Fusarium: more than a node or a foot-shaped basal cell.

Recent publications have argued that there are potentially serious consequences for researchers in recognising distinct genera in the terminal fusarioid clade of the family Nectriaceae. Thus, an alternate hypothesis, namely a very broad concept of the genus Fusarium was proposed. In doing so, however, a significant body of data that supports distinct genera in Nectriaceae based on morphology, biology, and phylogeny is disregarded. A DNA phylogeny based on 19 orthologous protein-coding genes was presented to support a very broad concept of Fusarium at the F1 node in Nectriaceae. Here, we demonstrate that re-analyses of this dataset show that all 19 genes support the F3 node that represents Fusarium sensu stricto as defined by F. sambucinum (sexual morph synonym Gibberella pulicaris). The backbone of the phylogeny is resolved by the concatenated alignment, but only six of the 19 genes fully support the F1 node, representing the broad circumscription of Fusarium. Furthermore, a re-analysis of the concatenated dataset revealed alternate topologies in different phylogenetic algorithms, highlighting the deep divergence and unresolved placement of various Nectriaceae lineages proposed as members of Fusarium. Species of Fusarium s. str. are characterised by Gibberella sexual morphs, asexual morphs with thin- or thick-walled macroconidia that have variously shaped apical and basal cells, and trichothecene mycotoxin production, which separates them from other fusarioid genera. Here we show that the Wollenweber concept of Fusarium presently accounts for 20 segregate genera with clear-cut synapomorphic traits, and that fusarioid macroconidia represent a character that has been gained or lost multiple times throughout Nectriaceae. Thus, the very broad circumscription of Fusarium is blurry and without apparent synapomorphies, and does not include all genera with fusarium-like macroconidia, which are spread throughout Nectriaceae (e.g., Cosmosporella, Macroconia, Microcera). In this study four new genera are introduced, along with 18 new species and 16 new combinations. These names convey information about relationships, morphology, and ecological preference that would otherwise be lost in a broader definition of Fusarium. To assist users to correctly identify fusarioid genera and species, we introduce a new online identification database, Fusarioid-ID, accessible at www.fusarium.org. The database comprises partial sequences from multiple genes commonly used to identify fusarioid taxa (act1, CaM, his3, rpb1, rpb2, tef1, tub2, ITS, and LSU). In this paper, we also present a nomenclator of names that have been introduced in Fusarium up to January 2021 as well as their current status, types, and diagnostic DNA barcode data. In this study, researchers from 46 countries, representing taxonomists, plant pathologists, medical mycologists, quarantine officials, regulatory agencies, and students, strongly support the application and use of a more precisely delimited Fusarium (= Gibberella) concept to accommodate taxa from the robust monophyletic node F3 on the basis of a well-defined and unique combination of morphological and biochemical features. This F3 node includes, among others, species of the F. fujikuroi, F. incarnatum-equiseti, F. oxysporum, and F. sambucinum species complexes, but not species of Bisifusarium [F. dimerum species complex (SC)], Cyanonectria (F. buxicola SC), Geejayessia (F. staphyleae SC), Neocosmospora (F. solani SC) or Rectifusarium (F. ventricosum SC). The present study represents the first step to generating a new online monograph of Fusarium and allied fusarioid genera (www.fusarium.org).

Genera of phytopathogenic fungi: GOPHY 1.

Genera of Phytopathogenic Fungi (GOPHY) is introduced as a new series of publications in order to provide a stable platform for the taxonomy of phytopathogenic fungi. This first paper focuses on 21 genera of phytopathogenic fungi: Bipolaris, Boeremia, Calonectria, Ceratocystis, Cladosporium, Colletotrichum, Coniella, Curvularia, Monilinia, Neofabraea, Neofusicoccum, Pilidium, Pleiochaeta, Plenodomus, Protostegia, Pseudopyricularia, Puccinia, Saccharata, Thyrostroma, Venturia and Wilsonomyces. For each genus, a morphological description and information about its pathology, distribution, hosts and disease symptoms are provided. In addition, this information is linked to primary and secondary DNA barcodes of the presently accepted species, and relevant literature. Moreover, several novelties are introduced, i.e. new genera, species and combinations, and neo-, lecto- and epitypes designated to provide a stable taxonomy. This first paper includes one new genus, 26 new species, ten new combinations, and four typifications of older names.

The genus Bipolaris.

