Genome copy number predicts extreme evolutionary rate variation in plant mitochondrial DNA.

Nuclear and organellar genomes can evolve at vastly different rates despite occupying the same cell. In most bilaterian animals, mitochondrial DNA (mtDNA) evolves faster than nuclear DNA, whereas this trend is generally reversed in plants. However, in some exceptional angiosperm clades, mtDNA substitution rates have increased up to 5,000-fold compared with closely related lineages. The mechanisms responsible for this acceleration are generally unknown. Because plants rely on homologous recombination to repair mtDNA damage, we hypothesized that mtDNA copy numbers may predict evolutionary rates, as lower copy numbers may provide fewer templates for such repair mechanisms. In support of this hypothesis, we found that copy number explains 47% of the variation in synonymous substitution rates of mtDNA across 60 diverse seed plant species representing ~300 million years of evolution. Copy number was also negatively correlated with mitogenome size, which may be a cause or consequence of mutation rate variation. Both relationships were unique to mtDNA and not observed in plastid DNA. These results suggest that homologous recombinational repair plays a role in driving mtDNA substitution rates in plants and may explain variation in mtDNA evolution more broadly across eukaryotes. Our findings also contribute to broader questions about the relationships between mutation rates, genome size, selection efficiency, and the drift-barrier hypothesis.

Heteroplasmy Is Rare in Plant Mitochondria Compared with Plastids despite Similar Mutation Rates.

Plant cells harbor two membrane-bound organelles containing their own genetic material-plastids and mitochondria. Although the two organelles coexist and coevolve within the same plant cells, they differ in genome copy number, intracellular organization, and mode of segregation. How these attributes affect the time to fixation or, conversely, loss of neutral alleles is currently unresolved. Here, we show that mitochondria and plastids share the same mutation rate, yet plastid alleles remain in a heteroplasmic state significantly longer compared with mitochondrial alleles. By analyzing genetic variants across populations of the marine flowering plant Zostera marina and simulating organelle allele dynamics, we examine the determinants of allele segregation and allele fixation. Our results suggest that the bottlenecks on the cell population, e.g. during branching or seeding, and stratification of the meristematic tissue are important determinants of mitochondrial allele dynamics. Furthermore, we suggest that the prolonged plastid allele dynamics are due to a yet unknown active plastid partition mechanism. The dissimilarity between plastid and mitochondrial novel allele fixation at different levels of organization may manifest in differences in adaptation processes. Our study uncovers fundamental principles of organelle population genetics that are essential for further investigations of long-term evolution and molecular dating of divergence events.

Unprecedented variation pattern of plastid genomes and the potential role in adaptive evolution in Poales.

BACKGROUND: The plastid is the photosynthetic organelle in plant cell, and the plastid genomes (plastomes) are generally conserved in evolution. As one of the most economically and ecologically important order of angiosperms, Poales was previously documented to exhibit great plastomic variation as an order of photoautotrophic plants. RESULTS: We acquired 93 plastomes, representing all the 16 families and 5 major clades of Poales to reveal the extent of their variation and evolutionary pattern. Extensive variation including the largest one in monocots with 225,293 bp in size, heterogeneous GC content, and a wide variety of gene duplication and loss were revealed. Moreover, rare occurrences of three inverted repeat (IR) copies in angiosperms and one IR loss were observed, accompanied by short IR (sIR) and small direct repeat (DR). Widespread structural heteroplasmy, diversified inversions, and unusual genomic rearrangements all appeared in Poales, occasionally within a single species. Extensive repeats in the plastomes were found to be positively correlated with the observed inversions and rearrangements. The variation all showed a "small-large-moderate" trend along the evolution of Poales, as well as for the sequence substitution rate. Finally, we found some positively selected genes, mainly in C4 lineages, while the closely related lineages of those experiencing gene loss tended to have undergone more relaxed purifying selection. CONCLUSIONS: The variation of plastomes in Poales may be related to its successful diversification into diverse habitats and multiple photosynthetic pathway transitions. Our order-scale analyses revealed unusual evolutionary scenarios for plastomes in the photoautotrophic order of Poales and provided new insights into the plastome evolution in angiosperms as a whole.

