A cysteine-rich secretory protein involves in phytohormone melatonin mediated plant resistance to CGMMV.

BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.

Ring Repeating Unit: An Upgraded Structure Representation of Linear Condensation Polymers for Property Prediction.

Unique structure representation of polymers plays a crucial role in developing models for polymer property prediction and polymer design by data-centric approaches. Currently, monomer and repeating unit (RU) approximations are widely used to represent polymer structures for generating feature descriptors in the modeling of quantitative structure-property relationships (QSPR). However, such conventional structure representations may not uniquely approximate heterochain polymers due to the diversity of monomer combinations and the potential multi-RUs. In this study, the so-called ring repeating unit (RRU) method that can uniquely represent polymers with a broad range of structure diversity is proposed for the first time. As a proof of concept, an RRU-based QSPR model was developed to predict the associated glass transition temperature (Tg) of polyimides (PIs) with deterministic values. Comprehensive model validations including external, internal, and Y-random validations were performed. Also, an RU-based QSPR model developed based on the same large database of 1321 PIs provides nonunique prediction results, which further prove the necessity of RRU-based structure representation. Promising results obtained by the application of the RRU-based model confirm that the as-developed RRU method provides an effective representation that accurately captures the sequence of repeat units and thus realizes reliable polymer property prediction by data-driven approaches.

Topsoil selenium (Se) under Se-rich farming in China: Current status, cropping impacts and ecological risk assessment.

Selenium (Se), as an essential microelement, can be supplied through Se-biofortified food from Se-rich soils and associated farming practices for human health, while it can also cause eco-risks if overapplied. In this study, a multi-scale spatiotemporal meta-analysis was conducted to guide sustainable Se-rich farming in China by combining a long-term survey with a reviewed database. The weighted mean concentration, spatial distribution of soil Se, nationwide topsoil Se variation from cropping impacts and its bioavailability-based ecological risks were assessed and quantified. The results showed that the weighted mean content (0.3 mg kg-1) of China was slightly higher than that of previous nationwide topsoil Se surveys, as more Se-rich areas were found in recent high-density sampling surveys. Cropping has overall reduced Se content by 9.5% from farmland across China and deprived more with the increase in farming rotation driven by geo-climatic conditions. Long-term cropping removed Se from Se-rich areas but accumulated it in Se-deficient areas. Additionally, the bioavailable Se content of topsoil in China ranged from 0 to 332 µg kg-1, and the bioavailability-based eco-risks indicated that high eco-risks only existed in overfertilized and extremely high-Se soils, such as in Enshi, Ziyang and some coalfield areas. This work provides evidence for the development of sustainable Se-rich farming with proper utilization of soil Se resources, simultaneously protecting the soil eco-environment.

Identification and characterization of a new geminivirus from soybean plants and determination of V2 as a pathogenicity factor and silencing suppressor.

BACKGROUND: Soybean is one of the four major crops in China. The occurrence of viruses in soybean causes significant economic losses. RESULTS: In this study, the soybean leaves from stay-green plants showing crinkle were collected for metatranscriptomic sequencing. A novel geminivirus, tentatively named soybean geminivirus A (SGVA), was identified in soybean stay-green plants. Sequence analysis of the full-length SGVA genome revealed a genome of 2762 nucleotides that contain six open reading frames. Phylogenetic analyses revealed that SGVA was located adjacent to the clade of begomoviruses in both the full genome-based and C1-based phylogenetic tree, while in the CP-based phylogenetic tree, SGVA was located adjacent to the clade of becurtoviruses. SGVA was proposed as a new recombinant geminivirus. Agroinfectious clone of SGVA was constructed. Typical systemic symptoms of curly leaves were observed at 11 dpi in Nicotiana benthamiana plants and severe dwarfism was observed after 3 weeks post inoculation. Expression of the SGVA encoded V2 and C1 proteins through a potato virus X (PVX) vector caused severe symptoms in N. benthamiana. The V2 protein inhibited local RNA silencing in co-infiltration assays in GFP transgenic 16C N. benthamiana plants. Further study revealed mild symptoms in N. benthamiana plants inoculated with SGVA-ZZ V2-STOP and SGVA-ZZ V2-3738AA mutants. Both the relative viral DNA and CP protein accumulation levels significantly decreased when compared with SGVA-inoculated plants. CONCLUSIONS: This work identified a new geminivirus in soybean stay-green plants and determined V2 as a pathogenicity factor and silencing suppressor.

