Two different viral proteins suppress NUCLEAR FACTOR-YC-mediated antiviral immunity during infection in rice.

Plant viruses have multiple strategies to counter and evade the host's antiviral immune response. However, limited research has been conducted on the antiviral defense mechanisms commonly targeted by distinct types of plant viruses. In this study, we discovered that NUCLEAR FACTOR-YC (NF-YC) and NUCLEAR FACTOR-YA (NF-YA), 2 essential components of the NF-Y complex, were commonly targeted by viral proteins encoded by 2 different rice (Oryza sativa L.) viruses, rice stripe virus (RSV, Tenuivirus) and southern rice black streaked dwarf virus (SRBSDV, Fijivirus). In vitro and in vivo experiments showed that OsNF-YCs associate with OsNF-YAs and inhibit their transcriptional activation activity, resulting in the suppression of OsNF-YA-mediated plant susceptibility to rice viruses. Different viral proteins RSV P2 and SRBSDV SP8 directly disrupted the association of OsNF-YCs with OsNF-YAs, thereby suppressing the antiviral defense mediated by OsNF-YCs. These findings suggest an approach for conferring broad-spectrum disease resistance in rice and reveal a common mechanism employed by viral proteins to evade the host's antiviral defense by hindering the antiviral capabilities of OsNF-YCs.

NF-YA transcription factors suppress jasmonic acid-mediated antiviral defense and facilitate viral infection in rice.

NF-Y transcription factors are known to play many diverse roles in the development and physiological responses of plants but little is known about their role in plant defense. Here, we demonstrate the negative roles of rice NF-YA family genes in antiviral defense against two different plant viruses, Rice stripe virus (RSV, Tenuivirus) and Southern rice black-streaked dwarf virus (SRBSDV, Fijivirus). RSV and SRBSDV both induced the expression of OsNF-YA family genes. Overexpression of OsNF-YAs enhanced rice susceptibility to virus infection, while OsNF-YAs RNAi mutants were more resistant. Transcriptome sequencing showed that the expression of jasmonic acid (JA)-related genes was significantly decreased in plants overexpressing OsNF-YA when they were infected by viruses. qRT-PCR and JA sensitivity assays confirmed that OsNF-YAs play negative roles in regulating the JA pathway. Further experiments showed that OsNF-YAs physically interact with JA signaling transcription factors OsMYC2/3 and interfere with JA signaling by dissociating the OsMYC2/3-OsMED25 complex, which inhibits the transcriptional activation activity of OsMYC2/3. Together, our results reveal that OsNF-YAs broadly inhibit plant antiviral defense by repressing JA signaling pathways, and provide new insight into how OsNF-YAs are directly associated with the JA pathway.

A class of independently evolved transcriptional repressors in plant RNA viruses facilitates viral infection and vector feeding.

Plant viruses employ diverse virulence strategies to achieve successful infection, but there are few known general strategies of viral pathogenicity and transmission used by widely different plant viruses. Here, we report a class of independently evolved virulence factors in different plant RNA viruses which possess active transcriptional repressor activity. Rice viruses in the genera Fijivirus, Tenuivirus, and Cytorhabdovirus all have transcriptional repressors that interact in plants with the key components of jasmonic acid (JA) signaling, namely mediator subunit OsMED25, OsJAZ proteins, and OsMYC transcription factors. These transcriptional repressors can directly disassociate the OsMED25-OsMYC complex, inhibit the transcriptional activation of OsMYC, and then combine with OsJAZ proteins to cooperatively attenuate the JA pathway in a way that benefits viral infection. At the same time, these transcriptional repressors efficiently enhanced feeding by the virus insect vectors by repressing JA signaling. Our findings reveal a common strategy in unrelated plant viruses in which viral transcriptional repressors hijack and repress the JA pathway in favor of both viral pathogenicity and vector transmission.

Transcriptional profiling reveals a critical role of GmFT2a in soybean staygreen syndrome caused by the pest Riptortus pedestris.