Cytonuclear evolution in fully heterotrophic plants: lifestyles and gene function determine scenarios.

BACKGROUND: Evidence shows that full mycoheterotrophs and holoparasites often have reduced plastid genomes with rampant gene loss, elevated substitution rates, and deeply altered to conventional evolution in mitochondrial genomes, but mechanisms of cytonuclear evolution is unknown. Endoparasitic Sapria himalayana and mycoheterotrophic Gastrodia and Platanthera guangdongensis represent different heterotrophic types, providing a basis to illustrate cytonuclear evolution. Here, we focused on nuclear-encoded plastid / mitochondrial (N-pt / mt) -targeting protein complexes, including caseinolytic protease (ClpP), ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCo), oxidative phosphorylation system (OXPHOS), DNA recombination, replication, and repair (DNA-RRR) system, and pentatricopeptide repeat (PPR) proteins, to identify evolutionary drivers for cytonuclear interaction. RESULTS: The severity of gene loss of N-pt PPR and pt-RRR genes was positively associated with increased degree of heterotrophy in full mycoheterotrophs and S. himalayana, while N-mt PPR and mt-RRR genes were retained. Substitution rates of organellar and nuclear genes encoding N-pt/mt subunits in protein complexes were evaluated, cytonuclear coevolution was identified in S. himalayana, whereas disproportionate rates of evolution were observed in the OXPHOS complex in full mycoheterotrophs, only slight accelerations in substitution rates were identified in N-mt genes of full mycoheterotrophs. CONCLUSIONS: Nuclear compensatory evolution was identified in protein complexes encoded by plastid and N-pt genes. Selection shaping codon preferences, functional constraint, mt-RRR gene regulation, and post-transcriptional regulation of PPR genes all facilitate mito-nuclear evolution. Our study enriches our understanding of genomic coevolution scenarios in fully heterotrophic plants.

Peering through the hedge: Multiple datasets yield insights into the phylogenetic relationships and incongruences in the tribe Lilieae (Liliaceae).

The increasing use of genome-scale data has significantly facilitated phylogenetic analyses, contributing to the dissection of the underlying evolutionary mechanisms that shape phylogenetic incongruences, such as incomplete lineage sorting (ILS) and hybridization. Lilieae, a prominent member of the Liliaceae family, comprises four genera and approximately 260 species, representing 43% of all species within Liliaceae. They possess high ornamental, medicinal and edible values. Yet, no study has explored the validity of various genome-scale data in phylogenetic analyses within this tribe, nor have potential evolutionary mechanisms underlying its phylogenetic incongruences been investigated. Here, transcriptome, Angiosperms353, plastid and mitochondrial data, were collected from 50 to 93 samples of Lilieae, covering all four recognized genera. Multiple datasets were created and used for phylogenetic analyses based on concatenated and coalescent-based methods. Evolutionary rates of different datasets were calculated, and divergence times were estimated. Various approaches, including coalescence simulation, Quartet Sampling (QS), calculation of concordance factors (gCF and sCF), as well as MSCquartets and reticulate network inference, were carried out to infer the phylogenetic discordances and analyze their underlying mechanisms using a reduced 33-taxon dataset. Despite extensive phylogenetic discordances among gene trees, robust phylogenies were inferred from nuclear and plastid data compared to mitochondrial data, with lower synonymous substitution detected in mitochondrial genes than in nuclear and plastid genes. Significant ILS was detected across the phylogeny of Lilieae, with clear evidence of reticulate evolution identified. Divergence time estimation indicated that most of lineages in Lilieae diverged during a narrow time frame (ranging from 5.0 Ma to 10.0 Ma), consistent with the notion of rapid radiation evolution. Our results suggest that integrating transcriptomic and plastid data can serve as cost-effective and efficient tools for phylogenetic inference and evolutionary analysis within Lilieae, and Angiosperms353 data is also a favorable choice. Mitochondrial data are more suitable for phylogenetic analyses at higher taxonomic levels due to their stronger conservation and lower synonymous substitution rates. Significant phylogenetic incongruences detected in Lilieae were caused by both incomplete lineage sorting (ILS) and reticulate evolution, with hybridization and "ghost introgression" likely prevalent in the evolution of Lilieae species. Our findings provide new insights into the phylogeny of Lilieae, enhancing our understanding of the evolution of species in this tribe.

