bangladesh, India, Kenya, Nigeria, and Pakistan underwent randomization. The trial was stopped for benefit at the second interim analysis. Neonatal death occurred in 278 of 1417 infants (19.6%) in the dexamethasone group and in 331 of 1406 infants (23.5%) in the placebo group (relative risk, 0.84; 95% confidence interval [CI], 0.72 to 0.97; P = 0.03). Stillbirth or neonatal death occurred in 393 of 1532 fetuses and infants (25.7%) and in 444 of 1519 fetuses and infants (29.2%), respectively (relative risk, 0.88; 95% CI, 0.78 to 0.99; P = 0.04); the incidence of possible maternal bacterial infection was 4.8% and 6.3%, respectively (relative risk, 0.76; 95% CI, 0.56 to 1.03). There was no significant between-group difference in the incidence of adverse events. CONCLUSIONS: Among women in low-resource countries who were at risk for early preterm birth, the use of dexamethasone resulted in significantly lower risks of neonatal death alone and stillbirth or neonatal death than the use of placebo, without an increase in the incidence of possible maternal bacterial infection. (Funded by the Bill and Melinda Gates Foundation and the World Health Organization; Australian and New Zealand Clinical Trials Registry number, ACTRN12617000476336; Clinical Trials Registry-India number, CTRI/2017/04/008326.).


Asunto(s)
Dexametasona/administración & dosificación , Glucocorticoides/administración & dosificación , Enfermedades del Prematuro/prevención & control , Muerte Perinatal/prevención & control , Atención Prenatal , Adulto , Países en Desarrollo , Femenino , Humanos , Recién Nacido de Bajo Peso , Recién Nacido , Recien Nacido Prematuro , Enfermedades del Prematuro/epidemiología , Inyecciones Intramusculares , Embarazo , Nacimiento Prematuro , Riesgo , Mortinato/epidemiología
3.
Planta ; 257(4): 82, 2023 Mar 14.
Artículo en Inglés | MEDLINE | ID: mdl-36917364

RESUMEN

MAIN CONCLUSION: Significantly thickened corner middle lamella of the hydroid cell wall in the stipe of dendroid moss Hypnodendron menziesii has a mechanical support function. The hydroid cell walls of the erect stipe of Hypnodendron menziesii were investigated using light microscopy (LM), transmission electron microscopy (TEM), and TEM-immunogold labeling in support of the proposed biomechanical function for the highly thickened cell corner middle lamellae. The statistical analyses of dimensions of hydroid cell and wall parameters revealed a strong positive correlation between the area of hydroid cell and (i) the hydroid cell walls adhering to thick corner middle lamella, (ii) the area of the thick cell wall at hydroid corners, and (iii) the maximum thickness of cell wall at hydroid corners. The total area of the thick cell wall at the hydroid corners concomitantly increased with the area of the hydroid cell wall adhering to the middle lamella, and with the increased number of hydroids surrounding a reference hydroid. The results suggest that markedly thickened middle lamellae of the hydroid cell wall in Hypnodendron likely function by preventing hydroid cells from collapsing under the tensile forces generated from the transpirational pull on the water column. The specific localization of (1→4)- ß-D-galactan and (1,5)-α-L-arabinan in the interface region of the hydroid cell wall and the thick middle lamella is consistent with these cell wall components being involved in the mechanical strengthening of the interface through firm adhesion as well as elasticity, ensuring the structural stability of this cell wall region, which may be prone to delamination/fracturing from the various internal and external pressures imposed. The copious presence of homogalacturonan in the thick middle lamella may further enhance the strength and flexibility of hydroid cell walls.


Asunto(s)
Bryopsida , Células Germinativas de las Plantas , Microscopía , Galactanos/análisis , Pared Celular/metabolismo
4.
Nat Mater ; 21(7): 779-785, 2022 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-35618823

RESUMEN

Single crystals of BaTiO3 exhibit small switching fields and energies, but thin-film performance is considerably worse, thus precluding their use in next-generation devices. Here, we demonstrate high-quality BaTiO3 thin films with nearly bulk-like properties. Thickness scaling provides access to the coercive voltages (<100 mV) and fields (<10 kV cm-1) required for future applications and results in a switching energy of <2 J cm-3 (corresponding to <2 aJ per bit in a 10 × 10 × 10 nm3 device). While reduction in film thickness reduces coercive voltage, it does so at the expense of remanent polarization. Depolarization fields impact polar state stability in thicker films but fortunately suppress the coercive field, thus driving a deviation from Janovec-Kay-Dunn scaling and enabling a constant coercive field for films <150 nm in thickness. Switching studies reveal fast speeds (switching times of ~2 ns for 25-nm-thick films with 5-µm-diameter capacitors) and a pathway to subnanosecond switching. Finally, integration of BaTiO3 thin films onto silicon substrates is shown. We also discuss what remains to be demonstrated to enable the use of these materials for next-generation devices.