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Cardiac-specific overexpression of miR-122 induces mitochondria-dependent cardiomyocyte apoptosis and promotes heart failure by inhibiting Hand2.

MicroRNA-122 (miR-122) is one of several microRNAs elevated in heart failure patients. To investigate the potential role and mechanism of miR-122 in heart failure, we constructed a transgenic mouse overexpressing miR-122 in the heart. This mouse exhibited cardiac dysfunction (as assessed by transthoracic echocardiography), morphological abnormalities of the heart and cardiomyocyte apoptosis characteristic of heart failure. Mechanistically, we identified the Hand2 transcription factor as a direct target of miR-122 using a dual-luciferase reporter assay. In Tg-miR-122 mice and H9C2 cells with miR-122 mimics, we detected apoptosis and increased expression of dynamin-related protein-1 (Drp1). This effect was blocked with prior knockdown of Hand2 in vitro. Our work suggests that miR-122 causes cardiomyocyte apoptosis by inhibiting Hand2 and consequently increasing Drp1-mediated mitochondrial fission. Such a mechanism likely contributes to heart failure and so modulating this pathway could be therapeutically valuable against heart failure.

Influence of basal media composition on barrier fidelity within human pluripotent stem cell-derived blood-brain barrier models.

It is increasingly recognized that brain microvascular endothelial cells (BMECs), the principal component of the blood-brain barrier (BBB), are highly sensitive to soluble cues from both the bloodstream and the brain. This concept extends in vitro, where the extracellular milieu can also influence BBB properties in cultured cells. However, the extent to which baseline culture conditions can affect BBB properties in vitro remains unclear, which has implications for model variability and reproducibility, as well as downstream assessments of molecular transport and disease phenotypes. Here, we explore this concept by examining BBB properties within human-induced pluripotent stem cell (iPSC)-derived BMEC-like cells cultured under serum-free conditions in DMEM/F12 and Neurobasal media, which have fully defined compositions. We demonstrate notable differences in both passive and active BBB properties as a function of basal media composition. Further, RNA sequencing and phosphoproteome analyses revealed alterations to various signaling pathways in response to basal media differences. Overall, our results demonstrate that baseline culture conditions can have a profound influence on the performance of in vitro BBB models, and these effects should be considered when designing experiments that utilize such models for basic research and preclinical assays.

An unusual ECG change after a car crash.

A 34-year-old male patient was preparing for splenic artery embolization because of a car crash. Personal or family histories of cardiovascular diseases, sudden cardiac death, or Brugada syndrome were denied. Type 1 Brugada pattern was observed in the preoperative electrocardiogram and gradually resolved within a week. Chest blunt trauma may contribute to the transient ECG changes, and some particular considerations should be taken in this patient.

Identification of cucurbit chlorotic yellows virus P4.9 as a possible movement protein.

BACKGROUND: Cucurbit chlorotic yellows virus (CCYV) is a bipartite cucurbit-infecting crinivirus within the family Closteroviridae. The crinivirus genome varies among genera. P4.9 is the first protein encoded by CCYV RNA2. P5, which is encoded by LIYV, is necessary for efficient viral infectivity in plants; however, it remains unknown whether CCYV P4.9 is involved in movement. FINDING: In this study, we used green fluorescent protein (GFP) to examine the intracellular distribution of P4.9-GFP in plant cells, and observed fluorescence in the cytoplasm and nucleus. Transient expression of P4.9 was localized to the plasmodesmata. Co-infiltration of agrobacterium carrying binary plasmids of P4.9 and GFP facilitated GFP diffusion between cells. Besides P4.9 was able to spread by itself to neighboring cells, and co-localized with a marker specific to the endoplasmic reticulum, HDEL-mCherry, but not with the Golgi marker Man49-mCherry. CONCLUSIONS: Together, these results demonstrate that CCYV P4.9 is involved in cell-cell movement.

Mortality, growth and metabolic responses by 1H-NMR-based metabolomics of earthworms to sodium selenite exposure in soils.