Chloroplast Genomes Evolution and Phylogenetic Relationships of Caragana species.

Caragana sensu lato (s.l.) includes approximately 100 species that are mainly distributed in arid and semi-arid regions. Caragana species are ecologically valuable for their roles in windbreaking and sand fixation. However, the taxonomy and phylogenetic relationships of the genus Caragana are still unclear. In this study, we sequenced and assembled the chloroplast genomes of representative species of Caragana and reconstructed robust phylogenetic relationships at the section level. The Caragana chloroplast genome has lost the inverted repeat region and wascategorized in the inverted repeat loss clade (IRLC). The chloroplast genomes of the eight species ranged from 128,458 bp to 135,401 bp and contained 110 unique genes. All the Caragana chloroplast genomes have a highly conserved structure and gene order. The number of long repeats and simple sequence repeats (SSRs) showed significant variation among the eight species, indicating heterogeneous evolution in Caragana. Selective pressure analysis of the genes revealed that most of the protein-coding genes evolved under purifying selection. The phylogenetic analyses indicated that each section forms a clade, except the section Spinosae, which was divided into two clades. This study elucidated the evolution of the chloroplast genome within the widely distributed genus Caragana. The detailed information obtained from this study can serve as a valuable resource for understanding the molecular dynamics and phylogenetic relationships within Caragana.

Purifying Selection Determines the Short-Term Time Dependency of Evolutionary Rates in SARS-CoV-2 and pH1N1 Influenza.

High-throughput sequencing enables rapid genome sequencing during infectious disease outbreaks and provides an opportunity to quantify the evolutionary dynamics of pathogens in near real-time. One difficulty of undertaking evolutionary analyses over short timescales is the dependency of the inferred evolutionary parameters on the timespan of observation. Crucially, there are an increasing number of molecular clock analyses using external evolutionary rate priors to infer evolutionary parameters. However, it is not clear which rate prior is appropriate for a given time window of observation due to the time-dependent nature of evolutionary rate estimates. Here, we characterize the molecular evolutionary dynamics of SARS-CoV-2 and 2009 pandemic H1N1 (pH1N1) influenza during the first 12 months of their respective pandemics. We use Bayesian phylogenetic methods to estimate the dates of emergence, evolutionary rates, and growth rates of SARS-CoV-2 and pH1N1 over time and investigate how varying sampling window and data set sizes affect the accuracy of parameter estimation. We further use a generalized McDonald-Kreitman test to estimate the number of segregating nonneutral sites over time. We find that the inferred evolutionary parameters for both pandemics are time dependent, and that the inferred rates of SARS-CoV-2 and pH1N1 decline by ∼50% and ∼100%, respectively, over the course of 1 year. After at least 4 months since the start of sequence sampling, inferred growth rates and emergence dates remain relatively stable and can be inferred reliably using a logistic growth coalescent model. We show that the time dependency of the mean substitution rate is due to elevated substitution rates at terminal branches which are 2-4 times higher than those of internal branches for both viruses. The elevated rate at terminal branches is strongly correlated with an increasing number of segregating nonneutral sites, demonstrating the role of purifying selection in generating the time dependency of evolutionary parameters during pandemics.

Molecular Clocks without Rocks: New Solutions for Old Problems.

Molecular data have been used to date species divergences ever since they were described as documents of evolutionary history in the 1960s. Yet, an inadequate fossil record and discordance between gene trees and species trees are persistently problematic. We examine how, by accommodating gene tree discordance and by scaling branch lengths to absolute time using mutation rate and generation time, multispecies coalescent (MSC) methods can potentially overcome these challenges. We find that time estimates can differ - in some cases, substantially - depending on whether MSC methods or traditional phylogenetic methods that apply concatenation are used, and whether the tree is calibrated with pedigree-based mutation rates or with fossils. We discuss the advantages and shortcomings of both approaches and provide practical guidance for data analysis when using these methods.

Sub-lineage B.1.6 of hMPXV in a global context: Phylogeny and epidemiology.