5.
Langmuir ; 39(44): 15716-15729, 2023 Nov 07.
Artículo en Inglés | MEDLINE | ID: mdl-37889478

RESUMEN

Droplets made of liquid perfluorocarbon undergo a phase transition and transform into microbubbles when triggered by ultrasound of intensity beyond a critical threshold; this mechanism is called acoustic droplet vaporization (ADV). It has been shown that if the intensity of the signal coming from high ultrasonic harmonics are sufficiently high, superharmonic focusing is the mechanism leading to ADV for large droplets (>3 µm) and high frequencies (>1.5 MHz). In such a scenario, ADV is initiated due to a nucleus occurring at a specific location inside the droplet volume. But the question on what induces ADV in the case of nanometer-sized droplets and/or at low ultrasonic frequencies (<1.5 MHz) still remains. We investigated ADV of perfluorohexane (PFH) nano- and microdroplets at a frequency of 1.1 MHz and at conditions where there is no superharmonic focusing. Three types of droplets produced by microfluidics were studied: plain PFH droplets, PFH droplets containing many nanometer-sized water droplets, and droplets made of a PFH corona encapsulating a single micron-sized water droplet. The probability to observe a vaporization event was measured as a function of acoustic pressure. As our experiments were performed on droplet suspensions containing a population of monodisperse droplets, we developed a statistical model to extrapolate, from our experimental curves, the ADV pressure thresholds in the case where only one droplet would be insonified. We observed that the value of ADV pressure threshold decreases as the radius of a plain PFH droplet increases. This value was further reduced when a PFH droplet encapsulates a micron-sized water droplet, while the encapsulation of many nanometer-sized water droplets did not modify the threshold. These results cannot be explained by a model of homogeneous nucleation. However, we developed a heterogeneous nucleation model, where the nucleus appears at the surface in contact with PFH, that successfully predicts our experimental ADV results.

6.
Int J Mol Sci ; 24(11)2023 Jun 03.
Artículo en Inglés | MEDLINE | ID: mdl-37298671

RESUMEN

Protein-based biostimulants (PBBs) have a positive effect on plant development, although the biological background for this effect is not well understood. Here, hydrolyzed wheat gluten (HWG) and potato protein film (PF) in two levels (1 and 2 g/kg soil) and in two different soils (low and high nutrient; LNC and HNC) were used as PBBs. The effect of these PBBs on agronomic traits, sugars, protein, and peptides, as well as metabolic processes, were evaluated on sugar beet in comparison with no treatment (control) and treatment with nutrient solution (NS). The results showed a significant growth enhancement of the plants using HWG and PF across the two soils. Sucrose and total sugar content in the roots were high in NS-treated plants and correlated to root growth in HNC soil. Traits related to protein composition, including nitrogen, peptide, and RuBisCO contents, were enhanced in PBB-treated plants (mostly for HWG and PF at 2 g/kg soil) by 100% and >250% in HNC and LNC, respectively, compared to control. The transcriptomic analysis revealed that genes associated with ribosomes and photosynthesis were upregulated in the leaf samples of plants treated with either HWG or PP compared to the control. Furthermore, genes associated with the biosynthesis of secondary metabolites were largely down-regulated in root samples of HWG or PF-treated plants. Thus, the PBBs enhanced protein-related traits in the plants through a higher transcription rate of genes related to protein- and photosynthesis, which resulted in increased plant growth, especially when added in certain amounts (2 g/kg soil). However, sucrose accumulation in the roots of sugar beet seemed to be related to the easy availability of nitrogen.