The genus Bipolaris includes important plant pathogens with worldwide distribution. Species recognition in the genus has been uncertain due to the lack of molecular data from ex-type cultures as well as overlapping morphological characteristics. In this study, we revise the genus Bipolaris based on DNA sequence data derived from living cultures of fresh isolates, available ex-type cultures from worldwide collections and observation of type and additional specimens. Combined analyses of ITS, GPDH and TEF gene sequences were used to reconstruct the molecular phylogeny of the genus Bipolaris for species with living cultures. The GPDH gene is determined to be the best single marker for species of Bipolaris. Generic boundaries between Bipolaris and Curvularia are revised and presented in an updated combined ITS and GPDH phylogenetic tree. We accept 47 species in the genus Bipolaris and clarify the taxonomy, host associations, geographic distributions and species' synonymies. Modern descriptions and illustrations are provided for 38 species in the genus with notes provided for the other taxa when recent descriptions are available. Bipolaris cynodontis, B. oryzae, B. victoriae, B. yamadae and B. zeicola are epi- or neotypified and a lectotype is designated for B. stenospila. Excluded and doubtful species are listed with notes on taxonomy and phylogeny. Seven new combinations are introduced in the genus Curvularia to accomodate the species of Bipolaris transferred based on the phylogenetic analysis. A taxonomic key is provided for the morphological identification of species within the genus.

Species limits in Diaporthe: molecular re-assessment of D. citri, D. cytosporella, D. foeniculina and D. rudis.

Species of Diaporthe are important plant pathogens of a wide range of hosts worldwide. In the present study the species causing melanose and stem end rot diseases of Citrus spp. are revised. Three species of Diaporthe occurring on Citrus are characterised, including D. citri, D. cytosporella and D. foeniculina. Morphology and phylogenetic analyses of the complete nuclear ribosomal internal transcribed spacer regions and partial sequences of actin, beta-tubulin, calmodulin and translation elongation factor 1-α were used to resolve species on Citrus and related Diaporthe species. Diaporthe citri occurs on Citrus throughout the Citrus-growing regions of the world. Diaporthe cytosporella is found on Citrus in Europe and California (USA). Diaporthe foeniculina, including the synonym D. neotheicola, is recognised as a species with an extensive host range including Citrus. Diaporthe medusaea, a name widely used for D. citri, was determined to be a synonym of D. rudis, a species with a broad host range. Diaporthe citri is delimited based on molecular phylogenetic analysis with the inclusion of the conserved ex-type and additional collections from different geographic locations worldwide. Diaporthe cytosporella, D. foeniculina and D. rudis are epitypified, fully described and illustrated with a review of all synonyms based on molecular data and morphological studies. Newly designed primers are introduced to optimise the amplification and sequencing of calmodulin and actin genes in Diaporthe. A discussion is provided of the utility of genes and the need for multi-gene phylogenies when distinguishing species of Diaporthe or describing new species.

First Report of Pilidium concavum causing Leaf Necrosis on Fallopia japonica in the United States.

Fallopia japonica (Houtt.) Ronse Decr. (= Polygonum cuspidatum Siebold & Zucc.; Japanese knotweed, JKW) is an invasive perennial forb in the Polygonaceae. It has been identified as a target for biological control in many parts of the world, including the United States. Several potted JKW plants in an outdoor study at the Oregon Department of Agriculture, Salem (44.93° N, 122.99° W) developed leaf spots. Samples collected on August 20, 2007, were sent to the FDWSRU for identification of the disease. The necrotic leaf spots were brown and large, 1 to 3 cm in diameter, and in some cases occupying 30% of the leaf area. Both hemispherical and discoid conidiomata with gloeoid spore masses (3) developed in necrotic areas of all leaves placed in moist chambers. Discoid conidiomata had dark, pedicellate bases subtending a fimbriate disc on which pale brown to brown gloeoid conidial masses were produced. Hemispherical conidiomata were black, circular, sessile, and somewhat flattened, within which similar, gloeoid conidial masses were produced. Conidia from each type of conidioma were unicellular, cylindrical to fusiform, hyaline, and 4.5 to 7.2 × 0.9 to 1.8 µm (mean 5.7 × 1.33). Artificial inoculation of 15 plants was made on two occasions with a suspension of 106 conidia per ml, followed by two 16-hr dew periods at 25°C that were separated by an 8-hr "day;" a similar set of 15 non-inoculated plants served as controls each time. Symptoms similar to those in the original sample developed within 2 months after inoculation. The fungus was easily reisolated, and conidia from each type of conidioma produced similar growth on artificial media and similar disease after inoculation. The characteristics of conidial size and distinctly different conidiomata are diagnostic of Pilidium concavum (Desm.) Höhn (3,4). A sequence of the ITS1-5.8S-ITS2 region DNA, extracted using a DNeasy Plant Mini Kit (QIAGEN), was found identical to that of P. concavum from Rosa sp. (BPI 1107275; GenBank Accession No. AY487094), using BLAST. This isolate, FDWSRU 07-116, has been deposited in the US National Fungus Collection (BPI 883546) and at the Centraalbureau voor Schimmelcultures (CBS 132725). Sequence data have been deposited in GenBank (JQ790789). To our knowledge, this is the first report of P. concavum causing disease on a member of the Polygonaceae in North America (1), a disease clearly different from a Japanese Mycosphaerella sp. under consideration for biological control of JKW in the United Kingdom (2). References: (1) D. F. Farr, and A. Y. Rossman. Fungal Databases, Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , May 15, 2012. (2) D. Kurose et al. MycoSci. 50:179, 2009. (3) M. E. Palm, Mycologia 83:787, 1991. (4) A. Y. Rossman, et al. Mycol. Progr. 3:275, 2004.