Soybean staygreen syndrome, characterized by delayed leaf and stem senescence, abnormal pods, and aborted seeds, has recently become a serious and prominent problem in soybean production. Although the pest Riptortus pedestris has received increasing attention as the possible cause of staygreen syndrome, the mechanism remains unknown. Here, we clarify that direct feeding by R. pedestris, not transmission of a pathogen by this pest, is the primary cause of typical soybean staygreen syndrome and that critical feeding damage occurs at the early pod stage. Transcriptome profiling of soybean indicated that many signal transduction pathways, including photoperiod, hormone, defense response, and photosynthesis, respond to R. pedestris infestation. Importantly, we discovered that members of the FLOWERING LOCUS T (FT) gene family were suppressed by R. pedestris infestation, and overexpression of floral inducer GmFT2a attenuates staygreen symptoms by mediating soybean defense response and photosynthesis. Together, our findings systematically illustrate the association between pest infestation and soybean staygreen syndrome and provide the basis for establishing a targeted soybean pest prevention and control system.

GPA5 Encodes a Rab5a Effector Required for Post-Golgi Trafficking of Rice Storage Proteins.

Dense vesicles (DVs) are vesicular carriers, unique to plants, that mediate post-Golgi trafficking of storage proteins to protein storage vacuoles (PSVs) in seeds. However, the molecular mechanisms regulating the directional targeting of DVs to PSVs remain elusive. Here, we show that the rice (Oryza sativa) glutelin precursor accumulation5 (gpa5) mutant is defective in directional targeting of DVs to PSVs, resulting in discharge of its cargo proteins into the extracellular space. Molecular cloning revealed that GPA5 encodes a plant-unique phox-homology domain-containing protein homologous to Arabidopsis (Arabidopsis thaliana) ENDOSOMAL RAB EFFECTOR WITH PX-DOMAIN. We show that GPA5 is a membrane-associated protein capable of forming homodimers and that it is specifically localized to DVs in developing endosperm. Colocalization, biochemical, and genetic evidence demonstrates that GPA5 acts in concert with Rab5a and VPS9a to regulate DV-mediated post-Golgi trafficking to PSVs. Furthermore, we demonstrated that GPA5 physically interacts with a class C core vacuole/endosome tethering complex and a seed plant-specific VAMP727-containing R-soluble N-ethylmaleimide sensitive factor attachment protein receptor complex. Collectively, our results suggest that GPA5 functions as a plant-specific effector of Rab5a required for mediating tethering and membrane fusion of DVs with PSVs in rice endosperm.

Distinct modes of manipulation of rice auxin response factor OsARF17 by different plant RNA viruses for infection.

Plant auxin response factor (ARF) transcription factors are an important class of key transcriptional modulators in auxin signaling. Despite the well-studied roles of ARF transcription factors in plant growth and development, it is largely unknown whether, and how, ARF transcription factors may be involved in plant resistance to pathogens. We show here that two fijiviruses (double-stranded RNA viruses) utilize their proteins to disturb the dimerization of OsARF17 and repress its transcriptional activation ability, while a tenuivirus (negative-sense single-stranded RNA virus) directly interferes with the DNA binding activity of OsARF17. These interactions impair OsARF17-mediated antiviral defense. OsARF17 also confers resistance to a cytorhabdovirus and was directly targeted by one of the viral proteins. Thus, OsARF17 is the common target of several very different viruses. This suggests that OsARF17 plays a crucial role in plant defense against different types of plant viruses, and that these viruses use independently evolved viral proteins to target this key component of auxin signaling and facilitate infection.

Occurrence of Watermelon silver mottle virus in Peanut in China.