During the 2022 COVID-19 pandemic, monkeypox emerged as a significant threat to global health. The virus responsible for the disease, the human monkeypox virus (hMPXV), underwent various genetic changes, resulting in the emergence of over a dozen distinct lineages, which could be identified by only a small number of unique mutations. As of January 25, 2023, genomic information of hMPXV generated had reached 4632 accessions in the GISAID database. In this study, we aimed to investigate the epidemiological and phylogenetic characteristics of the B.1.6 sub-lineage of hMPXV in Peru, compared with other circulating sub-lineages during the global outbreak. The B.1.6 sub-lineage, characterized by the 111029G>A mutation, was estimated to have emerged in June 2022 and was found mainly in Peru. Most cases (95.8%) were men with an average age of 33 years, and nearly half of the patients had HIV, of whom only 77.35% received antiretroviral therapy. Our findings revealed that the B.1.6, B.1.4, and B.1.2 sub-lineages were well represented and had a higher number of mutations despite having the lowest media substitution rates per site per year. Moreover, it was estimated that B.1.2 and B.1.4 appeared in February 2022 and were the first two sub-lineages to emerge. A mutation profile was also obtained for each sub-lineage, reflecting that several mutations had a pattern similar to the characteristic mutation. This study provides the first estimation of the substitution rate and ancestry of each monkeypox sub-lineage belonging to the 2022 outbreak. Based on our findings, continued genomic surveillance of monkeypox is necessary to understand better and track the evolution of the virus.

Rate accelerations in plastid and mitochondrial genomes of Cyperaceae occur in the same clades.

Cyperaceae, the second largest family in the monocot order Poales, comprises >5500 species and includes the genus Eleocharis with âˆ¼ 250 species. A previous study of complete plastomes of two Eleocharis species documented extensive structural heteroplasmy, gene order changes, high frequency of dispersed repeats along with gene losses and duplications. To better understand the phylogenetic distribution of gene and intron content as well as rates and patterns of sequence evolution within and between mitochondrial and plastid genomes of Eleocharis and Cyperaceae, an additional 29 Eleocharis organelle genomes were sequenced and analyzed. Eleocharis experienced extensive gene loss in both genomes while loss of introns was mitochondria-specific. Eleocharis has higher rates of synonymous (dS) and nonsynonymous (dN) substitutions in the plastid and mitochondrion than most sampled angiosperms, and the pattern was distinct from other eudicot lineages with accelerated rates. Several clades showed higher dS and dN in mitochondrial genes than in plastid genes. Furthermore, nucleotide substitution rates of mitochondrial genes were significantly accelerated on the branch leading to Cyperaceae compared to most angiosperms. Mitochondrial genes of Cyperaceae exhibited dramatic loss of RNA editing sites and a negative correlation between RNA editing and dS values was detected among angiosperms. Mutagenic retroprocessing and dysfunction of DNA replication, repair and recombination genes are the most likely cause of striking rate accelerations and loss of edit sites and introns in Eleocharis and Cyperaceae organelle genomes.

Mitogenome-based phylogenomics provides insights into the positions of the enigmatic sinensis group and the sanguinolenta group in Selaginellaceae (Lycophyte).

Spikemoss (Selaginellaceae) is one of the basal lineages of vascular plants. This family has a single genus Selaginella which consists of about 750 extant species. The phylogeny of Selaginellaceae has been extensively studied mainly based on plastid DNA and a few nuclear sequences. However, the placement of the enigmatic sinensis group is a long-term controversy because of the long branch in the plastid DNA phylogeny. The sanguinolenta group is also a phylogenetically problematic clade owing to two alternative positions resulted from different datasets. Here, we newly sequenced 34 mitochondrial genomes (mitogenomes) of individuals representing all seven subgenera and major clades in Selaginellaceae. We assembled the draft mitogenomes and annotated the genes and performed phylogenetic analyses based on the shared 17 mitochondrial genes. Our major results include: (1) all the assembled mitogenomes have complicated structures, unparalleled high GC content and a small gene content set, and the positive correlations among GC content, substitution rates and the number of RNA editing sites hold; (2) the sinensis group was well supported as a member of subg. Stachygynandrum; (3) the sanguinolenta group was strongly resolved as sister to all other Selaginella species except for subg. Selaginella. This study demonstrates the potential of mitogenome data in providing novel insights into phylogenetically recalcitrant problems.

Bayesian phylodynamic analysis reveals the evolutionary history and the dispersal patterns of citrus tristeza virus in China based on the p25 gene.

BACKGROUND: Citrus tristeza virus (CTV) is one of the most serious threats to the citrus industry, and is present in both wild and cultivated citrus. The origin and dispersal patterns of CTV is still poorly understood in China. METHODS: In this study, 524 CTV suspected citrus samples from China were collected, including 354 cultivated citrus samples and 174 wild citrus samples. Finally, 126 CTV coat protein sequences were obtained with time-stamped from 10 citrus origins in China. Bayesian phylodynamic inference were performed for CTV origin and dispersal patterns study in China. RESULT: We found that CTV was mainly distributed in southern and coastal areas of China. The substitution rate of CTV was 4.70 × 10- 4 subs/site/year (95% credibility interval: 1.10 × 10- 4 subs/site/year ~ 9.10 × 10- 4 subs/site/year), with a slight increasing trend in CTV populations between 1990 and 2006. The CTV isolates in China shared a most common recent ancestor around 1875 (95% credibility interval: 1676.57 ~ 1961.02). The CTV in China was originated from wild citrus in Hunan and Jiangxi, and then spread from the wild citrus to cultivated citrus in the growing regions of Sichuan, Chongqing, Hubei, Fujian, Zhejiang, Guangxi and Guangdong provinces. CONCLUSIONS: This study has proved that CTV in China was originated from wild citrus in Hunan and Jiangxi. The spatial-temporal distribution and dispersal patterns has uncovered the population and pandemic history of CTV, providing hints toward a better understanding of the spread and origin of CTV in China.

Dates and Rates of Tick-Borne Encephalitis Virus-The Slowest Changing Tick-Borne Flavivirus.

We evaluated the temporal signal and substitution rate of tick-borne encephalitis virus (TBEV) using 276 complete open reading frame (ORF) sequences with known collection dates. According to a permutation test, the TBEV Siberian subtype (TBEV-S) data set has no temporal structure and cannot be applied for substitution rate estimation without other TBEV subtypes. The substitution rate obtained suggests that the common clade of TBEV (TBEV-common), including all TBEV subtypes and louping-ill virus (LIV), is characterized by the lowest rate (1.87 × 10-5 substitutions per site per year (s/s/y) or 1 nucleotide substitution per ORF per 4.9 years; 95% highest posterior density (HPD) interval, 1.3-2.4 × 10-5 s/s/y) among all tick-borne flaviviruses previously assessed. Within TBEV-common, the TBEV European subtype (TBEV-E) has the lowest substitution rate (1.3 × 10-5 s/s/y or 1 nucleotide substitution per ORF per 7.5 years; 95% HPD, 1.0-1.8 × 10-5 s/s/y) as compared with TBEV Far-Eastern subtype (3.0 × 10-5 s/s/y or 1 nucleotide substitution per ORF per 3.2 years; 95% HPD, 1.6-4.5 × 10-5 s/s/y). TBEV-common representing the species tick-borne encephalitis virus diverged 9623 years ago (95% HPD interval, 6373-13,208 years). The TBEV Baikalian subtype is the youngest one (489 years; 95% HPD, 291-697 years) which differs significantly by age from TBEV-E (848 years; 95% HPD, 596-1112 years), LIV (2424 years; 95% HPD, 1572-3400 years), TBEV-FE (1936 years, 95% HPD, 1344-2598 years), and the joint clade of TBEV-S (2505 years, 95% HPD, 1700-3421 years) comprising Vasilchenko, Zausaev, and Baltic lineages.

Complete Chloroplast Genome of Hypericum perforatum and Dynamic Evolution in Hypericum (Hypericaceae).

Hypericum perforatum (St. John's Wort) is a medicinal plant from the Hypericaceae family. Here, we sequenced the whole chloroplast genome of H. perforatum and compared the genome variation among five Hypericum species to discover dynamic changes and elucidate the mechanisms that lead to genome rearrangements in the Hypericum chloroplast genomes. The H. perforatum chloroplast genome is 139,725 bp, exhibiting a circular quadripartite structure with two copies of inverted repeats (IRs) separating a large single-copy region and a small single-copy region. The H. perforatum chloroplast genome encodes 106 unique genes, including 73 protein-coding genes, 29 tRNAs, and 4 rRNAs. Hypericum chloroplast genomes exhibit genome rearrangement and significant variations among species. The genome size variation among the five Hypericum species was remarkably associated with the expansion or contraction of IR regions and gene losses. Three genes-trnK-UUU, infA, and rps16-were lost, and three genes-rps7, rpl23, and rpl32-were pseudogenized in Hypericum. All the Hypericum chloroplast genomes lost the two introns in clpP, the intron in rps12, and the second intron in ycf3. Hypericum chloroplast genomes contain many long repeat sequences, suggesting a role in facilitating rearrangements. Most genes, according to molecular evolution assessments, are under purifying selection.

Dynamic evolution of the plastome in the Elm family (Ulmaceae).

MAIN CONCLUSION: This study compared the plastomes of Ulmaceae allowing analyses of the dynamic evolution, including genome structure, codon usage bias, repeat sequences, molecular mutation rates, and phylogenetic inferences. Ulmaceae is a small family in the order Rosales. This family consists of seven genera, including Ulmus, Zelkova, Planera, Hemiptelea, Phyllostylon, Ampelocera, and Holoptelea. Ulmaceae is an interesting lineage from plant biogeographic, systematic, evolutionary, and paleobotanic perspectives. It is also a good model to investigate the evolution of the plastomes in woody plants. In this study, we sequenced and assembled the complete plastomes of the six Ulmaceae genera to compare genomic structures and reveal the molecular evolutionary patterns. The size of the quadripartite plastomes ranged from 158,290 bp to 161,886 bp. The genomes contained 131 genes, including 87 coding genes, 36 tRNA, and 8 rRNA. The gene number, gene content, and genomic structure were highly consistent among the Ulmaceae genera. Nine variable regions including ndhA intron, ndhF-rpl32, ycf1, psbK-trnS, rps16-trnQ, trnT-trnL, trnT-psbD, trnS-trnG, and rpl32-trnL, were identified in Ulmaceae plastomes according to the nucleotide diversity values. Condon usage was biased among the genes and showed consistent trends in the seven genera. Molecular evolution analyses revealed that most of the genes and all gene groups were under widespread purifying selection. Twelve genes (ccsA, matK, psbH, psbK, rbcL, rpl22, rpl32, rpoA, rps12, rps15, rps16, and ycf2) were under positive selection. Phylogenetic analyses supported that Ulmaceae should be divided into two main clades, such as the temperate clade, including Ulmus, Zelkova, Planera, and Hemiptelea and the tropical clade, including Phyllostylon, Ampelocera and Holoptelea. This study reports the structure and evolutionary characteristics of the Elm family. These new genomic data will benefit assessments of genomic evolution and provide information to elucidate the phylogenetic relationships among Ulmaceae species.

Depth as a driver of evolution and diversification of ancient squat lobsters (Decapoda, Galatheoidea, Phylladiorhynchus).

The exceptional hidden diversity included in the squat lobster genus Phylladiorhynchus and its wide bathymetric and geographic range make it an interesting group to thoroughly study its evolutionary history. Here we have analyzed the entire currently known species diversity of Phylladiorhynchus using an integrative approach that includes morphological and molecular characters. The aim was to establish whether depth range (bathymetry) has played a role in their morphological and molecular evolution and in their diversification pathways. Phylogenetic analyses recovered the genus as monophyletic and as the sister group of Coralliogalathea, conforming with current systematic hypotheses, although their placement in a monophyletic Galatheidae is doubted. All the analyzed species represent well-supported lineages, structured in ten clades, correlated in most part with the morphological phylogeny. The reconstruction of ancestral habitat showed that the most recent common ancestor of Phylladiorhynchus most likely lived in shallow water environments. The divergence time estimation analyses dated the origin of the genus back to the Upper Jurassic, preceding the origin of all the other galatheoid lineages. Morphological analyses suggested that species from deeper waters exhibit greater morphological divergences and lower genetic divergences in comparison to species from shallower waters. In Phylladiorhynchus, the colonization of deeper waters has taken place independently multiple times since the Lower-Cretaceous. Our reconstruction of ancestral habitat suggests that shallow water ancestors might show an acceleration in the molecular rate of evolution and a slowdown in the rates of morphological evolution in comparison to deep sea lineages. However, although lineages from shallow and deep sea habitats show slight differences in diversification trends, bathymetry does not significantly affect the diversification rate in Phylladiorhynchus according to our diversification analyses.