Phylogeny and taxonomic revision of the Planistromellaceae including its coelomycetous anamorphs: contributions towards a monograph of the genus Kellermania.

The core species of the family Planistromellaceae are included in the teleomorphic genera Planistroma and Planistromella and the connected anamorphic, coelomycetous genera Alpakesa, Kellermania, and Piptarthron. These genera have been defined primarily on the basis of ascospore septation or number of conidial appendages. Due to a lack of DNA sequence data, phylogenetic placement of these genera within the Dothideomycetes, evaluation of monophyly, and questions about generic boundaries could not be adequately addressed in the past. Isolates of nearly all of the known species in these genera were studied genetically and morphologically. DNA sequence data were generated for the nSSU, ITS, nLSU, and RPB1 markers and analysed phylogenetically. These results placed the Planistromellaceae, herein recognised as a distinct family, in an unresolved position relative to other genera within the order Botryosphaeriales. Species representing the core genera of the Planistromellaceae formed a clade and evaluation of its topology revealed that previous morphology-based definitions of genera resulted in an artificial classification system. Alpakesa, Kellermania, Piptarthron, Planistroma, and Planistromella are herein recognised as belonging to the single genus Kellermania. The following new combinations are proposed: Kellermania crassispora, K. dasylirionis, K. macrospora, K. plurilocularis, and K. unilocularis. Five new species are described, namely K. con- fusa, K. dasylirionicola, K. micranthae, K. ramaleyae, and K. rostratae. Descriptions of species in vitro and a key to species known from culture are provided.

Fungal Planet description sheets: 128-153.

Novel species of microfungi described in the present study include the following from Australia: Catenulostroma corymbiae from Corymbia, Devriesia stirlingiae from Stirlingia, Penidiella carpentariae from Carpentaria, Phaeococcomyces eucalypti from Eucalyptus, Phialophora livistonae from Livistona, Phyllosticta aristolochiicola from Aristolochia, Clitopilus austroprunulus on sclerophyll forest litter of Eucalyptus regnans and Toxicocladosporium posoqueriae from Posoqueria. Several species are also described from South Africa, namely: Ceramothyrium podocarpi from Podocarpus, Cercospora chrysanthemoides from Chrysanthemoides, Devriesia shakazului from Aloe, Penidiella drakensbergensis from Protea, Strelitziana cliviae from Clivia and Zasmidium syzygii from Syzygium. Other species include Bipolaris microstegii from Microstegium and Synchaetomella acerina from Acer (USA), Brunneiapiospora austropalmicola from Rhopalostylis (New Zealand), Calonectria pentaseptata from Eucalyptus and Macadamia (Vietnam), Ceramothyrium melastoma from Melastoma (Indonesia), Collembolispora aristata from stream foam (Czech Republic), Devriesia imbrexigena from glazed decorative tiles (Portugal), Microcyclospora rhoicola from Rhus (Canada), Seiridium phylicae from Phylica (Tristan de Cunha, Inaccessible Island), Passalora lobeliae-fistulosis from Lobelia (Brazil) and Zymoseptoria verkleyi from Poa (The Netherlands). Valsalnicola represents a new ascomycete genus from Alnus (Austria) and Parapenidiella a new hyphomycete genus from Eucalyptus (Australia). Morphological and culture characteristics along with ITS DNA barcodes are also provided.

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 µm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 µm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

New and Interesting Fungi. 3.