Watermelon silver mottle virus (WSMoV), a member of the genus Orthotospovirus of the family Bunyaviridae, was first identified in watermelon in Okinawa prefecture, in Japan (Iwaki et al. 1984). Subsequently, it was reported in a variety of solanaceae and cucurbitaceae crops such as tomato, pepper, and watermelon (Jones et al. 2005). WSMoV is naturally transmitted by vector thrips, and cause chlorotic, ring spots, and crinkling in the hosts (Yeh et al. 1992; Jones et al. 2005). So far, no confirmed reports exist regarding the WSMoV infecting peanut (Arachis hypogaea L.). In a field survey conducted in Yunnan Province, China during July 2022, young peanut plants were observed that were severely stunted (Fig. S1A). The leaves of five symptomatic peanut plants were randomly collected and used to identify potential pathogens via high throughput sequencing (HTS) analysis. Total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA) according to the manufacturer's instructions. Approximately 10 µg of total RNA was purified using magnetic beads (Thermo Fischer Scientific, U.S.A.). A TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA) was utilized for constructing the RNA sequencing library and transcriptome sequencing was performed on an Illumina HiSeq4000 platform (LC Sciences, USA) with a paired-end 150 bp manner. After RNA-seq, 35962944 raw reads were generated as paired-end data. Following quality control, a total of 34026806 clean reads were retained and subsequently assembled into contigs using Trinity software (version 2.8.5). The BLASTn analysis showed that three contigs mapped to the L, M, and S RNA segments of the WSMoV isolates, respectively (accession no. AY863200.1; no. AB042650.1; no. U75379.1). The lengths of three contigs were 8913 bp, 4921 bp, and 3558 bp, and the breadth coverage were 99.97%, 100%, and 100%, respectively. The sequences for L, M and S RNA segments of the WSMoV isolate from Yunnan were submitted to NCBI with the accession number OR123869-OR123871. Specific primers were designed for the nucleocapsid protein (NP) on WSMoV S RNA (5'-ATGTCTAACGTTAAGCAGCT-3'; 5'-TTACACTTCTAAGGAGGTGCT-3'; 828 bp) and the RNA-dependent RNA polymerase (RdRP) on WSMoV L RNA (5'-CTATATGTGCAGGGGGCTGG-3'; 5'- ACCCCTCAATTATGCTCGGC -3'; 948 bp) to verify the presence of WSMoV in peanut plants by RT-PCR. The expected PCR products were successfully amplified from each of the symptomatic tested plants, while not in negative controls (Fig. S1, B and C). Furthermore, the extracted total RNA was subjected to small RNA sequencing, and the results showed the detected small RNAs present a major peak at 21 nt and 22 nt (Fig. S1D). This further confirmed the natural infection of WSMoV in stunted peanut plants. RDRP, an important conserved protein in RNA viruses, which is in the L RNA segment of WSMoV, was selected to construct the phylogenetic tree. The results showed that the WSMoV isolate from Yunnan (OR123869) clustered separately from previously reported isolates (Fig. S2). Numerous economically important crops infected with WSMoV in China have experienced severe economic losses (Rao et al. 2011; Tang et al. 2015). Our data has provided the first confirmation of WSMoV naturally infecting peanuts in China, increasing our knowledge of the virus's host range. Further research is needed to determine this virus's specific vectors, the scope of its spread, and its impact on China's peanut production.

Post-Golgi trafficking of rice storage proteins requires the small GTPase Rab7 activation complex MON1-CCZ1.

Protein storage vacuoles (PSVs) are unique organelles that accumulate storage proteins in plant seeds. Although morphological evidence points to the existence of multiple PSV-trafficking pathways for storage protein targeting, the molecular mechanisms that regulate these processes remain mostly unknown. Here, we report the functional characterization of the rice (Oryza sativa) glutelin precursor accumulation7 (gpa7) mutant, which over-accumulates 57-kDa glutelin precursors in dry seeds. Cytological and immunocytochemistry studies revealed that the gpa7 mutant exhibits abnormal accumulation of storage prevacuolar compartment-like structures, accompanied by the partial mistargeting of glutelins to the extracellular space. The gpa7 mutant was altered in the CCZ1 locus, which encodes the rice homolog of Arabidopsis (Arabidopsis thaliana) CALCIUM CAFFEINE ZINC SENSITIVITY1a (CCZ1a) and CCZ1b. Biochemical evidence showed that rice CCZ1 interacts with MONENSIN SENSITIVITY1 (MON1) and that these proteins function together as the Rat brain 5 (Rab5) effector and the Rab7 guanine nucleotide exchange factor (GEF). Notably, loss of CCZ1 function promoted the endosomal localization of vacuolar protein sorting-associated protein 9 (VPS9), which is the GEF for Rab5 in plants. Together, our results indicate that the MON1-CCZ1 complex is involved in post-Golgi trafficking of rice storage protein through a Rab5- and Rab7-dependent pathway.

