G-quadruplex in the TMV Genome Regulates Viral Proliferation and Acts as Antiviral Target of Photodynamic Therapy.

Plant viruses seriously disrupt crop growth and development, and classic protein-targeted antiviral drugs could not provide complete protection against them. It is urgent to develop antiviral compounds with novel targets. Photodynamic therapy shows potential in controlling agricultural pests, but nonselective damage from reactive oxygen species (ROS) unexpectedly affects healthy tissues. A G-quadruplex (G4)-forming sequence in the tobacco mosaic virus (TMV) genome was identified to interfere the RNA replication in vitro, and affect the proliferation of TMV in tobacco. N-methyl mesoporphyrin IX stabilizing the G4 structure exhibited inhibition against viral proliferation, which was comparable to the inhibition effect of ribavirin. This indicated that G4 could work as an antiviral target. The large conjugate planes shared by G4 ligands and photosensitizers (PSs) remind us that the PSs could work as antiviral agents by targeting G4 in the genome of TMV. Chlorin e6 (Ce6) was identified to stabilize the G4 structure in the dark and selectively cleave the G4 sequence by producing ROS upon LED-light irradiation, leading to 92.2% inhibition against TMV in vivo, which is higher than that of commercial ningnanmycin. The inhibition of Ce6 was lost against the mutant variants lacking the G4-forming sequence. These findings indicated that the G-quadruplex in the TMV genome worked as an important structural element regulating viral proliferation, and could act as the antiviral target of photodynamic therapy.

Unfolding of an RNA G-quadruplex motif in the negative strand genome of porcine reproductive and respiratory syndrome virus by host and viral helicases to promote viral replication.

G-quadruplex (G4) is a unique secondary structure formed by guanine-rich nucleic acid sequences. Growing studies reported that the genomes of some viruses harbor G4 structures associated with viral replication, opening up a new field to dissect viral infection. Porcine reproductive and respiratory syndrome virus (PRRSV), a representative member of Arteriviridae, is an economically significant pathogen that has devastated the swine industry worldwide for over 30 years. In this study, we identified a highly conserved G-rich sequence with parallel-type G4 structure (named PRRSV-G4) in the negative strand genome RNA of PRRSV. Pyridostatin (PDS), a well-known G4-binding ligand, stabilized the PRRSV-G4 structure and inhibited viral replication. By screening the proteins interacting with PRRSV-G4 in PRRSV-infected cells and single-molecule magnetic tweezers analysis, we found that two helicases, host DDX18 and viral nsp10, interact with and efficiently unwound the PRRSV-G4 structure, thereby facilitating viral replication. Using a PRRSV reverse genetics system, we confirmed that recombinant PRRSV with a G4-disruptive mutation exhibited resistance to PDS treatment, thereby displaying higher replication than wild-type PRRSV. Collectively, these results demonstrate that the PRRSV-G4 structure plays a crucial regulatory role in viral replication, and targeting this structure represents a promising strategy for antiviral therapies.

PDA-PRGCN: identification of Piwi-interacting RNA-disease associations through subgraph projection and residual scaling-based feature augmentation.

BACKGROUND: Emerging evidences show that Piwi-interacting RNAs (piRNAs) play a pivotal role in numerous complex human diseases. Identifying potential piRNA-disease associations (PDAs) is crucial for understanding disease pathogenesis at molecular level. Compared to the biological wet experiments, the computational methods provide a cost-effective strategy. However, few computational methods have been developed so far. RESULTS: Here, we proposed an end-to-end model, referred to as PDA-PRGCN (PDA prediction using subgraph Projection and Residual scaling-based feature augmentation through Graph Convolutional Network). Specifically, starting with the known piRNA-disease associations represented as a graph, we applied subgraph projection to construct piRNA-piRNA and disease-disease subgraphs for the first time, followed by a residual scaling-based feature augmentation algorithm for node initial representation. Then, we adopted graph convolutional network (GCN) to learn and identify potential PDAs as a link prediction task on the constructed heterogeneous graph. Comprehensive experiments, including the performance comparison of individual components in PDA-PRGCN, indicated the significant improvement of integrating subgraph projection, node feature augmentation and dual-loss mechanism into GCN for PDA prediction. Compared with state-of-the-art approaches, PDA-PRGCN gave more accurate and robust predictions. Finally, the case studies further corroborated that PDA-PRGCN can reliably detect PDAs. CONCLUSION: PDA-PRGCN provides a powerful method for PDA prediction, which can also serve as a screening tool for studies of complex diseases.

Mechanistic Insights into the Ligand-Induced Unfolding of an RNA G-Quadruplex.

The cationic porphyrin TMPyP4 is a well-established DNA G-quadruplex (G4) binding ligand that can stabilize different topologies via multiple binding modes. However, TMPyP4 can have both a stabilizing and destabilizing effect on RNA G4 structures. The structural mechanisms that mediate RNA G4 unfolding remain unknown. Here, we report on the TMPyP4-induced RNA G4 unfolding mechanism studied by well-tempered metadynamics (WT-MetaD) with supporting biophysical experiments. The simulations predict a two-state mechanism of TMPyP4 interaction via a groove-bound and a top-face-bound conformation. The dynamics of TMPyP4 stacking on the top tetrad disrupts Hoogsteen H-bonds between guanine bases, resulting in the consecutive TMPyP4 intercalation from top-to-bottom G-tetrads. The results reveal a striking correlation between computational and experimental approaches and validate WT-MetaD simulations as a powerful tool for studying RNA G4-ligand interactions.

Recent advancement in small molecules as HCV inhibitors.

Hepatitis C virus (HCV) has caused a considerable threat to human health. To date, no treatments are without side effects. The proteins and RNA associated with HCV have specific functions during the viral life cycle. The vulnerabilities to virus are associated with those proteins or RNA. Thus, targeting these proteins and RNA is an efficient strategy to develop anti-HCV therapeutics. The treatment for HCV-infected patients has been greatly improved after the approval of direct-acting antivirals (DAAs). However, the cost of DAAs is unusually high, which adds to the economic burden on patients with chronic liver diseases. So far, many efforts have been devoted to the development of small molecules as novel HCV inhibitors. Investigations on the inhibitory activities of these small molecules have involved the target identification and the mechanism of action. In this mini-review, these small molecules divided into four kinds were elaborated, which focused on their targets and structural features. Furthermore, we raised the current challenges and promising prospects. This mini-review may facilitate the development of small molecules with improved activities targeting HCV based on the chemical scaffolds of HCV inhibitors.

Native de novo structural determinations of non-canonical nucleic acid motifs by X-ray crystallography at long wavelengths.

Obtaining phase information remains a formidable challenge for nucleic acid structure determination. The introduction of an X-ray synchrotron beamline designed to be tunable to long wavelengths at Diamond Light Source has opened the possibility to native de novo structure determinations by the use of intrinsic scattering elements. This provides opportunities to overcome the limitations of introducing modifying nucleotides, often required to derive phasing information. In this paper, we build on established methods to generate new tools for nucleic acid structure determinations. We report on the use of (i) native intrinsic potassium single-wavelength anomalous dispersion methods (K-SAD), (ii) use of anomalous scattering elements integral to the crystallization buffer (extrinsic cobalt and intrinsic potassium ions), (iii) extrinsic bromine and intrinsic phosphorus SAD to solve complex nucleic acid structures. Using the reported methods we solved the structures of (i) Pseudorabies virus (PRV) RNA G-quadruplex and ligand complex, (ii) PRV DNA G-quadruplex, and (iii) an i-motif of human telomeric sequence. Our results highlight the utility of using intrinsic scattering as a pathway to solve and determine non-canonical nucleic acid motifs and reveal the variability of topology, influence of ligand binding, and glycosidic angle rearrangements seen between RNA and DNA G-quadruplexes of the same sequence.

BMPQ-1 binds selectively to (3+1) hybrid topologies in human telomeric G-quadruplex multimers.

A single G-quadruplex forming sequence from the human telomere can adopt six distinct topologies that are inter-convertible under physiological conditions. This presents challenges to design ligands that show selectivity and specificity towards a particular conformation. Additional complexity is introduced in differentiating multimeric G-quadruplexes over monomeric species, which would be able to form in the single-stranded 3' ends of telomeres. A few ligands have been reported that bind to dimeric quadruplexes, but their preclinical pharmacological evaluation is limited. Using multidisciplinary approaches, we identified a novel quinoline core ligand, BMPQ-1, which bound to human telomeric G-quadruplex multimers over monomeric G-quadruplexes with high selectivity, and induced the formation of G-quadruplex DNA along with the related DNA damage response at the telomere. BMPQ-1 reduced tumor cell proliferation with an IC50 of ∼1.0 µM and decreased tumor growth rate in mouse by half. Biophysical analysis using smFRET identified a mixture of multiple conformations coexisting for dimeric G-quadruplexes in solution. Here, we showed that the titration of BMPQ-1 shifted the conformational ensemble of multimeric G-quadruplexes towards (3+1) hybrid-2 topology, which became more pronounced as further G-quadruplex units are added.

Open access databases available for the pesticide lead discovery.

Pesticide research is a multi-disciplinary collaborative study, and big data analysis based on integrating information from databases benefits decision-making in pesticide research. In the last 40 years, dozens of pesticide-related databases have been built up to describe their biological activities, toxicity, modes of action, and environmental risks, etc. However, these data are scattered and overlapping in different databases in multiple inconsistent formats, which is not convenient for information analysis and comparison. In this study, the content of 26 open access databases related to pesticide research was illustrated according to the information provided for the ligand-based drug design (LBDD) and receptor-based (or structure-based drug design, SBDD), and was summarized into three categories:1) the correspondence between the chemical structures and functional properties (biological activity, resistance, toxicity, environmental adaptation); 2) action mode study (target identification, target structures, and biological pathways); 3) computational servers for pesticide design. To our knowledge, this is the first review about the open access databases for pesticide research. The data classification could facilitate the information accessibility for pesticide research, and speed up the decision-making process in pesticide discovery.

Recent advances in the development of small molecules targeting RNA G-quadruplexes for drug discovery.

Extensive evidence indicates that RNA G-quadruplexes have associated with some important cellular events. Investigation of RNA G-quadruplexes is thus vital to revealing their biofunctions. Several small molecules have been developed to target RNA G-quadruplexes to date. Some of the small molecules showed significantly light-up fluorescence signals upon binding to RNA G-quadruplexes, while some of them regulated the biofunctions of RNA G-quadruplexes. In this mini-review, the small molecules divided into four kinds are expounded which focused mainly on their structural features and biological activities. Moreover, we raised the current challenges and promising prospects. This mini-review might contribute to exploiting more sophisticated small molecules targeting RNA G-quadruplexes with high specificity based on the reported chemical structural features.

Selective recognition of c-MYC Pu22 G-quadruplex by a fluorescent probe.

Nucleic acid mimics of fluorescent proteins can be valuable tools to locate and image functional biomolecules in cells. Stacking between the internal G-quartet, formed in the mimics, and the exogenous fluorophore probes constitutes the basis for fluorescence emission. The precision of recognition depends upon probes selectively targeting the specific G-quadruplex in the mimics. However, the design of probes recognizing a G-quadruplex with high selectivity in vitro and in vivo remains a challenge. Through structure-based screening and optimization, we identified a light-up fluorescent probe, 9CI that selectively recognizes c-MYC Pu22 G-quadruplex both in vitro and ex vivo. Upon binding, the biocompatible probe emits both blue and green fluorescence with the excitation at 405 nm. With 9CI and c-MYC Pu22 G-quadruplex complex as the fluorescent response core, a DNA mimic of fluorescent proteins was constructed, which succeeded in locating a functional aptamer on the cellular periphery. The recognition mechanism analysis suggested the high selectivity and strong fluorescence response was attributed to the entire recognition process consisting of the kinetic match, dynamic interaction, and the final stacking. This study implies both the single stacking state and the dynamic recognition process are crucial for designing fluorescent probes or ligands with high selectivity for a specific G-quadruplex structure.

G2-quadruplex in the 3'UTR of IE180 regulates Pseudorabies virus replication by enhancing gene expression.

RNA secondary structure elements in the mRNA 3'-untranslated regions (3'UTR) play important roles in post-transcriptional regulation. RNA structure elements in the viral RNA provide valuable model for studying diverse regulation mechanisms. Herpesvirus genomes are double-stranded DNA with GC-rich sequences, which can be transcribed into abundant GC-rich RNAs. It is valuable to explore the structures and function of those GC-rich RNAs. We identified a G2-quadruplex-forming sequence named PQS18-1 in the 3'UTR of the unique immediate early gene of Pseudorabies virus (PRV), an important member of Alphaherpesvirinae subfamily. The RNA PQS18-1 was folded into parallel G-quadruplex structure, enhancing gene expression. Both non-G-quadruplex mutant and G3-quadruplex mutant in the 3'UTR showed lower gene expression level than the wildtype G2-quadruplex. TMPyP4 destroyed PQS18-1 G2-quadruplex and suppressed gene expression, accordingly reducing PRV replication by one titre in the PK15 cells at 24 h post infection. Our findings indicated that the RNA G2-quadruplex in 3'UTR was essential for high expression of IE180 gene, and it could be a specific post-transcription regulation element in response to small molecules or other macromolecules. This study discovers a novel RNA G2-quadruplex in the 3'UTR of an immediate early gene of alphaherpesvirus and provides a new nucleic acid target for anti-virus drug design.

Oligo(ethylene glycol)-Functionalized Ratiometric Fluorescent Probe for the Detection of Hydrazine in Vitro and in Vivo.

Hydrazine induced toxicity causes serious harm to the health of humans. The detection of N2H4 in vitro and in vivo has attracted a great deal of attention, especially in the context of fluorescent probes. Although some fluorescent N2H4 probes have been reported, only a few operate in purely aqueous media and, as a result, require the use of organic cosolvents which hinders their use in analysis of real samples. In addition, most of the current N2H4 probes are either "off-on" or "on-off" types, in which it is difficult to eliminate interference from background fluorescence commonly occurring in in vitro and in vivo systems. Furthermore, some probes are unable to differentiate hydrazine from other organic amines. To address the above problems, we developed a novel oligo(ethylene glycol)-functionalized fluorescent probe for the detection of N2H4. The probe, which has a donor-π-acceptor (D-π-A)-type structure, is water-soluble, and it can be utilized to selectively detect N2H4 in both colorimetric and ratiometric mode. Furthermore, the probe is able to differentiate hydrazine from other organic amines and can be used to detect hydrazine vapor and for imaging A549 cells and zebrafish.

Intensive Distribution of G2-Quaduplexes in the Pseudorabies Virus Genome and Their Sensitivity to Cations and G-Quadruplex Ligands.

Guanine-rich sequences in the genomes of herpesviruses can fold into G-quadruplexes. Compared with the widely-studied G3-quadruplexes, the dynamic G2-quadruplexes are more sensitive to the cell microenvironment, but they attract less attention. Pseudorabies virus (PRV) is the model species for the study of the latency and reactivation of herpesvirus in the nervous system. A total of 1722 G2-PQSs and 205 G3-PQSs without overlap were identified in the PRV genome. Twelve G2-PQSs from the CDS region exhibited high conservation in the genomes of the Varicellovirus genus. Eleven G2-PQSs were 100% conserved in the repeated region of the annotated PRV genomes. There were 212 non-redundant G2-PQSs in the 3' UTR and 19 non-redundant G2-PQSs in the 5' UTR, which would mediate gene expression in the post-transcription and translation processes. The majority of examined G2-PQSs formed parallel structures and exhibited different sensitivities to cations and small molecules in vitro. Two G2-PQSs, respectively, from 3' UTR of UL5 (encoding helicase motif) and UL9 (encoding sequence-specific ori-binding protein) exhibited diverse regulatory activities with/without specific ligands in vivo. The G-quadruplex ligand, NMM, exhibited a potential for reducing the virulence of the PRV Ea strain. The systematic analysis of the distribution of G2-PQSs in the PRV genomes could guide further studies of the G-quadruplexes' functions in the life cycle of herpesviruses.

Flexibility and structural conservation in a c-KIT G-quadruplex.

A quadruplex sequence from the promoter region of the c-KIT gene forms a stable quadruplex, as characterized by crystallographic and NMR methods. Two new crystal structures are reported here, together with molecular dynamics simulation studies on these quadruplex crystal structures and an NMR structure. The new crystal structures, each in a distinct space group and lattice packing arrangement, together with the existing structures, demonstrate that the c-KIT quadruplex fold does not change with differing environments, suggesting that quadruplex topological dynamism is not a general phenomenon. The single and dinucleotide loops in these structures show a high degree of conformational flexibility within the three crystal forms and the NMR ensemble, with no evidence of clustering to particular conformers. This is in accord with the findings of high loop flexibility from the molecular dynamics studies. It is suggested that intramolecular quadruplexes can be grouped into two broad classes (i) those with at least one single-nucleotide loop, often showing singular topologies even though loops are highly flexible, and (ii) with all loops comprising at least two nucleotides, leading to topological dynamism. The loops can have more stable and less dynamic base-stacked secondary structures.

Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation.

We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.

Structural descriptions of ligand interactions to RNA quadruplexes folded from the non-coding region of pseudorabies virus.

To rationalise the binding of specific ligands to RNA-quadruplex we investigated several naphthalene diimide ligands that interact with the non-coding region of Pseudorabies virus (PRV). Herein we report on the x-ray structure of the naphthalene diimide ND11 with an RNA G-quadruplex putative forming sequence from rPRV. Consistent with previously observed rPRV sequence it assembles into a bimolecular RNA G-quadruplex consisting of a pair of two tetrads stacked 3' to 5'. We observe that ND11 interacts by binding on both the externally available 5' and 3' quartets. The CUC (loop 1) is structurally altered to enhance the 5' mode of interaction. These loop residues are shifted significantly to generate a new ligand binding pocket whereas the terminal A14 residue is lifted away from the RNA G-quadruplex tetrad plane to be restacked above the bound ND11 ligand NDI core. CD analysis of this family of NDI ligands shows consistency in the spectra between the different ligands in the presence of the rPRV RNA G-quadruplex motif, reflecting a common folded topology and mode of ligand interaction. FRET melt assay confirms the strong stabilising properties of the tetrasubstituted NDI compounds and the contributions length of the substituted groups have on melt temperatures.

Small-molecule binding to the DNA minor groove is mediated by a conserved water cluster.

High-resolution crystal structures of the DNA duplex sequence d(CGCGAATTCGCG)(2) complexed with three minor-groove ligands are reported. A highly conserved cluster of 11 linked water molecules has been found in the native and all 3 ligand-bound structures, positioned at the boundary of the A/T and G/C regions where the minor groove widens. This cluster appears to play a key structural role in stabilizing noncovalently binding small molecules in the AT region of the B-DNA minor groove. The cluster extends from the backbone phosphate groups along the mouth of the groove and links to DNA and ligands by a network of hydrogen bonds that help to maintain the ligands in position. This arrangement of water molecules is distinct from, but linked by, hydrogen bonding to the well-established spine of hydration, which is displaced by bound ligands. Features of the water cluster and observed differences in binding modes help to explain the measured binding affinities and thermodynamic characteristics of these ligands on binding to AT sites in DNA.

Crystal structure of a promoter sequence in the B-raf gene reveals an intertwined dimer quadruplex.

The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.

An overview of single-molecule techniques and applications in the study of nucleic acid structure and function.

Nucleic acids are an indispensable component in all known life forms. The biological processes are regulated by Nucleic acids, which associate to form special high-order structures. since the high-level structures of nucleic acids are related to gene expression in cancer cells or viruses, it is very likely to become a potential drug target. Traditional biochemical methods are limited to distinguish the conformational distribution and dynamic transition process of single nucleic acid structure. The ligands based on the intermediate and transition states between different conformations are not designed by traditional biochemical methods. The single-molecule techniques enable real-time observation of the individual nucleic acid behavior due to its high resolution. Here, we introduce the application of single-molecule techniques in the study of small molecules to recognize nucleic acid structures, such as single-molecule FRET, magnetic tweezers, optical tweezers and atomic force microscopy. At the same time, we also introduce the specific advantages of single-molecule technology compared with traditional biochemical methods and some problems arisen in current research.

In vivo dynamics and regulation of DNA G-quadruplex structures in mammals.

G-quadruplex (G4) is a four-stranded helical DNA secondary structure formed by guanine-rich sequence folding, and G4 has been computationally predicted to exist in a wide range of species. Substantial evidence has supported the formation of endogenous G4 (eG4) in living cells and revealed its regulatory dynamics and critical roles in several important biological processes, making eG4 a regulator of gene expression perturbation and a promising therapeutic target in disease biology. Here, we reviewed the methods for prediction of potential G4 sequences (PQS) and detection of eG4s. We also highlighted the factors affecting the dynamics of eG4s and the effects of eG4 dynamics. Finally, we discussed the future applications of eG4 dynamics in disease therapy.