Seven new genera, 26 new species, 10 new combinations, two epitypes, one new name, and 20 interesting new host and / or geographical records are introduced in this study. New genera are: Italiofungus (based on Italiofungus phillyreae) on leaves of Phillyrea latifolia (Italy); Neolamproconium (based on Neolamproconium silvestre) on branch of Tilia sp. (Ukraine); Neosorocybe (based on Neosorocybe pini) on trunk of Pinus sylvestris (Ukraine); Nothoseptoria (based on Nothoseptoria caraganae) on leaves of Caragana arborescens (Russia); Pruniphilomyces (based on Pruniphilomyces circumscissus) on Prunus cerasus (Russia); Vesiculozygosporium (based on Vesiculozygosporium echinosporum) on leaves of Muntingia calabura (Malaysia); Longiseptatispora (based on Longiseptatispora curvata) on leaves of Lonicera tatarica (Russia). New species are: Barrmaelia serenoae on leaf of Serenoa repens (USA); Chaetopsina gautengina on leaves of unidentified grass (South Africa); Chloridium pini on fallen trunk of Pinus sylvestris (Ukraine); Cadophora fallopiae on stems of Reynoutria sachalinensis (Poland); Coleophoma eucalyptigena on leaf litter of Eucalyptus sp. (Spain); Cylindrium corymbiae on leaves of Corymbia maculata (Australia); Diaporthe tarchonanthi on leaves of Tarchonanthus littoralis (South Africa); Elsinoe eucalyptorum on leaves of Eucalyptus propinqua (Australia); Exophiala quercina on dead wood of Quercus sp., (Germany); Fusarium californicum on cambium of budwood of Prunus dulcis (USA); Hypomyces gamsii on wood of Alnus glutinosa (Ukraine); Kalmusia araucariae on leaves of Araucaria bidwillii (USA); Lectera sambuci on leaves of Sambucus nigra (Russia); Melanomma populicola on fallen twig of Populus canadensis (Netherlands), Neocladosporium syringae on branches of Syringa vulgarishorus (Ukraine); Paraconiothyrium iridis on leaves of Iris pseudacorus (Ukraine); Pararoussoella quercina on branch of Quercus robur (Ukraine); Phialemonium pulveris from bore dust of deathwatch beetle (France); Polyscytalum pinicola on needles of Pinus tecunumanii (Malaysia); Acervuloseptoria fraxini on Fraxinus pennsylvanica (Russia); Roussoella arundinacea on culms of Arundo donax (Spain); Sphaerulina neoaceris on leaves of Acer negundo (Russia); Sphaerulina salicicola on leaves of Salix fragilis (Russia); Trichomerium syzygii on leaves of Syzygium cordatum (South Africa); Uzbekistanica vitis-viniferae on dead stem of Vitis vinifera (Ukraine); Vermiculariopsiella eucalyptigena on leaves of Eucalyptus sp. (Australia).

First Report of Japanese Apple Rust Caused by Gymnosporangium yamadae on Malus spp. in North America.

Plants in the genus Malus Mill. are grown in temperate regions for fruit crops such as apple and ornamental landscape plants such as flowering crab apple. Gymnosporangium yamadae Miyabe ex G. Yamada, cause of Japanese apple rust, is known to attack economically important species of Malus in Asia. In August 2004 and July 2008, the aecial stage of a rust fungus was observed in Wilmington, DE and nearby in Media, PA on leaves of toringo crab apple (Malus toringo (Siebold) Siebold ex de Vriese), a cultivated plant native to Asia. On the basis of morphological and molecular characteristics, the fungus was identified as G. yamadae. This pathogen has not been previously reported in North America. The identification was confirmed by morphological comparisons with specimens of G. yamadae from Asia and descriptions (1-3) as well as using the D1/D2 domain of 28S rDNA sequence data G. clavariiforme (GenBank Accession No. AR426211), G. clavipes (GenBank Accession No. DQ354545), G. cornutum (GenBank Accession No. AF426210), G. juniperi-virginianae (GenBank Accession Nos. AF522167, AY629316, and DQ354547), G. libocedri (GenBank Accession No. AF522168), G. sabinae (GenBank Accession Nos. AF426209 and AY512845) and G. yamadae (GenBank Accession Nos. FJ559373 and FJ559375). The specimens from North America included aecia of G. yamadae that are foliicolous, hypophyllous, roestelioid, and 4 to 7 mm high. The peridia are yellow-brown to brown and cornute to tubular with a closed brown tip at the apex and lacerate sides; the peridial remains often form a reticulate pattern. The peridial cells are long-narrow rhomboid, 83 to 120 µm long with smooth outer walls and verrucose to echinulate inner and side walls. The aeciospores are globose, 18 to 28 × 19 to 29 µm, with a slightly coronate surface and brown-yellow walls 2 to 3 µm thick. The telia known on Juniperus spp. were not observed. The specimens were deposited in the U.S. National Fungus Collections (BPI 878846, BPI 878847, BPI 878848, and BPI 878849). The 28S rDNA sequence of G. yamadae from BPI 878849 was deposited in GenBank as Accession No. FJ455091. Aecia of G. juniperi-virginianae, cause of cedar apple rust, differ from G. yamadae in having recurved peridial walls at maturity. References: (1) F. D. Kern. A Revised Taxonomic Account of Gymnosporangium. Pennsylvania State University Press, University Park, PA, 1973. (2) S. K. Lee and M. Kakishima. Mycoscience 40:109, 1999. (3) S. K. Lee and M. Kakishima. Mycoscience 40:121. 1999.