Soybean genetic resources contributing to sustainable protein production.

KEY MESSAGE: Genetic resources contributes to the sustainable protein production in soybean. Soybean is an important crop for food, oil, and forage and is the main source of edible vegetable oil and vegetable protein. It plays an important role in maintaining balanced dietary nutrients for human health. The soybean protein content is a quantitative trait mainly controlled by gene additive effects and is usually negatively correlated with agronomic traits such as the oil content and yield. The selection of soybean varieties with high protein content and high yield to secure sustainable protein production is one of the difficulties in soybean breeding. The abundant genetic variation of soybean germplasm resources is the basis for overcoming the obstacles in breeding for soybean varieties with high yield and high protein content. Soybean has been cultivated for more than 5000 years and has spread from China to other parts of the world. The rich genetic resources play an important role in promoting the sustainable production of soybean protein worldwide. In this paper, the origin and spread of soybean and the current status of soybean production are reviewed; the genetic characteristics of soybean protein and the distribution of resources are expounded based on phenotypes; the discovery of soybean seed protein-related genes as well as transcriptomic, metabolomic, and proteomic studies in soybean are elaborated; the creation and utilization of high-protein germplasm resources are introduced; and the prospect of high-protein soybean breeding is described.

GmIAA27 Encodes an AUX/IAA Protein Involved in Dwarfing and Multi-Branching in Soybean.

Soybean plant height and branching affect plant architecture and yield potential in soybean. In this study, the mutant dmbn was obtained by treating the cultivar Zhongpin 661 with ethylmethane sulfonate. The dmbn mutant plants were shorter and more branched than the wild type. The genetic analysis showed that the mutant trait was controlled by a semi-dominant gene. The candidate gene was fine-mapped to a 91 kb interval on Chromosome 9 by combining BSA-seq and linkage analysis. Sequence analysis revealed that Glyma.09g193000 encoding an Aux/IAA protein (GmIAA27) was mutated from C to T in the second exon of the coding region, resulting to amino acid substitution of proline to leucine. Overexpression of the mutant type of this gene in Arabidopsis thaliana inhibited apical dominance and promoted lateral branch development. Expression analysis of GmIAA27 and auxin response genes revealed that some GH3 genes were induced. GmIAA27 relies on auxin to interact with TIR1, whereas Gmiaa27 cannot interact with TIR1 owing to the mutation in the degron motif. Identification of this unique gene that controls soybean plant height and branch development provides a basis for investigating the mechanisms regulating soybean plant architecture development.

A rice LRR receptor-like protein associates with its adaptor kinase OsSOBIR1 to mediate plant immunity against viral infection.

Plants sense pathogen attacks using a variety of receptors at the cell surface. The LRR receptor-like proteins (RLP) and receptor-like kinases (RLK) are widely reported to participate in plant defence against bacterial and fungal pathogen invasion. However, the role of RLP and RLK in plant antiviral defence has rarely been reported. We employed a high-throughput-sequencing approach, transgenic rice plants and viral inoculation assays to investigate the role of OsRLP1 and OsSOBIR1 proteins in rice immunity against virus infection. The transcript of a rice LRR receptor-like protein, OsRLP1, was markedly up-regulated following infection by RBSDV, a devastating pathogen of rice and maize. Viral inoculation on various OsRLP1 mutants demonstrated that OsRLP1 modulates rice resistance against RBSDV infection. It was also shown that OsRLP1 is involved in the RBSDV-induced defence response by positively regulating the activation of MAPKs and PTI-related gene expression. OsRLP1 interacted with a receptor-like kinase OsSOBIR1, which was shown to regulate the PTI response and rice antiviral defence. Our results offer a novel insight into how a virus-induced receptor-like protein and its adaptor kinase activate the PTI response and antiviral defence in rice.