Asunto(s)
Beta vulgaris , Beta vulgaris/metabolismo , Nitrógeno/metabolismo , Desarrollo de la Planta , Suelo , Sacarosa/metabolismo , Raíces de Plantas/metabolismo
7.
J Environ Manage ; 328: 116902, 2023 Feb 15.
Artículo en Inglés | MEDLINE | ID: mdl-36508978

RESUMEN

Efficient nutrient cycling through decomposition of leaf litter often regulates the high productivity and subsequent carbon sequestration of mangrove ecosystems along the land-ocean boundary. To understand the characteristics and the potentials of mangrove leaf litter in supplying organic carbon and nutrients to the coastal waters, four major mangrove species (A. officinalis, R. mucronata, H. littoralis and S. apetala) of Bhitarkanika mangrove forest, Odisha, India, were examined in controlled environmental conditions. Half-life time (t0.5), estimated for decomposition of those mangrove leaf litter materials ranged from 18 to 52 days. During the incubation experiment, organic carbon from mangrove leaf litter was released primarily through physical processes and was available for heterotrophic respiration. Among the four species, leaf litter of S. apetala with the lowest initial C/N ratios, released organic carbon with low molecular weight (labile substances) that has a relatively higher potential to support the aquatic food web. On the contrary, leaf litter of R. mucronata released organic material with relatively higher molecular weight (humic substances, higher aromaticity), which revealed its superior non-labile characteristics in this unique environment. The mean total heterotrophic bacterial (THB) population in the incubation was around nine-fold higher than the control. THB population growth and Chromophoric Dissolved Organic Matter (CDOM) spectral data further suggested the rapid release of highly labile and recalcitrant carbon from S. apetala and R. mucronata (between 7th and 21st day of incubation), respectively. The mean litter fall from the Bhitarkanika mangrove forest was estimated to be 11.32 ± 1.57 Mg ha-1 y-1 and its corresponding carbon content was 5.43 ± 0.75 Mg C ha-1. The study revealed the role of leaf litter leachates as an important food source to microbial communities in the adjacent coastal waters, in addition to a potential carbon sequesterer through long-term burial in mangrove soil and export to the deep sea.


Asunto(s)
Ecosistema , Humedales , Hojas de la Planta , Carbono , Nutrientes
8.
Nat Mater ; 20(2): 194-201, 2021 Feb.
Artículo en Inglés | MEDLINE | ID: mdl-33046856

RESUMEN

Topological solitons such as magnetic skyrmions have drawn attention as stable quasi-particle-like objects. The recent discovery of polar vortices and skyrmions in ferroelectric oxide superlattices has opened up new vistas to explore topology, emergent phenomena and approaches for manipulating such features with electric fields. Using macroscopic dielectric measurements, coupled with direct scanning convergent beam electron diffraction imaging on the atomic scale, theoretical phase-field simulations and second-principles calculations, we demonstrate that polar skyrmions in (PbTiO3)n/(SrTiO3)n superlattices are distinguished by a sheath of negative permittivity at the periphery of each skyrmion. This enhances the effective dielectric permittivity compared with the individual SrTiO3 and PbTiO3 layers. Moreover, the response of these topologically protected structures to electric field and temperature shows a reversible phase transition from the skyrmion state to a trivial uniform ferroelectric state, accompanied by large tunability of the dielectric permittivity. Pulsed switching measurements show a time-dependent evolution and recovery of the skyrmion state (and macroscopic dielectric response). The interrelationship between topological and dielectric properties presents an opportunity to simultaneously manipulate both by a single, and easily controlled, stimulus, the applied electric field.

9.
Nature ; 530(7589): 198-201, 2016 Feb 11.
Artículo en Inglés | MEDLINE | ID: mdl-26814971

RESUMEN

The complex interplay of spin, charge, orbital and lattice degrees of freedom provides a plethora of exotic phases and physical phenomena. In recent years, complex spin topologies have emerged as a consequence of the electronic band structure and the interplay between spin and spin-orbit coupling in materials. Here we produce complex topologies of electrical polarization--namely, nanometre-scale vortex-antivortex (that is, clockwise-anticlockwise) arrays that are reminiscent of rotational spin topologies--by making use of the competition between charge, orbital and lattice degrees of freedom in superlattices of alternating lead titanate and strontium titanate layers. Atomic-scale mapping of the polar atomic displacements by scanning transmission electron microscopy reveals the presence of long-range ordered vortex-antivortex arrays that exhibit nearly continuous polarization rotation. Phase-field modelling confirms that the vortex array is the low-energy state for a range of superlattice periods. Within this range, the large gradient energy from the vortex structure is counterbalanced by the corresponding large reduction in overall electrostatic energy (which would otherwise arise from polar discontinuities at the lead titanate/strontium titanate interfaces) and the elastic energy associated with epitaxial constraints and domain formation. These observations have implications for the creation of new states of matter (such as dipolar skyrmions, hedgehog states) and associated phenomena in ferroic materials, such as electrically controllable chirality.