First Report of Gymnosporangium sabinae, European Pear Rust, on Bradford Pear in Michigan.

Bradford pear, Pyrus calleryana Decne., is well known as an ornamental plant for its flowers, leaf color in fall, and disease resistance, making it desirable as a street tree. In August and October of 2008, the aecial stage of Gymnosporangium sabinae (Dicks.) G. Winter was collected from leaves of P. calleryana in Farmington, MI (Oakland County). The one tree had foliage that was severely affected by the rust fungus. Using published descriptions of G. sabinae as the synonym of G. fuscum, type of the genus Gymnosporangium (1-4), the Michigan specimen was identified and confirmed by comparison with previously reported European and U.S. specimens (BPI 118736 and BPI 856578). The diagnostic characteristics of G. sabinae include: spermagonia epiphyllous; aecia hypophyllous, roestelioid, 3 to 6 mm high; peridium balanoid (acorn shaped), becoming elongated at maturity, pale yellow, sides opening with lateral slits but remaining attached at light brown, pointed apex; peridial cells elongated, 51 to 68 µm long, outer walls smooth, inner walls and side walls sparsely echinulate; aeciospores globose to broadly ellipsoid, somewhat angular, surface slightly coronate, 22 to 32 × 22 to 36 µm, walls orange, 3.5 to 5.5 µm thick. This species is distinguished from other species of Gymnosporangium on Pyrus by the balanoid (acorn-shaped) peridium and the late season maturation of the aecial stage (4). Telia and teliospores of G. sabinae are produced on the alternate host, various species of Juniperus sect. Sabinae, but were not observed in Michigan. The specimen from Michigan is deposited in the U.S. National Fungus Collections (BPI 878928). G. sabinae is widely distributed in Europe, extending to Asia and North Africa, but is rarely reported in North America. It was accidentally introduced into California in the aecial stage on P. communis L. and the telial stage on Juniperus chinensis L. (2), as well as introduced into Canada (British Columbia) (3,4). The only previous report of G. sabinae on P. calleryana is in Germany (1). G. sabinae is known to attack commercial pear and ornamental juniper plants in Europe, thus it seems important to prevent the further spread of this fungus in North America. References: (1) U. Braun. Feddes Repert. Beih. 93:213, 1982. (2) G. Laundon. Mycotaxon 3:133, 1975. (3) A. H. McCain and D. Y. Rosenberg. Calif. Dep. Agric. Bull. 50:13, 1961. (4) J. A. Parmelee. Fungi Canadensis No. 43. Gymnosporangium fuscum, 1974.

Leaf-inhabiting genera of the Gnomoniaceae, Diaporthales.

The Gnomoniaceae are characterised by ascomata that are generally immersed, solitary, without a stroma, or aggregated with a rudimentary stroma, in herbaceous plant material especially in leaves, twigs or stems, but also in bark or wood. The ascomata are black, soft-textured, thin-walled, and pseudoparenchymatous with one or more central or eccentric necks. The asci usually have a distinct apical ring. The Gnomoniaceae includes species having ascospores that are small, mostly less than 25 mum long, although some are longer, and range in septation from non-septate to one-septate, rarely multi-septate. Molecular studies of the Gnomoniaceae suggest that the traditional classification of genera based on characteristics of the ascomata such as position of the neck and ascospores such as septation have resulted in genera that are not monophyletic. In this paper the concepts of the leaf-inhabiting genera in the Gnomoniaceae are reevaluated using multiple genes, specifically nrLSU, translation elongation factor 1-alpha (tef1-alpha), and RNA polymerase II second largest subunit (rpb2) for 64 isolates. ITS sequences were generated for 322 isolates. Six genera of leaf-inhabiting Gnomoniaceae are defined based on placement of their type species within the multigene phylogeny. The new monotypic genus Ambarignomonia is established for an unusual species, A. petiolorum. A key to 59 species of leaf-inhabiting Gnomoniaceae is presented and 22 species of Gnomoniaceae are described and illustrated.

First Report of Colletotrichum dracaenophilum on Dracaena sanderiana in Bulgaria.