The rapid development of selenium-enriched agriculture leads to the accumulation of selenium in the soil, which has an adverse impact on terrestrial ecosystems. In the present study, the mortality, growth inhibition rate and metabolism of earthworms were examined to investigate the toxicological effects of sodium selenite (Na2SeO3) on earthworms (Eisenia fetida) after exposuring for 14 days (d). We used 1H-NMR-based metabolomics to identify sensitive biomarkers and explored the metabolic responses of earthworms exposed to Na2SeO3. The mortality and growth inhibition rate of earthworms exposed to 70 and 90 mg/kg Na2SeO3 were significantly higher than the rate of control group. The LC50 (the median lethal concentration) of Na2SeO3 was 57.4 mg/kg in this artificial soil test of E. fetida exposed to Na2SeO3 for 14 d. However, there was no significant differences when earthworms were exposed to different concentrations of Na2SeO3. The selected metabolic markers were ATP, lactic acid, leucine, alanine, valine, glycine, glutamic acid, lysine, α-glucose and betaine. Na2SeO3 affected the metabolic level of earthworms, as the percentage of metabolic markers in the earthworm changes when exposed to different concentrations of Na2SeO3. The metabolic disturbances were greater with increasing concentrations of Na2SeO3. The differential metabolic markers were significantly changed when exposed to Na2SeO3 comparing to those in the control group, affecting the tricarboxylic acid cycle process and breaking the metabolic balance. This study showed that Na2SeO3 had toxic effect on the growth and development of earthworms. In addition, this study provided a biochemical insights for the development of selenium-enriched agriculture.

Urban-rural gradients of polycyclic aromatic hydrocarbons in soils at a regional scale: Quantification and prediction.

The quantitative study of urban-rural gradients for persistent organic pollutants (POPs) is extremely important to understand the behavior of POPs as well as for ecological risk assessment and management. In this study, a practical urban-rural gradient model (URGM) was developed using atmospheric point source diffusion combined with a fugacity approach to test potential mathematical relationships among urban and rural soils. The mean value of polycyclic aromatic hydrocarbons (PAHs) for urban soils (0-2-km sites) was 570.80 ng/g, and was approximately 3.5 times higher than rural soils (30-50 km sites). Significant linear correlations were found between the amounts of PAHs in the surface soil and the city population and between the soil concentration and artificial surface area. Urban-rural PAH concentrations were simulated by the URGM and calibrated by city population and land-cover data, with average relative errors of 12.84%. The results showed that the URGM was suitable for simulating urban-rural PAH concentrations at a regional scale. The combustion of fossil fuels, biomass, and coal was the main source of soil PAHs in the study area, and the characteristic ratios of PAHs indicated a transition trend from pyrogenic to petrogenic sources along the urban-rural transects. This study thus provides a combined method for quantifying urban-rural gradients of PAHs and can thereby promote quantitative research on coupling among land cover, socio-economic data, and POP concentrations.

Sublethal or not? Responses of multiple biomarkers in Daphnia magna to single and joint effects of BDE-47 and BDE-209.

Polybrominated diphenyl ethers (PBDEs) are extremely incessant anthropogenic contaminants found in the environment, with dreadful risk to aquatic ecosystems. However, there is a limited amount of data concerning their impacts on freshwater organisms. 2,2',3,3',4,4',5,5',6,6'-decabromodiphenyl ether (BDE-209) and 2,2',4,4'-tetrabromodiphenyl ether (BDE-47) are significant components of total PBDEs in water. The sublethal effects of BDE-47, BDE-209 and their binary mixtures on the aquatic organism Daphnia magna were investigated in acute and chronic exposure experiments. Immobilization and heartbeat were studied in daphnids after 48 h of exposure. Mortality rate, breed number, Cholinesterase (ChE), Glutathione S-transferases (GST) and Catalase (CAT) activities were evaluated after 21 days of exposure. The results showed that at 100 and 200 µg/L concentration of BDE-47, immobilization rate of daphnids were inhibited by 44.0 ±â€¯16.7% and 88.0 ±â€¯10.9%, respectively. The binary mixture of BDE-47 and BDE-209 had uncongenial effects on immobilization of D. magna under acute toxicity test. BDE-209 significantly increased the heartbeat rate of daphnids, which increased even further when combined with BDE-47. After 21 days of exposure, daphnids exposed to single BDE-47 were physiologically altered. The combination of BDE-47 with BDE-209 significantly decreased the mortality rate of daphnids. Irrespective of the concentration, higher numbers of offsprings were produced in the mixtures compared to BDE-47 treatment alone. ChE activities significantly (p < 0.05) decreased at concentrations of 2 and 4 µg/L in single BDE-47 treatment, while GST activity significantly (p < 0.05) decreased at 0.5 µg/L. CAT activities significantly increased with BDE-47 treatments in all the tested concentrations (p < 0.05). The mixtures significantly affect ChE (p < 0.05), GST (p < 0.05) and CAT activities (p < 0.05). The results illustrated that the toxicity of the mixture of PBDE congeners exposed to aquatic organisms may have antagonistic effects. The 21 days chronic test in this study suggests that acute toxicity tests, i.e. 48-h tests, using Daphnia may lead to underestimation of risks associated with PBDEs, especially, BDE-209. Hence, there is a necessity to re-examine PBDE congeners' environmental risk in aquatic organisms.