10.
Sensors (Basel) ; 22(20)2022 Oct 16.
Artículo en Inglés | MEDLINE | ID: mdl-36298214

RESUMEN

Surface ozone is one of six air pollutants designated as harmful by National Ambient Air Quality Standards because it can adversely impact human health and the environment. Thus, ozone forecasting is a critical task that can help people avoid dangerously high ozone concentrations. Conventional numerical approaches, as well as data-driven forecasting approaches, have been studied for ozone forecasting. Data-driven forecasting models, in particular, have gained momentum with the introduction of machine learning advancements. We consider planetary boundary layer (PBL) height as a new input feature for data-driven ozone forecasting models. PBL has been shown to impact ozone concentrations, making it an important factor in ozone forecasts. In this paper, we investigate the effectiveness of utilization of PBL height on the performance of surface ozone forecasts. We present both surface ozone forecasting models, based on multilayer perceptron (MLP) and bidirectional long short-term memory (LSTM) models. These two models forecast hourly ozone concentrations for an upcoming 24-h period using two types of input data, such as measurement data and PBL height. We consider the predicted values of PBL height obtained from the weather research and forecasting (WRF) model, since it is difficult to gather actual PBL measurements. We evaluate two ozone forecasting models in terms of index of agreement (IOA), mean absolute error (MAE), and root mean square error (RMSE). Results showed that the MLP-based and bidirectional LSTM-based models yielded lower MAE and RMSE when considering forecasted PBL height, but there was no significant changes in IOA when compared with models in which no forecasted PBL data were used. This result suggests that utilizing forecasted PBL height can improve the forecasting performance of data-driven prediction models for surface ozone concentrations.


Asunto(s)
Contaminantes Atmosféricos , Contaminación del Aire , Ozono , Humanos , Ozono/análisis , Monitoreo del Ambiente/métodos , Contaminantes Atmosféricos/análisis , Contaminación del Aire/análisis , Aprendizaje Automático , Predicción
11.
Ann Oncol ; 32(Suppl 2)2021 05.
Artículo en Inglés | MEDLINE | ID: mdl-34220400

RESUMEN

Background: Glucocorticoid receptor (GR) is shown to have variable frequency of expression in invasive tumors of the breast. Investigation of additional nuclear receptors like GR in receptor negative tumors like triple negative breast cancer (TNBC) may have prognostic and therapeutic significance. Methods: Expression of GR was evaluated by immunohistochemistry in 175 tumors of invasive breast cancer with long term follow up. GR Expression was separately evaluated in invasive tumor cells, stromal cells and tumor infiltrating lymphocytes (TIL's). Staining pattern was categorised as positive when more than 1% of the cells stained in each subpopulation of cells. Disease free survival was analysed between GR positive and negative status by Kaplan Meier analysis. Results: Of the 175 tumors, 121 (70%) were ER positive, 53 (30%) were ER negative and 29% (51) were triple negative. 74% (130/175) tumors showed expression of GR in invasive tumor cells while (84%) 147/175 had expression in TIL's. No significant difference in distribution of GR was noted between ER positive and ER negative tumors (78% vs 66%, p-0.1). Of the TNBC's 54% (28/51) and 70% (36/51) showed expression of GR in invasive tumor and TIL's respectively. Overall, GR positive tumors had significant better survival than GR negative tumors (mean survival time of 85 vs 59 months respectively, p-0.04) Contrary to the reports that GR expression in TIL's are associated with immunosuppressive activity in model systems, TNBC's with increased expression of GR in immune cells were associated with better survival (Mean survival time 74 vs 41 months, log rank test- p-0.03). TNBC tumors which were GR negative had higher lymph node metastases (p-0.04) and none of the other clinical features like age, menopausal state, tumor size and grade were different between GR positive and negative tumors within TNBC. Conclusions: Glucocorticoids (GC) are often used to alleviate the adverse symptoms during chemotherapy. Determining the GR status is of importance due to the pro cell survival effect of the glucocorticoids mediated through GR during chemotherapy. Though GC mediated effects on chemotherapy are controversial, our results indicate favourable effects in TNBC.