The small GTPase Rab5a and its guanine nucleotide exchange factors are involved in post-Golgi trafficking of storage proteins in developing soybean cotyledon.

Storage protein is the most abundant nutritional component in soybean seed. Morphology-based evidence has verified that storage proteins are initially synthesized on the endoplasmic reticulum, and then follow the Golgi-mediated pathway to the protein storage vacuole. However, the molecular mechanisms of storage protein trafficking in soybean remain unknown. Here, we clone the soybean homologs of Rab5 and its guanine nucleotide exchange factor (GEF) VPS9. GEF activity combined with yeast two-hybrid assays demonstrated that GmVPS9a2 might specifically act as the GEF of the canonical Rab5, while GmVPS9b functions as a common activator for all Rab5s. Subcellular localization experiments showed that GmRab5a was dually localized to the trans-Golgi network and pre-vacuolar compartments in developing soybean cotyledon cells. Expression of a dominant negative variant of Rab5a, or RNAi of either Rab5a or GmVPS9s, significantly disrupted trafficking of mRFP-CT10, a cargo marker for storage protein sorting, to protein storage vacuoles in maturing soybean cotyledons. Together, our results systematically revealed the important role of GmRab5a and its GEFs in storage protein trafficking, and verified the transient expression system as an efficient approach for elucidating storage protein trafficking mechanisms in seed.

Occurrence of Soybean Yellow Common Mosaic Virus in Soybean in China Showing Yellow Common Mosaic Disease.

Soybean yellow common mosaic virus (SYCMV), a positive sense ssRNA virus classified in the genus Sobemovirus, was first reported and characterized in Korea (Nam et al., 2012). Currently, its only known host is soybean (Nam et al., 2012) on which it causes bright yellow mosaic and crinkling of the leaves (Lim et al., 2016). During a field survey in July 2019, bright yellow mosaic and mild crinkling symptoms were observed on soybean leaves (cv. Zhonghuang 13) in the Hubei province of China. To identify the possible pathogen(s) associated to the disease symptoms, leaves from five symptomatic plants were collected, pooled and total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). 10 µg of the total RNA was purified via magnetic beads (Thermo Fischer Scientific, USA) and a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA) was then used to construct an RNA sequencing library. Transcriptome sequencing was performed on an Illumina HiSeq 4000 (LC Sciences, USA). The average insert size for the paired-end library was 300 ± 50 bp. After quality control, a total of 47.5 million clean reads were obtained and assembled using the Trinity software (version 2.8.5). The assembled contigs were searched against NCBI virus RefSeqs (ftp://ftp.ncbi.nlm.nih.gov/refseq/release/viral) by the BLASTx algorithm with a cutoff E value of ≤10-5. 12 contigs sized from 3,421 to 4,093 bp were found to share a sequence identity of 77.5%-94.1% with SYCMV isolates from Japan (LC332541) and South Korea (JF495127.1). No other virus matches were identified. The largest contig (4,093 bp, MT816507) covers 99% of the expected complete genome of SYCMV (4,121 bp, KX096577). To verify the accuracy of the sequence assembled, RT-PCR-Sanger sequencing was performed on a single field plant sample using primers designed for SYCMV (Forward, 5'-GAACAAAGAGTCTGGATCTT-3'; Reverse, 5'-TCCTTCCAAAACCTCGCGGG-3'). The sequence of the amplicon (3854 bp, MT997092) exhibited an identity of 99.9% to the HTS-derived SYCMV contig sequence. Phylogenetic analysis of the amplicon sequence revealed that the SYCMV isolate from China formed a distinct branch in the tree (Fig. S1). Sap from symptomatic field plants was used to mechanically inoculate two soybean cultivars (Jiunong 9 and Kefeng 1, 10 plants per cultivar), and leaves inoculated with phosphate buffer saline (PBS, 0.01 M, pH 7.5) served as a control (3 plants per cultivar). All but the control plants developed systemic bright yellow mosaic symptoms 10 days after inoculation (Fig. S2A). The infection of the soybean plants with SYCMV was confirmed by RT-PCR with the newly designed primers for SYCMV (Forward, 5'- CCTACAGGCATTGGTTTCGT-3'; Reverse, 5'-CGTGAGGTTCTTGCTTCACA-3', anticipated amplicon size: 2,210 bp) (Fig. S2B) and by amplicon sequencing (100% sequence identity with MT9979092). In addition, the infection was further confirmed by immuno-blotting using an antibody against SYCMV coat protein (synthesized by GenScript, USA) (Fig. S2C). Together, the results demonstrate that SYCMV is the causal agent of the bright yellow mosaic symptoms in soybean observed in the field. To the best of our knowledge, this is the first report of SYCMV on soybean in China. These findings shall not only alert local growers to a potential new threat to soybean production in their region, but also provide new insights on the transmission, epidemiology and pathological properties of SYCMV in China.

QTL mapping pod dehiscence resistance in soybean (Glycine max L. Merr.) using specific-locus amplified fragment sequencing.

KEY MESSAGE: We constructed a high-density genetic linkage map comprising 4,593 SLAF markers using specific-locus amplified fragment sequencing and identified six quantitative trait loci for pod dehiscence resistance in soybean. Pod dehiscence is necessary for propagation in wild soybean (Glycine soja). It is a major component causing yield losses in cultivated soybean, however, and thus, cultivated soybean varieties have been artificially selected for resistance to pod dehiscence. Detecting quantitative trait loci (QTLs) related to pod dehiscence is required for molecular marker-assisted selection for breeding new varieties with pod dehiscence resistance. In this study, we constructed a high-density genetic linkage map using 260 recombinant inbred lines derived from the cultivars of Heihe 43 (pod-indehiscent) (ZDD24325) and Heihe 18 (pod-dehiscent) (ZDD23620). The map contained 4953 SLAF markers spanning 1478.86 cM on 20 linkage groups with an average distance between adjacent markers of 0.53 cM. In total, six novel QTLs related to pod dehiscence were mapped using inclusive composite interval mapping, explaining 7.22-24.44% of the phenotypic variance across 3 years, including three stable QTLs (qPD01, qPD05-1 and qPD08-1), that had been validated by developing CAPS/dCAPS markers. Based on the SNP/Indel and significant differential expression analyses of two parents, seven genes were selected as candidate genes for future study. The high-density map, three stable QTLs and their molecular markers will be helpful for map-based cloning of pod dehiscence resistance genes and marker-assisted selection of pod dehiscence resistance in soybean breeding.

Development and utilization of a new chemically-induced soybean library with a high mutation density .

Mutagenized populations have provided important materials for introducing variation and identifying gene function in plants. In this study, an ethyl methanesulfonate (EMS)-induced soybean (Glycine max) population, consisting of 21,600 independent M2 lines, was developed. Over 1,000 M4 (5) families, with diverse abnormal phenotypes for seed composition, seed shape, plant morphology and maturity that are stably expressed across different environments and generations were identified. Phenotypic analysis of the population led to the identification of a yellow pigmentation mutant, gyl, that displayed significantly decreased chlorophyll (Chl) content and abnormal chloroplast development. Sequence analysis showed that gyl is allelic to MinnGold, where a different single nucleotide polymorphism variation in the Mg-chelatase subunit gene (ChlI1a) results in golden yellow leaves. A cleaved amplified polymorphic sequence marker was developed and may be applied to marker-assisted selection for the golden yellow phenotype in soybean breeding. We show that the newly developed soybean EMS mutant population has potential for functional genomics research and genetic improvement in soybean.