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

Comparative genomics of tadpole shrimps (Crustacea, Branchiopoda, Notostraca): Dynamic genome evolution against the backdrop of morphological stasis.

This analysis presents five genome assemblies of four Notostraca taxa. Notostraca origin dates to the Permian/Upper Devonian and the extant forms show a striking morphological similarity to fossil taxa. The comparison of sequenced genomes with other Branchiopoda genomes shows that, despite the morphological stasis, Notostraca share a dynamic genome evolution with high turnover for gene families' expansion/contraction and a transposable elements content comparable to other branchiopods. While Notostraca substitutions rate appears similar or lower in comparison to other branchiopods, a subset of genes shows a faster evolutionary pace, highlighting the difficulty of generalizing about genomic stasis versus dynamism. Moreover, we found that the variation of Triops cancriformis transposable elements content appeared linked to reproductive strategies, in line with theoretical expectations. Overall, besides providing new genomic resources for the study of these organisms, which appear relevant for their ecology and evolution, we also confirmed the decoupling of morphological and molecular evolution.

Evolutionary Rates are Correlated Between Buchnera Endosymbionts and the Mitochondrial Genomes of Their Aphid Hosts.

The evolution of bacterial endosymbiont genomes is strongly influenced by host-driven selection. Factors affecting host genome evolution will potentially affect endosymbiont genomes in similar ways. One potential outcome is correlations in molecular rates between the genomes of the symbiotic partners. Recently, we presented the first evidence of such correlations between the mitochondrial genomes of cockroaches and the genomes of their endosymbiont (Blattabacterium cuenoti). Here we investigate whether similar patterns are found in additional host-symbiont partners. We use partial genome data from multiple strains of the bacterial endosymbionts Buchnera aphidicola and Sulcia muelleri, and the mitochondrial genomes of their sap-feeding insect hosts. Both endosymbionts show phylogenetic congruence with the mitochondria of their hosts, a result that is expected due to their identical mode of inheritance. We compared root-to-tip distances and branch lengths of phylogenetically independent species pairs. Both analyses showed a highly significant correlation of molecular rates between the genomes of Buchnera and the mitochondrial genomes of their hosts. A similar correlation was detected between Sulcia and their hosts, but was not statistically significant. Our results indicate that evolutionary rate correlations between hosts and long-term symbionts may be a widespread phenomenon.

Time-calibrated genomic evolution of a monomorphic bacterium during its establishment as an endemic crop pathogen.

Horizontal gene transfer is of major evolutionary importance as it allows for the redistribution of phenotypically important genes among lineages. Such genes with essential functions include those involved in resistance to antimicrobial compounds and virulence factors in pathogenic bacteria. Understanding gene turnover at microevolutionary scales is critical to assess the pace of this evolutionary process. Here, we characterized and quantified gene turnover for the epidemic lineage of a bacterial plant pathogen of major agricultural importance worldwide. Relying on a dense geographic sampling spanning 39 years of evolution, we estimated both the dynamics of single nucleotide polymorphism accumulation and gene content turnover. We identified extensive gene content variation among lineages even at the smallest phylogenetic and geographic scales. Gene turnover rate exceeded nucleotide substitution rate by three orders of magnitude. Accessory genes were found preferentially located on plasmids, but we identified a highly plastic chromosomal region hosting ecologically important genes such as transcription activator-like effectors. Whereas most changes in the gene content are probably transient, the rapid spread of a mobile element conferring resistance to copper compounds widely used for the management of plant bacterial pathogens illustrates how some accessory genes can become ubiquitous within a population over short timeframes.