12.
Planta ; 254(1): 2, 2021 Jun 04.
Artículo en Inglés | MEDLINE | ID: mdl-34085144

RESUMEN

MAIN CONCLUSION: Heteromannans are the predominant hemicelluloses in the gametophytic stem of the moss Hypnodendron menziesii and occur in the walls of all cell types Little is known about the cell-wall polysaccharides of mosses. Monosaccharide analysis of cell walls isolated from the stem of the umbrella moss Hypnodendron menziesii was consistent with heteromannans, probably galactoglucomannans, being the predominant hemicellulosic polysaccharides in the walls. Immunofluorescence and immunogold microscopy with the monoclonal antibody LM21, specific for heteromannans, showed that these polysaccharides were present in the walls of all stem cell types. These cell types, except the hydroids, have secondary walls. Experiments in which sections were pre-treated with 0.1 M sodium carbonate and with the enzyme pectate lyase indicated that the heteromannans have O-acetyl groups that limit LM21 binding and the cell walls contain pectic homogalacturonan that masks detection of heteromannans using LM21. Therefore, to fully detect heteromannans in the cell walls, it was essential to use these pre-treatments to remove the O-acetyl groups from the heteromannans and pectic homogalacturonan from the cell walls. Fluorescence microscopy experiments with a second monoclonal antibody, LM22, also specific for heteromannans, showed similar results, but the binding was considerably weaker than with LM21, possibly as a result of subtle structural differences in the epitopes of the two antibodies. Although heteromannans occur abundantly in the cell walls of many species in basal lineages of tracheophytes, prior to the present study, research on the distribution of these polysaccharides in the walls of different cell types in mosses was confined to the model species Physcomitrium patens.


Asunto(s)
Briófitas , Polisacáridos , Pared Celular , Células Germinativas de las Plantas , Pectinas
13.
Planta ; 255(1): 20, 2021 Dec 11.
Artículo en Inglés | MEDLINE | ID: mdl-34894286

RESUMEN

MAIN CONCLUSION: Droughts negatively affect sorghum's productivity and nutritional quality. Across its diversity centers, however, there exist resilient genotypes that function differently under drought stress at various levels, including molecular and physiological. Sorghum is an economically important and a staple food crop for over half a billion people in developing countries, mostly in arid and semi-arid regions where drought stress is a major limiting factor. Although sorghum is generally considered tolerant, drought stress still significantly hampers its productivity and nutritional quality across its major cultivation areas. Hence, understanding both the effects of the stress and plant response is indispensable for improving drought tolerance of the crop. This review aimed at enhancing our understanding and provide more insights on drought tolerance in sorghum as a contribution to the development of climate resilient sorghum cultivars. We summarized findings on the effects of drought on the growth and development of sorghum including osmotic potential that impedes germination process and embryonic structures, photosynthetic rates, and imbalance in source-sink relations that in turn affect seed filling often manifested in the form of substantial reduction in grain yield and quality. Mechanisms of sorghum response to drought-stress involving morphological, physiological, and molecular alterations are presented. We highlighted the current understanding about the genetic basis of drought tolerance in sorghum, which is important for maximizing utilization of its germplasm for development of improved cultivars. Furthermore, we discussed interactions of drought with other abiotic stresses and biotic factors, which may increase the vulnerability of the crop or enhance its tolerance to drought stress. Based on the research reviewed in this article, it appears possible to develop locally adapted cultivars of sorghum that are drought tolerant and nutrient rich using modern plant breeding techniques.


Asunto(s)
Sequías , Sorghum , Grano Comestible , Regulación de la Expresión Génica de las Plantas , Fitomejoramiento , Sorghum/genética
14.
BMC Microbiol ; 21(1): 205, 2021 07 05.
Artículo en Inglés | MEDLINE | ID: mdl-34225658