In the winter of 2007, severe damage was observed on numerous indoor potted plants of Dracaena sanderiana hort. Sander ex Mast. ("lucky bamboo") in Plovdiv, Bulgaria, which were imported from a country of unknown origin. These plants were already in the retail distribution stream. Initially, the internodes of infected stems appeared pale green with yellowish lesions. An upward spreading necrosis led to a weakness of the stems with wilt and death of the plants occurring within 2 weeks. Eventually, entire stems were covered with numerous, black, globose-to-ellipsoid acervuli with sparse, black setae. The fungus was aseptically isolated from stem lesions on potato dextrose agar (PDA) on which it produced fast-growing, pale pink colonies. On the plant and in culture, the conidia were hyaline, broadly clavate to cylindrical, occasionally slightly curved, and measured 20 to 34 × 6.7 to 10.0 µm (average 28 × 8.5 µm). On the basis of the symptoms on the plant and morphological, cultural, and molecular characteristics, the fungus was identified as Colletotrichum dracaenophilum D.F. Farr & M.E. Palm (1). Pathogenicity of the fungus was confirmed by artificial inoculation of healthy plants of D. sanderiana (three replicates). Stems were inoculated by inserting small mycelial plugs from 7-day-old PDA cultures into wounds that were subsequently covered with Parafilm strips. After 2 weeks, pale green lesions started developing on all inoculated plants and the fungus was successfully reisolated. No symptoms were found around the pure agar control wounds. The specimen from Bulgaria was deposited in the U.S. National Fungus Collections (BPI 877337) with the derived culture deposited as CBS 121453. In addition, the internal transcribed spacer region of the nrDNA of this isolate was sequenced and deposited as GenBank Accession No. EU003533. To our knowledge, this is the first report of C. dracaenophilum on potted plants outside of China and is the first report of this species in Bulgaria. Reference: (1) D. F. Farr et al. Mycol. Res. 110:1395, 2006.

First Report of Dolabra nepheliae on Rambutan and Litchi in Hawaii and Puerto Rico.

A stem canker disease on rambutan (Nephelium lappaceum L.) and litchi (Litchi chinensis Sonn. (Sapindaceae) was found in plants in Hawaii and Puerto Rico. A fungus associated with cankers was identified as Dolabra nepheliae C. Booth & Ting (1). Numerous black, stipitate, elongate ascomata were produced within cracks of cankers. These ascomata contain elongate, bitunicate asci amid unbranched, interthecial elements and thin, cylindrical, hyaline ascospores measuring 96 to 136 × 2.5 to 3.5 µm. This fungus was originally described from Malaysia on N. lappaceum (1) and is also known on pulasan (N. mutabile Blume) in Australia (2). Classified by the Food and Agriculture Organization as a 'minor disease', the canker appears to be relatively common in Hawaii and was most likely introduced into Puerto Rico on imported germplasm. Nevertheless, efforts are underway to study the potential damage of this disease as well as mechanisms of control, including introduction of disease resistant clones. Specimens have been deposited at the U.S. National Fungus Collections (Hawaii on Nephelium BPI 878189, Puerto Rico (PR) on Nephelium BPI 878188, and PR on Litchi BPI 878190). Although a specimen of D. nepheliae on L. chinensis was collected from Hawaii in 1984 by G. Wong and C. Hodges and deposited as BPI 626373, this fungus was not known on Nephelium spp. in Hawaii and was not previously known from Puerto Rico on either host. References: (1) C. Booth and W. P. Ting. Trans. Brit. Mycol. Soc. 47:235, 1964. (2) T. K. Lim and Y. Diczbalis. Rambutan. Page 306 in: The New Rural Industries. Online publication. Rural Industries Research and Development Corporation, Australia, 1997.

First Report of the Rust Phragmidium violaceum on Pennsylvania Blackberry in California.

In April 2005, a rust fungus on Pennsylvania blackberry, Rubus pensilvanicus Poiret (= R. abactus Bailey), was collected in Humboldt County, CA. Although native to eastern North America, this host is an escaped cultivar that occurs in disturbed areas throughout California. Morphological and molecular data suggest that this rust is Phragmidium violaceum (Schultz) G. Winter. To confirm the identification of the specimen from California, an ~1,000-bp section of ribosomal DNA from the 28S large subunit was amplified and sequenced with rust-specific primers (M. C. Aime, unpublished data) (Genbank Accession No. EF672358). This sequence was 100% homologous to sequences of this rust species from Oregon and France. Widespread in Europe and introduced into Australasia as a biological control agent, P. violaceum has recently been reported from Oregon on Himalayan and evergreen blackberries, R. armeniacus Focke and R. laciniatus Willd. (2). Finding this rust in California about the same time as in Oregon suggests that its distribution may be widespread, possibly existing in the United States for some time. To our knowledge, this the first report from California and of the rust species on this plant host (1). The specimen from California is infected with urediniospores but lacks teliospores; it has been deposited at the U.S. National Fungus Collections as BPI 877816. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. Online publication. USDA, ARS, 2007. (2) N. Osterbauer et al. Online publication. doi:10.1094/PHP-2005-0923-01-BR. Plant Health Progress, 2005.