Metatranscriptome and small RNA sequencing revealed a mixed infection of newly identified bymovirus and bean yellow mosaic virus on peas.

Peas (Pisum sativum L.) are widely cultivated in temperate regions and are susceptible hosts for various viruses across different families. The discovery and identification of new viruses in peas has significant implications for field disease management. Here, we identified a mixed infection of two viruses from field-collected peas exhibiting virus-like symptoms using metatranscriptome and small RNA sequencing techniques. Upon identification, one of the viruses was determined to be a newly isolated and discovered bymovirus from peas, named "pea bymovirus 1 (PBV1)". The other was identified as a novel variant of bean yellow mosaic virus (BYMV-HZ1). Subsequently, mechanical inoculation and RT-PCR assays confirmed that both viruses could be inoculated back onto peas and tobaccos, showing mixed infection by PBV1 and BYMV-HZ1. To our knowledge, this is the first isolation of a bymovirus from pea and the first documented case of mixed infection of peas by PBV1 and BYMV-HZ1 in China.

Histone deacetylase OsHDA706 orchestrates rice broad-spectrum antiviral immunity and is impeded by a viral effector.

Lysine acetylation is a dynamic post-translational modification of proteins. Extensive studies have revealed that the acetylation modulated by histone acetyltransferases and histone deacetylases (HDACs) plays a crucial role in regulating protein function. However, there has been limited focus on how HDACs regulate jasmonic acid (JA) biosynthesis in plants. Here, we uncover that the protein stability of OsLOX14, a critical enzyme involved in JA biosynthesis, is regulated by a histone deacetylase, OsHDA706, and is hindered by a viral protein. Our results show that OsHDA706 deacetylates OsLOX14 and enhances the stability of OsLOX14, leading to JA accumulation and an improved broad-spectrum rice antiviral defense. Furthermore, we found that the viral protein P2, encoded by the destructive rice stripe virus, disrupts the association of OsHDA706-OsLOX14, promoting viral infection. Overall, our findings reveal how HDAC manipulates the interplay of deacetylation and protein stability of a JA biosynthetic enzyme to enhance plant antiviral responses.

Salivary proteins potentially derived from horizontal gene transfer are critical for salivary sheath formation and other feeding processes.

Herbivorous insects employ an array of salivary proteins to aid feeding. However, the mechanisms behind the recruitment and evolution of these genes to mediate plant-insect interactions remain poorly understood. Here, we report a potential horizontal gene transfer (HGT) event from bacteria to an ancestral bug of Eutrichophora. The acquired genes subsequently underwent duplications and evolved through co-option. We annotated them as horizontal-transferred, Eutrichophora-specific salivary protein (HESPs) according to their origin and function. In Riptortus pedestris (Coreoidea), all nine HESPs are secreted into plants during feeding. The RpHESP4 to RpHESP8 are recently duplicated and found to be indispensable for salivary sheath formation. Silencing of RpHESP4-8 increases the difficulty of R. pedestris in probing the soybean, and the treated insects display a decreased survivability. Although silencing the other RpHESPs does not affect the salivary sheath formation, negative effects are also observed. In Pyrrhocoris apterus (Pyrrhocoroidea), five out of six PaHESPs are secretory salivary proteins, with PaHESP3 being critical for insect survival. The PaHESP5, while important for insects, no longer functions as a salivary protein. Our results provide insight into the potential origin of insect saliva and shed light on the evolution of salivary proteins.

Complete genome sequence of two variant porcine reproductive and respiratory syndrome viruses isolated from vaccinated piglets.

Porcine reproductive and respiratory syndrome virus (PRRSV) continues to affect the Chinese swine industry. Since 2006, variant PRRSV strains sharing two unique discontinuous deletions of 30 amino acids in the nonstructural protein Nsp2 have become dominant in Chinese swine herds and have caused huge economic losses to the swine industry in China. Here we report the complete genome sequence of two novel PRRSV variants isolated from vaccinated piglets with additional amino acid deletions in Nsp2.