RESUMEN

BACKGROUND: Aquaponics are food production systems advocated for food security and health. Their sustainability from a nutritional and plant health perspective is, however, a significant challenge. Recirculated aquaculture systems (RAS) form a major part of aquaponic systems, but knowledge about their microbial potential to benefit plant growth and plant health is limited. The current study tested if the diversity and function of microbial communities in two commercial RAS were specific to the fish species used (Tilapia or Clarias) and sampling site (fish tanks and wastewaters), and whether they confer benefits to plants and have in vitro antagonistic potential towards plant pathogens. RESULTS: Microbial diversity and composition was found to be dependent on fish species and sample site. The Tilapia RAS hosted higher bacterial diversity than the Clarias RAS; but the later hosted higher fungal diversity. Both Tilapia and Clarias RAS hosted bacterial and fungal communities that promoted plant growth, inhibited plant pathogens and encouraged biodegradation. The production of extracellular enzymes, related to nutrient availability and pathogen control, by bacterial strains isolated from the Tilapia and Clarias systems, makes them a promising tool in aquaponics and in their system design. CONCLUSIONS: This study explored the microbial diversity and potential of the commercial RAS with either Tilapia or Clarias as a tool to benefit the aquaponic system with respect to plant growth promotion and control of plant diseases.


Asunto(s)
Acuicultura/métodos , Bagres/microbiología , Interacciones Microbianas/fisiología , Enfermedades de las Plantas/prevención & control , Tilapia/microbiología , Microbiología del Agua , Animales , Fenómenos Fisiológicos Bacterianos , Biodiversidad , Hongos/fisiología , Enfermedades de las Plantas/microbiología , Plantas/microbiología
15.
Phytopathology ; 111(12): 2168-2175, 2021 Dec.
Artículo en Inglés | MEDLINE | ID: mdl-33973799

RESUMEN

Phytophthora infestans causes late blight disease on potato and tomato and is currently controlled by resistant cultivars or intensive fungicide spraying. Here, we investigated an alternative means for late blight control by spraying potato leaves with double-stranded RNAs (dsRNA) that target the P. infestans genes essential for infection. First, we showed that the sporangia of P. infestans expressing green fluorescent protein (GFP) can take up in vitro synthesized dsRNAs homologous to GFP directly from their surroundings, including leaves, which led to the reduced relative expression of GFP. We further demonstrate the potential of spray-induced gene silencing (SIGS) in controlling potato late blight disease by targeting developmentally important genes in P. infestans such as guanine-nucleotide binding protein ß-subunit (PiGPB1), haustorial membrane protein (PiHmp1), cutinase (PiCut3), and endo-1,3(4)-ß-glucanase (PiEndo3). Our results demonstrate that SIGS can potentially be used to mitigate potato late blight; however, the degree of disease control is dependent on the selection of the target genes.[Formula: see text] Copyright © 2021 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.


Asunto(s)
Phytophthora infestans , Solanum tuberosum , Silenciador del Gen , Enfermedades de las Plantas , Solanum tuberosum/genética , Esporangios
16.
Cell Mol Life Sci ; 77(2): 253-265, 2020 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-31468060

RESUMEN

Dysregulation of angiogenesis is a phenomenon observed in several disorders such as diabetic foot, critical limb ischemia and myocardial infarction. Mesenchymal stromal cells (MSCs) possess angiogenic potential and have recently emerged as a powerful tool for cell therapy to promote angiogenesis. Although bone marrow-derived MSCs are the primary cell of choice, obtaining them has become a challenge. The placenta has become a popular alternative as it is a highly vascular organ, easily available and ethically more favorable with a rich supply of MSCs. Comparatively, placenta-derived MSCs (PMSCs) are clinically promising due to their proliferative, migratory, clonogenic and immunomodulatory properties. PMSCs release a plethora of cytokines and chemokines key to angiogenic signaling and facilitate the possibility of delivering PMSC-derived exosomes as a targeted therapy to promote angiogenesis. However, there still remains the challenge of heterogeneity in the isolated populations, questions on the maternal or fetal origin of these cells and the diversity in previously reported isolation and culture conditions. Nonetheless, the growing rate of clinical trials using PMSCs clearly indicates a shift in favor of PMSCs. The overall aim of the review is to highlight the importance of this rather poorly understood cell type and emphasize the need for further investigations into their angiogenic potential as an alternative source for therapeutic angiogenesis.