Where are all the undescribed fungi?

ABSTRACT The hypothesis that there are 1.5 million fungal species on Earth, of which only about 70,000 are described, implies that 1.43 million remain undescribed. The recognition that many new species have yet to be found is of fundamental importance to plant pathologists, agronomists, and plant regulatory officials, among others, who continue to encounter diseases caused by previously unknown or understudied fungi. Unexplored habitats with their arsenal of unknown fungi are also of interest to those searching for novel organisms for use in biological control or for their pharmaceutical attributes. This paper presents data on the expected numbers of fungi in some relatively unexplored habitats, such as tropical forests, and those obligately associated with plants, lichens, and insects. In addition to undiscovered species, many have been collected but remain lost or hidden as named species and ignored for lack of modern characterization; others have been collected and recognized as new species but remain undescribed. Some fungal species are unrecognized within erroneously circumscribed species, often based on presumed host specificity, while others exist as biological species but remain buried within those broadly defined species for lack of gross morphological characterization. From these data, one must conclude that enormous numbers of unrecognized fungi can be found almost everywhere, including one's own backyard.

First Report of Nematostoma artemisiae on Artemisia in the United States.

A fungus associated with leaf hairs of Silver King also known as Silver Wormwood (Artemisia ludoviciana Nutt. subsp. albula (Wooton) Keck) from Missouri (Crawford County, near Bourbon) was identified as the loculoascomycete Nematostoma artemisiae Syd. and P. Syd. When the fungus is present, the leaf hairs become discolored due to the numerous dark ascocarps and eventually drop off and the living leaves lose their silvery appearance, detracting from the ornamental value of the plants. Undocumented observations suggest that the fungus occurred on this host in Ohio and other states of the Midwest in 1995. N. artemisiae was described from Japan on Artemisia indica Willd. and reported once from China on that host. The type specimen was recently redescribed and illustrated by Sivanesan (1) who provided an account of the genus of which this is the type species. The uniloculate fruiting bodies of N. artemisiae are solitary, superficial to basally immersed, dark brown, globose, 120 to 160 µm in diameter, with four to 10 black setae 125 to 175 (300) µm long extending from the thickened region around the ostiole. The bitunicate, cylindrical, 8-spored asci are 50 to 65 × 7 to 9 µm and contain pale brown, broadly fusiform, smooth ascospores, 14 to 18 × 4.5 to 5.0 µm, three-septate, slightly constricted at each septum. The anamorph pycnidia are similar in appearance to the ascomycete fruiting bodies and contain hyaline, broadly spherical conidia 3 to 5 µm in diameter. The specimen has been deposited at the U.S. National Fungus Collection (BPI 749199). Reference: (1) A. Sivanesan. Syst. Ascomycetum 6:201, 1987.

First Report of Ash Anthracnose Caused by Discula fraxinea in Oregon.

Anthracnose on ash trees has been observed on landscape trees in western Oregon, yet there has been no formal report of the disease or its causal fungus. Anthracnose symptoms are observed annually in May and become severe by July when defoliation starts to occur. From 1989 to now, samples have been received from Benton, Josephine, and Marion counties, suggesting that ash anthracnose has been present throughout western Oregon for some time. To identify the causal agent, a fungus was isolated from acervuli on necrotic lesions on leaves of cultivated white ash (Fraxinus americana L.) trees in Benton County in July 2003. The acervuli produced hyaline, nonseptate, ellipsoid conidia 5 to 11 × 3.5 to 6 µm in diameter. The fungus was identified as Discula fraxinea (Peck) Redlin & Stack (teleomorph Gnomoniella fraxini Redlin & Stack) (2). The sequences of the internal transcribed spacer (ITS) region (GenBank Accession No. AY455814) and large subunit (GenBank Accession No. AY455818) nrDNA agreed with those of D. fraxinea from Maryland, except for three single-base substitutions and three insertions/deletions in ITS1. Ash anthracnose has been reported from the central and eastern United States and California, the prairie provinces in Canada, and recently, from British Columbia (1). A specimen (U.S. National Fungus Collections BPI 843391) and culture (Centraal Bureau voor Schimmelcultures CBS 114053) of D. fraxinea from Oregon were deposited. References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory. On-line publication. ARS USDA, 2003. (2) S. C. Redlin and R. W. Stack. Mycotaxon 32:175, 1988.

Phlyctema vagabunda Isolated from Coin Canker of Ash Trees in Michigan.

The coelomycetous fungus Phlyctema vagabunda Desm. (teleomorph Neofabraea alba (E.J. Guthrie) Verkley, synonym Pezicula alba E.J. Guthrie) is associated with a serious canker disease of cultivated ash trees in Michigan. Four- to five-year-old trees of Fraxinus americana cv. Autumn Purple and F. pennsylvanica cvs. Champ Tree, Cimmaron, and Urbanite had cankers that were smooth, round, brownish yellow, approximately 2 to 4 cm in diameter with distinct reddish, cracked margins. Immersed, eventually erumpent, unilocular acervuli developed in the central portions of these cankers. The same fungus was isolated both from the conidia as well as from the margin of the canker. The internal transcribed spacer (ITS) (AY064704) and beta-tubulin (AY064702) sequences were identical to sequences identified in GenBank as Pezicula alba from apple (1), and the morphology was consistent with Phlyctema vagabunda as well (2). P. vagabunda has been studied primarily as the cause of Bull's eye canker of apple (1). P. vagabunda under its numerous synonyms has been reported on various hardwood and herbaceous hosts from temperate regions around the world, including the United States. However, it has not been reported previously on species of Fraxinus. A specimen and culture from the ash cankers in Michigan have been deposited (BPI 841384 and CBS 109875). References: (1) S. N. De Jong et al. Mycol. Res. 105:658, 2001. (2) B. C. Sutton. The Coelomycetes. CMI, Kew, Surrey, UK, 1980.

First Report of Anthracnose of Crupina vulgaris Caused by a Colletotrichum sp. in Greece.

Crupina vulgaris Cass. (common crupina, family Asteraceae), an introduced invasive weed in the northwestern United States, is a target of biological control efforts. During the spring of 2002, ≈30 wilting C. vulgaris plants were found along a road from Volos to Portaria, Greece (39°22'58″N, 22°59'27″E, elevation 446 m). Wilting plants had irregular, purple, necrotic lesions extending along the main stems and petioles. In the laboratory, diseased leaves were surface disinfested and placed on moist filter paper in petri dishes. Acervuli with setae typical of a Colletotrichum sp. were observed after 2 to 5 days. A fungal isolate, DB 02-030, was isolated from these diseased leaves. Stems and leaves of 12- and 16-week-old plants (12 plants of each age) were spray inoculated with an aqueous suspension of 2 × 106 conidia per ml from 14-day-old cultures of DB 02-030 grown on acidified potato dextrose agar (APDA). Inoculated plants were placed in a dew chamber at 18 to 21°C with continuous dew and 8 h of light per day for 48 h. Plants were moved to a greenhouse bench with 8 h of light per day and watered twice daily. Symptoms developed after 7 days on 16-week-old plants (33% symptomatic) and 14 days on 12-week-old plants (17% symptomatic). No symptoms developed on control plants. By 61 days after inoculation, 67% of plants inoculated at 16 weeks of age were dead and 50% of plants inoculated at 12 weeks of age were wilted. Koch's postulates were repeated with isolates from two other plants. Isolate DB 02-030 was reisolated three times from 10 of 10 symptomatic leaves, 4 of 4 stems with necrotic lesions, and 4 of 4 stems with leaves from wilted inoculated plants. Conidia germination on water agar was 95% at 18 to 21°C with light compared with 19% in darkness or at 23 to 26°C. C. vulgaris is an annual plant that emerges during early spring and reproduces only by seeds. As a cool-temperature aggressive pathogen, isolate DB 02-030 has the potential as a biological control agent to reduce seed production and stands of C. vulgaris. This isolate fits the morphology of Colletotrichum gloeosporioides according to Sutton (2). On APDA, conidia were formed after 4 days. Conidia were hyaline, straight, cylindrical, nonseptate, and 18 to 27 × 3 to 6 µm. Setae produced in acervuli were abundant, straight, narrow, and 75 to 210 µm long × 3 µm at the base. Appressoria in vitro were subglobose to clavate and 8 to 12 µm in diameter. Nucleotide sequences were obtained for the internal transcribed spacer (GenBank Accession No. AY539806) and 28S (GenBank Accession No. AY539807) rDNA genes of this isolate. Parsimony analyses (unpublished), with sequences from GenBank and 25 isolates from established culture collections, indicate the isolate on C. vulgaris belongs to a clade of taxonomically problematic Colletotrichum spp. that are only distantly related to other isolates of C. gloeosporioides. A culture of DB 02-030 has been deposited at the Centraalbureau voor Schimmelcultures as CBS 114801. A dried culture voucher specimen has been deposited with the U.S. National Fungus Collections (BPI 843682). To our knowledge, no species of Colletotrichum has been reported previously on any Crupina spp. (1). References: (1) D. F. Farr et al. Fungal Databases. Systematic Botany and Mycology Laboratory, On-line publication. ARS, USDA, 2004. (2) B. C. Sutton. The Coelomycetes. CMI, Kew, Surrey, England, 1980.