Infectious clones of the crinivirus cucurbit chlorotic yellows virus are competent for plant systemic infection and vector transmission.

Cucurbit chlorotic yellows virus (CCYV), a recently identified bipartite crinivirus, causes economic losses in cucurbit plants. CCYV is naturally transmitted only by whitefly Bemisia tabaci. Here we constructed full-length cDNA clones of CCYV (RNA1 and RNA2) fused to the T7 RNA polymerase promoter and the cauliflower mosaic virus 35S promoter. CCYV replicated and accumulated efficiently in Cucumis sativus protoplasts transfected with in vitro transcripts. Without RNA2, RNA1 replicated efficiently in C. sativus protoplasts. Agroinoculation with the infectious cDNA clones of CCYV resulted in systemic infection in the host plants of C. sativus and Nicotiana benthamiana. Virus derived from the infectious clones could be transmitted between cucumber plants by vector whiteflies. This system will greatly enhance the reverse genetic studies of CCYV gene functions.

Survival, growth, detoxifying and antioxidative responses of earthworms (Eisenia fetida) exposed to soils with industrial DDT contamination.

The survival, growth, activity of the biotransformation system phase II enzyme glutathione-S-transferase (GST) and the oxidative defense enzyme catalase (CAT) of earthworms exposed to the contaminated soils from a former DDT plant and reference soils were investigated, and compared with the corresponding indicators in simulated soil-earthworm system, unpolluted natural soils with spiked-in DDT series, to identify the toxic effects of DDT on earthworms and their cellular defense system in complex soil system. The results indicated that DDT level in the contaminated soils was significantly higher than that in the reference soils with similar level of other pollutants and soil characters. The mortality, growth inhibition rates, GST and CST activities of earthworms exposed to the contaminated soils were significantly higher than that in reference soils. The contribution of historical DDT in contaminated soils to earthworms was confirmed by the DDT spiked tests. DDT spiked in soils at rates of higher than 200 mg·kg(-1) was significantly toxic to both the survival and the growth of earthworms. DDT significantly stimulated GST and CAT activity in earthworms after 14 days. The CAT and GST activities were also stimulated by DDT exposure at rates of 100 mg·kg(-1) after chronic exposure (42 days). The results provide implications for validating the extrapolation from laboratory simulated soils criteria to contaminated soils and for making site risk assessments.

Two proteins of Cucurbit chlorotic yellows virus, P59 and P9, are self-interacting.

The yeast two-hybrid (Y2H) assay, a powerful tool for identifying protein-protein interactions, has been widely used to study viral protein interactions and to elucidate the functions of viral proteins. In this study, Cucurbit chlorotic yellows virus-encoded proteins were investigated by Y2H assays in all possible pairwise combinations, and the self-interactions of P59 and P9 were detected. The interacting domains of P59 and P9 were identified using vectors carrying an activation domain fused to a truncated version of P59 or P9. We found that the middle region (amino acids 173-344) of P59 was necessary for this self-interaction, while three different truncated versions of P9 showed no interaction with full-length P9. This is the first report of the self-interaction of P59 in the genus Crinivirus.

Growth inhibition and altered gene transcript levels in earthworms (Eisenia fetida) exposed to 2,2',4,4'-tetrabromodiphenyl ether.

The toxic effects of the ubiquitous pollutant 2,2',4,4'-tetrabromodiphenyl ether (BDE-47) on the earthworm Eisenia fetida were assessed by determining growth-inhibition and gene transcript levels of superoxide dismutase (SOD), catalase (CAT), glutathione transferase (GST), and transcriptional changes of the stress-response gene (heat-shock protein 70 [Hsp70]). Somatic growth and growth-inhibition rates in all BDE-47-treated groups were significantly different from those of the controls. The SOD gene transcripts were upregulated at all exposure doses and reached the maximum at the concentration of 400 mg/kg dry weight (dw) (3.84-fold, P < 0.01), which protected earthworms from oxidative stresses. However, downregulation of CAT and Hsp70 was present in all exposure doses and reached to the minimum at concentrations of 400 mg/kg dw (0.07-fold, P < 0.01 and 0.06-fold, P < 0.01, respectively). Upregulation of GST gene transcript level presented significant changes at concentrations of 10 (2.69-fold, P < 0.05) and 100 mg/kg dw (2.55-fold, P < 0.05). SOD maintained a dynamic balance to upregulate SOD expression to eliminate superoxide radicals in all dosage treatments, but downregulation of CAT decreased the ability to eliminate hydrogen peroxide. These changes could result in biochemical and physiological disturbances in earthworms.

[Effects of 1-bromopropane on liver and kidney functions of exposed workers].

OBJECTIVE: To study the effects of 1-bromopropane (1-BP) on liver and kidney functions of exposed workers. METHODS: Occupational health situation in three 1-BP plants was investigated. Fifty-four workers from the 1-BP manufacturing line were chose to be contact group, while 42 workers from non-1-BP manufacturing line as control group. All workers underwent questionnaire survey, liver function test as well as kidney function test. RESULT: Working years has no impact on liver and kidney functions of workers from contact group. Compared with the control, liver and kidney functions test of the two groups showed no statistical difference either. CONCLUSION: The present investigation doesn't prove any impact of occupational 1-BP exposure on worker's liver and kidney functions.

Probabilistic risk assessment of diuron and prometryn in the Gwydir River catchment, Australia, with the input of a novel bioassay based on algal growth.

A probabilistic risk assessment of the selected herbicides (diuron and prometryn) in the Gwydir River catchment was conducted, with the input of the EC50 values derived from both literature and a novel bioassay. Laboratory test based on growth of algae exposed to herbicides assayed with a microplate reader was used to examine the toxicity of diuron and prometryn on the growth of Chlorella vulgaris. Both herbicides showed concentration dependent toxicity in inhibiting the growth of Chlorella during the exposure period of 18-72 h. Diuron caused more toxicity as judged by growth rates than prometryn. Thalaba Creek at Merrywinebone was identified as the 'hotspot' for diuron and prometryn risk in the Gwydir catchment. The use of microplate assays coupled with probabilistic risk assessment is recommended for rapid assessment of ecotoxicity of indigenous species, allowing identification of locations in river catchments requiring environmental management.

Legacy and alternative per-and polyfluoroalkyl substances (PFASs) in the Bohai Bay Rim: Occurrence, partitioning behavior, risk assessment, and emission scenario analysis.

The use of alternative per- and polyfluoroalkyl substances (PFASs) has been practiced because of the restrictions on legacy PFASs. However, knowledge gaps exist on the ecological risks of alternatives and relationships between restrictions and emissions. This study systematically analyzed the occurrence characteristics, water-sediment partitioning behaviors, ecological risks, and emissions of legacy and alternative PFASs in the Bohai Bay Rim (BBR). The mean concentration of total PFASs was 46.105 ng/L in surface water and 6.125 ng/g dry weight (dw) in sediments. As an alternative for perfluorooctanoic acid (PFOA), hexafluoropropylene oxide dimer acid (GenX) had a concentration second only to PFOA in surface water. In sediments, perfluorobutyric acid (PFBA) and GenX were the two predominant contaminants. In the water-sediment partitioning system, GenX, 9-chlorohexadecafluoro-3-oxanone-1-sulfonic acid (F-53B), and 11-chloroeicosafluoro-3-oxaundecane-1-sulfonic acid (8:2 Cl-PFESA) tended to be enriched towards sediments. The species sensitivity distribution (SSD) models revealed the low ecological risks of PFASs and their alternatives in the BBR. Moreover, predicted no-effected concentrations (PNECs) indicated that short-chain alternatives like PFBA and perfluorobutane sulfonate (PFBS) were safer for aquatic ecosystems, while caution should be exercised when using GenX and F-53B. Due to the incremental replacement of PFOA by GenX, cumulative emissions of 1317.96 kg PFOA and 667.22 kg GenX were estimated during 2004-2022, in which PFOA emissions were reduced by 59.2 % due to restrictions implemented since 2016. If more stringent restrictions are implemented from 2023 to 2030, PFOA emissions will further decrease by 85.0 %, but GenX emissions will increase by an additional 21.3 %. Simultaneously, GenX concentrations in surface water are forecasted to surge by 2.02 to 2.45 times in 2023. This study deepens the understanding of PFAS alternatives and assists authorities in developing policies to administer PFAS alternatives.