Asunto(s)
Células Madre Mesenquimatosas/fisiología , Neovascularización Fisiológica/fisiología , Placenta/fisiología , Animales , Exosomas/fisiología , Femenino , Humanos , Embarazo
17.
Biofouling ; 37(5): 506-520, 2021 05.
Artículo en Inglés | MEDLINE | ID: mdl-34139900

RESUMEN

Marine biogrowth infestation of a seawater intake system was investigated. A digital camera fixed onto a skid was used to record the biogrowth at intervals of 5 m up to a depth of 55 m. Divers inspected the intake shaft and collected the biogrowth samples for biomass estimation. A biomass density of 7.5 kg m-2 and 28.2 kg m-2 was recorded at 5 and 30 m depths respectively. Inspection by the divers revealed that hard-shelled organisms such as oysters and brown and green mussels were observed in plenty up to a thickness of 15 cm and bryozoans grew as epibionts. At lower depths (<40 m), hydroids grew on the shells of green mussels along with silt accumulation. The biofouling community was composed of 46 organisms, exhibiting variation in distribution and abundance. The study explains the extent and type of marine biogrowth phenomena with depth and describes biofouling preventive methods.Supplemental data for this article is available online at https://doi.org/10.1080/08927014.2021.1933457 .


Asunto(s)
Incrustaciones Biológicas , Bivalvos , Animales , Biomasa , Agua de Mar
18.
Ecotoxicol Environ Saf ; 208: 111765, 2021 Jan 15.
Artículo en Inglés | MEDLINE | ID: mdl-33396084

RESUMEN

Recent studies have shown that organisms including humans are exposed to microplastics directly or indirectly. The present study aims to examine the ingestion of these microplastics and the consequences of the same by studying the accumulation behavior of weathered Polyethylene (wPE) microplastics. The Perna viridis were exposed chronically to three different environmentally relevant concentrations of wPE for 30 days, followed by a one-week depuration phase. There was no mortality observed in the control and exposed groups, but the feeding rate was observed to have substantially decreased in the group exposed to higher concentration (3 µgL-1) of wPE. It was also observed that a higher number of wPE particles accumulated in the intestine of exposed organisms. Interestingly, the present study revealed the presence of the substantial number of wPE particles in exposed organisms, which may adversely affect the internal organs as well as growth and reproduction. This study perceived that accumulation is marginally influenced by size of wPE. Similarly, biomarker analysis showed that wPE exposure significantly altered both the metabolism and histology of the internal organs of the exposed organisms. Overall, the study confirmed that the intestine was the most sensitive organ followed by gills, adductor muscles, and foot tissue adding new insights into the adverse effects of wPE in the marine ecosystem.


Asunto(s)
Microplásticos/toxicidad , Perna/fisiología , Polietileno/metabolismo , Contaminantes Químicos del Agua/metabolismo , Animales , Ecosistema , Ecotoxicología , Branquias/efectos de los fármacos , Humanos , Microplásticos/metabolismo , Perna/efectos de los fármacos , Plásticos , Polietileno/toxicidad , Alimentos Marinos/análisis , Contaminantes Químicos del Agua/análisis , Contaminantes Químicos del Agua/toxicidad
19.
Plant Dis ; 2021 Mar 05.
Artículo en Inglés | MEDLINE | ID: mdl-33673773

RESUMEN

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

20.
J Insect Sci ; 21(6)2021 Nov 01.
Artículo en Inglés | MEDLINE | ID: mdl-34723331

RESUMEN

Honey bee larvae are dependent on the social structure of colony for their provisioning and survival. With thousands of larvae being managed collectively by groups of foragers (collecting food resources) and nurse bees (processing food and provisioning larvae), coordination of colony efforts in rearing brood depends on multiple dynamic cues of larval presence and needs. Much of these cues appear to be chemical, with larvae producing multiple pheromones, major being brood ester pheromone (BEP; nonvolatile blend of fatty acid esters) that elicits both short-term releaser effects and long-term primer effects. While BEP can affect colony food collection and processing with the signaling of larval presence, it is unclear if BEP signals individual larval needs. To understand this aspect, in a series of experiments we manipulated larval feeding environment by depriving larvae from adult bee contact for 4-h period and examined (1) nurse bee interactions with contact-deprived and nondeprived larvae and larval extracts; (2) forager bee responses to contact-deprived and nondeprived larval extracts. We also characterized BEP of contact-deprived and nondeprived larvae. We found that nurse honey bees tend to aggregate more over contact-deprived larvae when compared with nondeprived larvae, but that these effects were not found in response to whole hexane extracts. Our analytical results suggest that BEP components changed in both quantity and quality over short period of contact deprivation. These changes affected foraging behavior, but did not appear to directly affect nursing behavior, suggesting that different chemical cues are involved in regulating nursing effort to individual larvae.


Asunto(s)
Abejas , Señales (Psicología) , Larva , Feromonas , Estructura Social , Animales , Conducta Apetitiva
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA