A novel nepovirus causing a chlorotic fleck disease on common bean (Phaseolus vulgaris L.).

Two common bean leaf samples from Ethiopia that had shown chlorotic fleck and veinal mosaic symptoms but tested ELISA-negative for known viruses were mechanically transmitted to herbaceous hosts to obtain virus isolates ET-773/4 and ET-779. Virus purification from Chenopodium quinoa systemically infected with ET-773/4 yielded icosahedral particles measuring ~ 30 nm in diameter and containing a single capsid protein of ~ 58 kDa, suggesting a nepovirus infection. Analysis of nucleotide sequences generated from RNA1 and RNA2 of the isolates indicated that they represent a distinct virus species in the genus Nepovirus. Surprisingly, the most closely related sequence in the GenBank database was that of Hobart nepovirus 3, an incompletely described metagenomic sequence obtained from honey bees in Tasmania. This new nepovirus from Ethiopia is provisionally named "bean chlorotic fleck virus".

Virus species polemics: 14 senior virologists oppose a proposed change to the ICTV definition of virus species.

The Executive Committee of the International Committee on Taxonomy of Viruses (ICTV) has recently decided to modify the current definition of virus species (Code of Virus Classification and Nomenclature Rule 3.21) and will soon ask the full ICTV membership (189 voting members) to ratify the proposed controversial change. In this discussion paper, 14 senior virologists, including six Life members of the ICTV, compare the present and proposed new definition and recommend that the existing definition of virus species should be retained. Since the pros and cons of the proposal posted on the ICTV website are not widely consulted, the arguments are summarized here in order to reach a wider audience.

First Report of a Nanovirus Disease of Pea in Germany.

During the growing season of 2009, a disease consisting of leaf rolling, top yellows, and plant stunting affected pea (Pisum sativum) in fields near Aschersleben, Saxony-Anhalt, Germany. Samples from symptomatic plants collected in July 2009 were analyzed at the JKI in Braunschweig for infections by various legume viruses by ELISA, immunoelectron microscopy, and transmission assays by sap and aphids. Of 23 samples, 9 were shown to contain Pea enation mosaic virus and three samples each contained Bean leafroll virus and Soybean dwarf virus. From two further samples that had tested negative for the aforementioned viruses, we succeeded in transferring a disease agent to faba bean (Vicia faba) seedlings by giving 50 to 100 individuals of the pea aphid (Acyrthosiphon pisum) acquisition and inoculation access feedings each of ~48 h. Following vector transmission, the agent caused severe yellowing and stunting in pea and faba bean, sometimes followed by necrosis. Attempts at mechanical transmission of the agent failed, and isolation of double-stranded RNA from infected tissue was not successful. Therefore, we considered the possible presence of a nanovirus (4). When using polyclonal antibodies (PAbs) against Faba bean necrotic yellows virus (FBNYV) for double-antibody sandwich (DAS)-ELISA analysis of the two isolates of the disease agent we observed weak but clearly positive reactions. To confirm these weak DAS-ELISA reactions, we used all available monoclonal antibodies (MAbs) raised against FBNYV (1) and faba bean necrotic stunt virus (FBNSV) (3) individually in triple-antibody sandwich (TAS)-ELISA in combination with the FBNYV PAbs for plate coating. Six of 26 MAbs reacted from weak to strong with the two pea isolates, with MAbs FBNYV-3-1F7 and FBNSV-5-1G8 giving the strongest reactions and none of the MAbs giving a differential reaction with the two pea isolates. Employing rolling circle amplification of total DNA extracted from symptomatic leaves of one of the pea isolates yielded a substantial amount of high molecular weight DNA, whereas little or no amplification occurred when using DNA from noninoculated pea leaves. Restriction of the amplified DNA in a nanovirus iteron-specific manner by AatII endonuclease yielded a predominant and abundant product of ~1 kb (3). Sequence comparisons of eight cloned DNAs of 1,002 nucleotides long unequivocally identified them as complete DNA-R component of a new member of the genus Nanovirus (2,4). Its DNA-R sequence (GenBank No. GU553134) is nearly equidistant from the DNA-R sequences of FBNYV (Y11405), FBNSV (GQ150778), Milk vetch dwarf virus (MDV) (AB027511) and Subterranean clover stunt virus (SCSV) (AJ290434), sharing with them respective sequence identities of 79, 78, 79, and 73%. Moreover, it is more distinct from the DNA-R sequences of FBNYV, FBNSV, and MDV than the three latter are from each other (86 to 91%). This together with the serological data relating to the capsid protein properties of this virus strongly suggest that it is distinct from the hitherto described nanoviruses FBNYV, MDV, FBNSV, and SCSV. Therefore, we propose the name pea necrotic yellow dwarf virus (PNYDV) for this new nanovirus naturally infecting pea in Germany. References: (1) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (2) I. Grigoras et al. J. Gen. Virol. 89:583, 2008. (3) I. Grigoras et al. J. Virol. 83:10778, 2009. (4) H. J. Vetten et al. Page 343 in: Virus Taxonomy. Elsevier/Academic Press, London, 2005.

Serological and Molecular Identification of Chickpea chlorotic stunt virus from Chickpea in Iran.

During a survey of chickpea (Cicer arietinum L.) crops in western Iran in July 2009, leaf samples from yellow and stunted plants were collected from fields in the provinces of Kermanshah (n = 30) and Lorestan (n = 16). Symptoms suggested infections by luteoviruses, such as viruses of the Beet western yellows virus (BWYV) subgroup (e.g., Turnip yellows virus [TuYV]) (4) and Chickpea chlorotic stunt virus (CpCSV), a virus first described from Ethiopia (1) and recently reported from other countries of West Asia and North Africa (2). All 46 samples were analyzed by triple-antibody sandwich (TAS)-ELISA (3) using the luteovirus-specific monoclonal antibody (MAb) B-2-5G4 (1), a mixture of three MAbs (1-1G5, -3H4, and -4B12) to an Ethiopian (Eth) isolate of CpCSV (1), and six individual MAbs (5-1F10, -2B8, -3D5, -5B8, -6F11, and 6-4E10) to a CpCSV isolate from Syria (Sy) (2) in combination with a mixture of polyclonal antibodies to CpCSV and BWYV for plate coating. CpCSV-Eth and -Sy were used as positive controls. Six of the sixteen Lorestan samples and two of the thirty Kermanshah samples reacted with MAb B-2-5-G4, indicating infections with a luteovirus. While none of the 46 samples reacted with the mixture of the CpCSV-Eth specific MAbs, two (Lorestan No. 25 and Kermanshah No. 31) of the eight MAb B-2-5-G4-positive samples reacted strongly with each of the six individual MAbs to CpCSV-Sy. Since this indicated the presence of a serotype II isolate of CpCSV in these two chickpea samples from Iran, we tried to confirm this by reverse transcriptase (RT)-PCR. TRI-Reagent (Sigma, St. Louis, MO) was used for total RNA extraction from samples Nos. 25 and 31. RT-PCR was carried out using the primers 5'-CAC GTG AGA TCA ATA GTC AAT GAA TAC GGT CG-3' (sense) and 5'-TTT GTA ATT ACC AAY ATT CCA-3' (antisense) derived from the CpCSV coat protein (CP) gene and 5' end of ORF5, the readthrough domain (RTD), respectively. In RT-PCR experiments, no amplification was observed from healthy plant extracts, but chickpea samples Nos. 25 and 31 yielded amplicons of ~1,100 bp, which were used for cloning and sequencing. The sequences of the complete CP gene and 5' end of ORF5 (RTD) from the two samples were determined and deposited in GenBank (GU930837 and GU930838). Sequence analysis revealed that the two Iranian isolates were most similar to each other, sharing CP nucleotide and amino acid (aa) sequence identities of 97.8 and 99.1%, respectively. They differed from each other only in 3 of the 200 aa positions of their CP sequences and were indistinguishable in the 128 N-terminal aa positions of their RTD sequences. When using DNAMAN for phylogenetic analysis, they clustered with serogroup-II isolates of CpCSV from Egypt, Morocco, and Syria (2), with which they were most closely related (approximately 98% in CP aa sequence). While the two Iranian CpCSV isolates differed by approximately 10% in CP aa sequences from serotype-I isolates of CpCSV, they differed strikingly (by ~27%) in RTD aa sequences from CpCSV-Eth, a serotype-I isolate and the only CpCSV isolate for which RTD sequences are available. To our knowledge, this is the first report of the occurrence of CpCSV in Iran. The virus can cause yellowing and stunting of chickpea similar to symptoms caused by other viruses reported from this crop. References: (1) A. D. Abraham et al. Phytopathology 96:437, 2006. (2) A. D. Abraham et al. Arch. Virol 154:791, 2009. (3) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (4) K. M. Makkouk et al. J. Plant Dis. Prot. 110:157, 2003.

First Report of Beet mosaic virus Infecting Chickpea (Cicer arietinum) in Tunisia.

Chickpea plants with severe yellowing and tip wilting were observed in the Cap-Bon Region of Tunisia in 2006. The viral-like symptoms resulted in yield loss of approximately 25% in some fields. A total of 110 symptomatic chickpea plants was collected from nine chickpea fields and tested at the Virology Laboratory of ICARDA, Syria for eight legume viruses using tissue-blot immunoassay (TBIA) (3). Polyclonal antisera produced at the ICARDA Virology Laboratory were used to test for Chickpea chlorotic dwarf virus (genus Mastrevirus, family Geminiviridae), Broad bean stain virus (genus Comovirus, family Secoviridae), Broad bean mottle virus (genus Bromovirus, family Bromoviridae), and Bean yellow mosaic virus and Pea seed borne mosaic virus (genus Potyvirus, family Potyviridae). Antiserum to Beet mosaic virus (BtMV; genus Potyvirus, family Potyviridae) (AS-0143) was provided by the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). In addition, three monoclonal antibodies (MAb) were used to detect Faba bean necrotic yellows virus (FBNYV; genus Nanovirus, family Nanoviridae) (MAb 3-2E9) (1), potyviruses (PVAS-769 [MAb PTY 3 Potyvirus Group] American Type Culture Collection, Manassas, VA), and luteoviruses (MAb B-2-5G4) (2). Twenty-two of the plants tested positive with MAb PTY 3 and BtMV antisera, 56 samples reacted with MAb B-2-5G4, and eight plants with the FBNYV MAb, whereas 24 plants tested negative with all antisera. Because reactions with the BtMV antiserum were unexpected, detection of BtMV was confirmed by reverse transcription-(RT)-PCR assays using BtMV-specific primers (LN26 and LN27) (4), which produced an amplicon of expected size (1,050 bp) from all plants that reacted with BtMV antiserum but not from plants that were serologically negative. Leaf tissue from a BtMV-infected plant was ground in 0.01 M potassium phosphate buffer, pH 7.2 (1:20, wt/vol), mixed with 0.5% celite, and used for mechanical inoculation of chickpea seedlings (cv. Beja 4). In addition, adults of three legume aphid species (Aphis craccivora, A. fabae, and Acyrthosiphon pisum) were starved for 1 h before feeding on BtMV-infected chickpea leaves for an acquisition access period of 5 min. Fifteen aphids of each species were placed on each chickpea plant, allowed to feed for 24 h, and then sprayed with an insecticide. Tip wilting symptoms appeared on plants 15 to 20 days after mechanical and aphid inoculations but not on plants used as negative control treatments (inoculated mechanically with healthy leaf tissue or with aphids that had fed on noninfected chickpea plants). Use of BtMV antiserum for TBIA analysis of inoculated plants revealed systemic BtMV infections in 35 of 92 plants inoculated mechanically and 15 of 75 plants inoculated with viruliferous A. fabae only. To our knowledge, this is the first record of BtMV infecting chickpea in Tunisia. References: (1) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (2) L. Katul. Characterization by serology and molecular biology of bean leaf roll virus and faba bean necrotic yellows virus. Ph.D. thesis. University of Gottingen, Germany, 1992. (3) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (4) L. G. Nemchinov et al. Arch. Virol. 149:1201, 2004.

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius.

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis 'P1', which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

Host Range, Purification, and Genetic Variability in Sweet potato chlorotic fleck virus.

Sweet potato chlorotic fleck virus (SPCFV) has recently been classified as a putative new member of the genus Carlavirus (family Flexiviridae) on the basis of its molecular properties. In this study, SPCFV was characterized in terms of host range, physical and biological characteristics, and genetic variability. In addition to sweet potato, SPCFV infected some plant species in the families Convolvulaceae, Chenopodiaceae, and Solanaceae. Limited numbers of virus particles were observed in the assimilation parenchyma cells of infected plant tissues; some cells had a distorted and enlarged endoplasmic reticulum though without any cytoplasmic and amorphous inclusions. The normal length of SPCFV particles was determined to be approximately 800 nm. In enzyme-linked immunosorbent assays, polyclonal antibodies raised against purified SPCFV virions were able to detect the virus in infected sweet potato and indicator plant tissues. In immunoelectron microscopy, SPCFV particles were all strongly decorated when reacted with homologous antiserum. Comparison of the 3' terminal part of the genome of a range of geographically diverse isolates revealed a high level of genetic diversity. The amino acid sequence identity in the coat protein and the nucleic acid binding protein ranged from 89 to 99.7% and from 75.9 to 99.2%, respectively. Phylogenetic analysis of both proteins showed a geographically associated clustering into two genogroups.

First Report of Soybean dwarf virus (Genus Luteovirus) Infecting Faba Bean and Clover in Germany.

In 2003, leaf samples from faba bean plants (Vicia faba L.) showing slight growth reductions and yellowing symptoms were collected in a field near Hebenshausen, Hesse, Germany. Some of these samples did not react in triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) with species-specific monoclonal antibodies (Mabs) to either Bean leaf roll virus or Turnip yellows virus, but did react with a broad-spectrum Mab (B-2-5G4) used to detect viruses in the genera Polerovirus and Luteovirus (family Luteoviridae) (1). Since this indicated the occurrence of a hitherto unrecognized polero- or luteovirus in faba bean in Germany, attempts were made to obtain nucleotide sequence information on two of the unknown faba bean isolates using a pair of degenerate primers (S2 [5'-ATCACITTCGGGCCGWSTCTATCAGA-3'] and AS3 [5'-CACGCGTCIACCTATTTIGGRTTITG-3'] [I = inosine]) derived from conserved domains in the capsid protein (CP) genes of several polero- and luteoviruses. Following reverse transcription (RT)-PCR amplification and cloning, the CP gene sequences of two genetically distinct isolates of Soybean dwarf virus (SbDV), a species of the genus Luteovirus, were obtained. To our knowledge, SbDV has not been reported from Germany or Europe but only from Africa, Australia, Japan, and the United States. In the two latter countries, at least two SbDV strain groups, SbDV-Y (for yellowing) and SbDV-D (for dwarfing), are distinguished on the basis of differences in symptomatology, host range, and molecular properties (2-4). On the basis of CP aa sequences, the two faba bean isolates from Hebenshausen differed by 8%, with one (FB1) most similar (>96% identity) to SbDV-D isolates and the other (FB2) closely related (>96%) to SbDV-Y isolates. Similar to observations in Japan (3) and the United States (2), we were able to detect SbDV in numerous samples from red clover (Trifolium pratense) and white clover (T. repens) in Braunschweig using SbDV antibodies (Agdia, Elkhart, IN) in DAS-ELISA. This was confirmed by RT-PCR amplification of CP gene sequences using SbDV-specific primers (SbDVs: 5'-GTCTACCTAAAAATTTCAAAGAATCTG-3'; SbDVas: 5'-CGGACCCGGTTCTCCGTCTA-3'). CP sequence analysis of two SbDV-positive clover samples revealed the presence of a SbDV-D isolate in red clover. However, a white clover plant contained an unusual SbDV isolate that possessed a unique CP, sharing aa sequence identities of approximately 92% with the two faba bean isolates from Germany and only 88.5 to 90.5% with other SbDV isolates. Attempts at aphid transmission of SbDV isolates from clover to faba bean were only successful for the combination Acyrthosiphon pisum and the white clover isolate. No faba bean seedlings became infected when the aphid species Aulacorthum solani and Aphis craccivora were given acquisition access feedings of 48 to 72 h on SbDV-infected white and red clover plants. The sequences determined in this study were deposited in GenBank (Accession Nos. EF466131-EF466134). References: (1) A. D. Abraham et al. Phytopathology 96:437, 2006. (2) V. D. Damsteegt et al. Phytopathology 89:374, 1999. (3) T. Tamada and M. Kojima. No. 179 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1977. (4) H. Terauchi et al. Arch. Virol. 146:1885, 2001.

Chickpea chlorotic stunt virus: A New Polerovirus Infecting Cool-Season Food Legumes in Ethiopia.

ABSTRACT Serological analysis of diseased chickpea and faba bean plantings with yellowing and stunting symptoms suggested the occurrence of an unknown or uncommon member of the family Luteoviridae in Ethiopia. Degenerate primers were used for reverse transcriptase-polymerase chain reaction amplification of the viral coat protein (CP) coding region from both chickpea and faba bean samples. Cloning and sequencing of the amplicons yielded nearly identical (96%) nucleotide sequences of a previously unrecognized species of the family Luteoviridae, with a CP amino acid sequence most closely related (identity of approximately 78%) to that of Groundnut rosette assistor virus. The complete genome (5,900 nts) of a faba bean isolate comprised six major open reading frames characteristic of polero-viruses. Of the four aphid species tested, only Aphis craccivora transmitted the virus in a persistent manner. The host range of the virus was confined to a few species of the family Fabaceae. A rabbit antiserum raised against virion preparations cross-reacted unexpectedly with Beet western yellows virus-like viruses. This necessitated the production of murine monoclonal antibodies which, in combination with the polyclonal antiserum, permitted both sensitive and specific detection of the virus in field samples by triple-antibody sandwich, enzyme-linked immunosorbent assay. Because of the characteristic field and greenhouse symptoms in chickpea, the name Chickpea chlorotic stunt virus is proposed for this new member of the genus Polerovirus (family Luteoviridae).

Serotype A and B strains of bean common mosaic virus are two distinct potyviruses.

The serological relationships among strains of bean common mosaic virus (BCMV) (genus Potyvirus, family Potyviridae) were investigated by testing 13 isolates of the 10 known BCMV pathotypes with two monoclonal antibodies and six antisera to BCMV strains. In addition, other properties of serologically distinct BCMV strains were compared. Two groups of BCMV strains were obtained by ELISA and Western blot serology: serotype A contained the BCMV strains NL3, NL5, and NL8 and serotype B contained the BCMV strains NL1, NL2, NL4, NL6, US4, NL7, NY15, and Fla. SDS polyacrylamide gel electrophoresis and Western blotting of freshly purified preparations, and of extracts from leaves infected with eleven BCMV strains showed that the apparent molecular mass of the capsid protein of the serotype A isolates NL3, NL5, and NL8 are lower (about M(r) 33,000) than those of the serotype B isolates (M(r) 34,500 to 35,000). The normal lengths of the particles of the serotype A isolates were shorter (810-818 nm) than those of most isolates (except NL6 and NY15) of serotype B (847-886 nm). All isolates studied induced cytoplasmic pinwheel and scroll inclusions. Cells infected with serotype A isolates contained a specific type of proliferated endoplasmic reticulum which was never found in cells infected with serotype B isolates. The capsid protein gene of a representative member of each serotype was cloned and sequenced. Molecular mass calculations based upon nucleotide sequence-derived amino acid sequences yielded M(r) of 29,662 and 32,489 for the capsid proteins of the serotype A isolate NL8 and the serotype B isolate NL4, respectively. Comparison of the coat-protein sequences showed considerable differences at the N-termini whereas the core regions and the C-termini appeared to be highly conserved. Marked differences were also observed within the 3' non-coding regions of cloned cDNAs of NL 4 and NL 8. The striking differences between the two serotypes of BCMV strongly suggest that they be classified as two distinct potyviruses which naturally infect Phaseolus beans.

Further Evidence that Shallot Yellow Stripe Virus (SYSV) Is a Distinct Potyvirus and Reidentification of Welsh Onion Yellow Stripe Virus as a SYSV Strain.

ABSTRACT An antiserum to shallot yellow stripe virus (SYSV) was raised and used in combination with a range of other antisera to potyviruses of Allium spp. in electron microscopic decoration experiments. The serological results corroborated an earlier finding that the type isolates of SYSV and Welsh onion yellow stripe virus (WoYSV) are closely related to each other and only distantly related to onion yellow dwarf (OYDV) and leek yellow stripe (LYSV) viruses, the two other major potyviruses infecting Allium spp. Moreover, the decoration results indicated that Japanese potyviruses named OYDV and Wakegi yellow dwarf virus are isolates of SYSV. Sequence analysis of the 3'-terminal regions of the SYSV and WoYSV ge-nomes revealed coat protein (CP) amino acid and 3'-nontranslated region (3'-NTR) nucleotide sequence identities of 95 and 89%, respectively. The CP amino acid and 3'-NTR nucleotide sequences of these viruses differed from those of OYDV and LYSV by >25 and >67%, respectively. The serological and molecular studies showed that SYSV and WoYSV are different strains of a potyvirus distinct from OYDV and LYSV. For priority reasons, we propose that these strains together with the Wakegi-type isolates of OYDV described in Japan be referred to as SYSV and that SYSV isolates from Allium spp. other than shallot be designated as the Welsh onion strain of SYSV (SYSV-Wo).

Occurrence of Lily mottle virus in Escarole.

Lily mottle virus (LMoV), genus Potyvirus, an important virus of lily that also causes flower-breaking in tulip (1), is considered to have a natural host range restricted to the family Liliaceae. In 1996, escarole (Cichorium endivia L. var. latifolium LAM) plants growing in fields close to Torino, Italy, and showing mosaic and necrotic spots on outer leaves were infected by a potyvirus related to LMoV. The virus was identified by immunoelectron microscopy (IEM) done on experimentally infected Nicotiana benthamiana and Chenopodium quinoa. The virus isolated from escarole (LMoV-E) had an experimental host range similar to that of lily isolates of LMoV, although species within the Liliaceae were not tested. LMoV-E systemically infected all nine escarole cultivars and six of seven endive cultivars (C. endivia L. var. crispum LAM) but did not infect any of six lettuce and two chicory cultivars (C. intybus L. var. foliosum HEGI). Symptoms ranged from mild to severe mosaic and were generally more severe on escarole than on endive. Some of the same escarole, endive, and lettuce cultivars were inoculated with a typical LMoV isolate from lily (Le97/49, from A. F. L. M. Derks, the Netherlands), which induced mild systemic infections in only one escarole and one endive cultivar. Both cultivars were also susceptible to LMoV-E. LMoV-E was purified from N. benthamiana, and an antiserum was prepared. IEM decoration titer experiments were done with LMoV-E and four other LMoV isolates from Liliaceae and their homologous antisera. Heterologous titers ranging from identity to serological differentiation index values of 2 to 4 were obtained, confirming the identity of the escarole isolate as a LMoV strain and indicating considerable serological variability among LMoV isolates. In a field survey of endive and escarole crops in 1998, in the area where LMoV-E was first identified, the virus was again detected by enzyme-linked immunosorbent assay in 4 of 80 escarole plants tested. LMoV-E appears to be a LMoV strain particularly adapted to escarole. To our knowledge, this is the first report of LMoV identified in a naturally infected host outside monocotyledonous plants. Reference: (1) E. L. Dekker et al. J. Gen. Virol. 74:881, 1993.

Identification of the East African Strain of Sweet Potato Chlorotic Stunt Virus as a Major Component of Sweet Potato Virus Disease in Southern Africa.

Sweet potato virus disease (SPVD) is the most damaging disease of sweet potato Ipomoea batatas (L.) Lam. in Africa. It is caused by sweet potato feathery mottle potyvirus (SPFMV) plus either the West African strain of sweet potato chlorotic stunt crinivirus (Closteroviridae) (SPCSV-WA) (2) or the serologically distinct and apparently more severe East African strain (SPCSV-EA) (1). Typical symptoms of SPVD include severe plant stunting, leaf distortion, chlorosis, mosaic, or vein clearing (1). During a survey done in February 1998 of 48 farmers' fields in Lusaka Province and North Western Province of Zambia, sweet potato plants with typical SPVD symptoms were observed. Incidence was generally 1 to 5% but occasionally >20%. To determine which viruses (SPFMV, SPCSV-EA, SPCSV-WA) were present in symptomatic plants, enzyme-linked immunosorbent assays (ELISAs) were done on leaf sap extracts. Twenty-two SPVD-affected plants from Lusaka Province and 15 from North Western Province were tested and SPFMV and SPCSV-EA (but not SPCSV-WA) were detected in all samples. SPCSV-EA by itself may cause purpling or yellowing of lower or middle leaves (1). Eight plants showing these symptoms were collected from North Western Province, and SPCSV-EA only was detected in six of the samples. SPVD was also observed in a 1997 survey of crops near Antsirable, Madagascar; incidence was generally <1% but occasionally >20%; SPFMV and SPCSV-EA, but not SPCSV-WA, were detected in two SPVD samples tested. Our results are the first report of SPCSV in southern Africa. SPVD in the regions surveyed appears to be due to SPFMV and SPCSV-EA; SPCSV-WA was not detected. References: (1) R. W. Gibson et al. Plant Pathol. 47:95, 1998. (2) G. A. Schaefers and E. R. Terry. Phytopathology 66:642, 1976.

Sequence analysis of the entire RNA genome of a sweet potato chlorotic fleck virus isolate reveals that it belongs to a distinct carlavirus species.

Since the paucity of information on sweet potato chlorotic fleck virus (SPCFV) had precluded its classification, we have determined the complete nucleotide sequence of the single-stranded RNA genome of a Ugandan isolate of SPCFV. The genome is 9104 nucleotides long (excluding the poly(A) tail) and potentially includes six open reading frames (ORFs). Based on genomic organisation and sequence similarity, SPCFV appears to be a member of the genus Carlavirus (family Flexiviridae). However, SPCFV is distantly related to typical carlaviruses, as most of its putative gene products share amino acid sequence identities of <40% with those of typical carlaviruses. Its closest relative is melon yellowing-associated virus, a proposed carlavirus from Brazil, with which it shares ORF5 and ORF6 amino acid sequence identities of 61 and 46%, respectively.

Biological and molecular variability among geographically diverse isolates of sweet potato virus 2.

Sweet potato virus 2 (SPV2) is a tentative member of the genus Potyvirus, family Potyviridae. In addition to the type isolate of SPV2 recently characterised in greater detail, twelve additional isolates of this virus were obtained from sweet potato clones originating from China, Portugal, South Africa and Zambia. Sequences of the coat protein (CP) gene and 3' non-translated region (NTR) were determined. Comparisons of the CP gene sequences of these isolates revealed nucleotide and amino acid sequence identities ranging from 81 to 99% and from 86 to 99%, respectively. Phylogenetic analysis of sequences distinguished several groups, which partially correlated with the geographic origin of the isolates, and indicated that some isolates from South Africa and a Zambian isolate are most distinct both in CP and 3'NTR sequences. Host range studies of a selected number of isolates revealed some differences in test plant reactions, which appeared to correlate to some extent with the geographic origin and molecular distinctness of the SPV2 isolates. The results strongly suggest the occurrence of biologically and genetically diverse strains of SPV2.

Infectivity of nanovirus DNAs: induction of disease by cloned genome components of Faba bean necrotic yellows virus.

Circumstantial evidence suggests that the genome of Faba bean necrotic yellows virus (FBNYV), a nanovirus, consists of eight distinct, circular, single-stranded DNAs, each of about 1 kb and encoding only one protein. Here, the use of cloned full-length FBNYV DNAs for reproducing FBNYV-like symptoms in Vicia faba, the principal natural host of FBNYV, is reported. Characteristic symptoms of FBNYV infection were obtained in faba bean plants following biolistic DNA delivery or agroinoculation with all eight FBNYV DNAs. Although the eight different DNAs have been invariably detected in field samples infected with the various geographical FBNYV isolates, experimental infection with different combinations of fewer than eight DNAs also led to typical FBNYV symptoms. Even only five genome components, DNA-R, DNA-S, DNA-M, DNA-U1 and DNA-U2, were sufficient for inducing disease symptoms in V. faba upon agroinoculation. Symptomatic plants agroinoculated or bombarded with eight DNAs contained typical FBNYV virions; however, the virus was not transmitted by Aphis craccivora or Acyrthosiphon pisum, two efficient aphid vectors of FBNYV.

Molecular characterization of isolates of anagyris vein yellowing virus, plantago mottle virus and scrophularia mottle virus -- comparison of various approaches for tymovirus classification.

The complete nucleotide sequences were determined for the genomic RNAs of three tymoviruses, i.e. isolates of anagyris vein yellowing virus (AVYV), plantago mottle virus (PlMoV) and scrophularia mottle virus (SrMV) which are all serologically closely related to ononis yellow mosaic virus (ibid) and to Nemesia ring necrosis virus (NeRNV), a recently described recombinant virus which is widely spread in commercially grown ornamental plant species belonging to the Scrophulariaceae. Total nucleotide and coat protein amino acid sequence identities revealed similar groupings in the genus tymovirus as serological studies did. The latter, however, tended to suggest much closer relationships than the molecular data and may fail to recognise the distinctiveness of new tymovirus species. The usefulness of various species demarcation criteria for the classification of tymoviruses is discussed.