The type I interferon system in the development of lupus.

The type I interferon (IFN) system induces inhibition of viral replication, but can also activate the innate and adaptive immune system. An important role of the type I IFN system in autoimmune diseases, including lupus, is suggested by the observation that these disorders display a prominent over-expression of type I IFN regulated genes. The development of autoimmune diseases in some individuals treated with IFN-α directly supports a pivotal role for this cytokine in breaking tolerance and inducing autoimmune reactions. A genetic setup that promotes type I IFN production and/or response and the presence of endogenous inducers of IFN-α production have been described in patients with lupus. Several known environmental risk factors for development of lupus or disease flares may contribute to the ongoing type I IFN production. In the present review we will describe the possible role of the type I IFN system in the lupus disease process. The possible connection between the type I IFN system and some environmental and genetic risk factors for lupus is also discussed.

B lymphocytes enhance interferon-α production by plasmacytoid dendritic cells.

OBJECTIVE: The type I interferon (IFN) system and B cells are activated in many autoimmune diseases, such as systemic lupus erythematosus (SLE). The IFNα produced by plasmacytoid dendritic cells (PDCs) stimulates several B cell functions, including autoantibody production. However, not much is known about how B cells influence PDC function. The aim of this study was to investigate the regulatory effect of B cells on IFNα production by PDCs. METHODS: PDCs and B cells isolated from peripheral blood mononuclear cells from healthy blood donors were stimulated with RNA-containing immune complexes (ICs) consisting of U1 small nuclear RNP and SLE IgG, herpes simplex virus, or oligonucleotide (ODN) 2216, alone or in cocultures. IFNα, several other cytokines, and PDC- or B cell-associated surface molecules were analyzed using immunoassays or flow cytometry. RESULTS: B cells enhanced IFNα production by PDCs up to 47-fold, and the effect was most pronounced for PDCs stimulated with RNA-containing ICs. Anti-CD31 antibody reduced RNA-containing IC-induced IFNα production by 80% but had no effect on IFNα production when ODN 2216 was used as an inducer. Supernatants from ODN 2216-stimulated B cells promoted IFNα production by PDCs, while supernatants from RNA-containing IC-stimulated B cells did not. CONCLUSION: Our results showed that a novel function of B cells is enhancement of type I IFN production by PDCs. Because B cells are activated by type I IFN, this PDC-B cell cross-talk might be of fundamental importance in the etiopathogenesis of SLE and contribute to long-term immune activation in SLE and other systemic rheumatic diseases.

IFN-α production by plasmacytoid dendritic cells stimulated with RNA-containing immune complexes is promoted by NK cells via MIP-1ß and LFA-1.

Several systemic autoimmune diseases display a prominent IFN signature. This is caused by a continuous IFN-α production by plasmacytoid dendritic cells (pDCs), which are activated by immune complexes (ICs) containing nucleic acid. The IFN-α production by pDCs stimulated with RNA-containing IC (RNA-IC) consisting of anti-RNP autoantibodies and U1 small nuclear ribonucleoprotein particles was recently shown to be inhibited by monocytes, but enhanced by NK cells. The inhibitory effect of monocytes was mediated by TNF-α, PGE(2), and reactive oxygen species, but the mechanisms for the NK cell-mediated increase in IFN-α production remained unclear. In this study, we investigated the mechanisms whereby NK cells increase the RNA-IC-induced IFN-α production by pDCs. Furthermore, NK cells from patients with systemic lupus erythematosus (SLE) were evaluated for their capacity to promote IFN-α production. We found that CD56(dim) NK cells could increase IFN-α production >1000-fold after RNA-IC activation, whereas CD56(bright) NK cells required costimulation by IL-12 and IL-18 to promote IFN-α production. NK cells produced MIP-1α, MIP-1ß, RANTES, IFN-γ, and TNF-α via RNA-IC-mediated FcγRIIIA activation. The IFN-α production in pDCs was promoted by NK cells via MIP-1ß secretion and LFA-mediated cell-cell contact. Moreover, NK cells from SLE patients displayed a reduced capacity to promote the RNA-IC-induced IFN-α production, which could be restored by exogenous IL-12 and IL-18. Thus, different molecular mechanisms can mediate the NK cell-dependent increase in IFN-α production by RNA-IC-stimulated pDCs, and our study suggests that the possibility to therapeutically target the NK-pDC axis in IFN-α-driven autoimmune diseases such as SLE should be investigated.

Type I interferon system activation and association with disease manifestations in systemic sclerosis.

OBJECTIVES: To study the presence of interferogenic autoantibodies in systemic sclerosis (SSc) and their correlation with clinical manifestations, serum levels of interferon alpha (IFNalpha) and chemokines of importance in the disease process. METHODS: Peripheral blood mononuclear cells (PBMCs) or purified plasmacytoid dendritic cells (pDCs) from healthy donors were stimulated with sera from patients with SSc (n=70) or healthy individuals (n=30), together with necrotic or apoptotic cell material. The IFNalpha produced and serum levels of IFNalpha, IFN-inducible protein-10 (IP-10)/chemokine (C-X-C motif) ligand 10, monocyte chemoattractant protein-1 (MCP-1)/(C-C motif) ligand-2 (CCL-2), macrophage inflammatory protein-1alpha (MIP-1alpha)/CCL-3 and RANTES/CCL-5 were measured and correlated with the presence of autoantibodies and clinical manifestations in the patients with SSc. RESULTS: Sera from both diffuse SSc and limited SSc contained interferogenic antibodies, which correlated with the presence of anti-ribonucleoprotein and anti-Sjögren syndrome antigen autoantibodies. The pDCs were responsible for the IFNalpha production which required interaction with FcgammaRII and endocytosis. Increased serum levels of IP-10 were associated with vascular manifestations such as cardiac involvement (p=0.027) and pulmonary arterial hypertension (p=0.036). Increased MCP-1 or IFNalpha serum levels were associated with lung fibrosis (p=0.019 and 0.048, respectively). Digital ulcers including digital loss were associated with increased serum levels of IFNalpha (p=0.029). CONCLUSION: An activated type I IFN system previously seen in several other systemic autoimmune diseases is also present in SSc and may contribute to the vascular pathology and affect the profibrotic process.

Type I interferon and lupus.

PURPOSE OF REVIEW: Patients with lupus have signs of an ongoing production of type I interferons (IFNs) that are of importance both for the etiopathogenesis and the clinical manifestations. In this review, we summarize the latest information concerning the type I IFN system in lupus. RECENT FINDINGS: Activated plasmacytoid dendritic cells are responsible for the IFNalpha production in lupus and can be found in target organs such as glomeruli. The plasmacytoid dendritic cells are triggered by interferogenic immune complexes, and produced IFNalpha activates the immune system and impairs T-regulatory cell function. Autoantibodies, which can form interferogenic immune complexes, are not only present in serum of lupus patients but also in the cerebrospinal fluid of patients with neuropsychiatric manifestations. There is a strong association between risk to develop lupus and gene variants connected to the production and effects of type I IFN. Risk variants can not only cause either increased serum IFNalpha activity or sensitivity but also a more severe disease phenotype. Administration of monoclonal anti-IFNalpha antibodies to lupus patients downregulates several proinflammatory pathways and reduces disease activity. SUMMARY: Increasing evidence indicates that the activated type I IFN system in lupus is critical in the etiopathogenesis of the disease and is an important therapeutic target.

The natural interferon-alpha producing cells in systemic lupus erythematosus.

Prolonged exposure of the immune system to type I interferons (IFN-alpha/beta/omega) in patients receiving IFN-alpha therapy frequently results in development of autoantibodies and autoimmune disease. This is attributed to the many immunostimulatory effects of these cytokines. Patients with the autoimmune disease systemic lupus erythematosus (SLE) have an ongoing IFN-alpha production. Recent studies of SLE demonstrated the presence of endogenous IFN-alpha inducers, acting specifically on natural IFN-alpha producing cells (NIPC), often termed plasmacytoid dendritic cells (PDC). These IFN-alpha inducers were potent, present at the blood level, and characterized as immune complexes that contained DNA and IgG as essential components. They were considered a likely reason for the activated IFN-alpha production in SLE, which, in turn, might be an important etiopathogenic factor. Here, we briefly review the biology of the type I IFN system, with emphasis on inducers, producing cells (especially NIPC/PDC), IFN-alpha actions, and target immune cells, which might be relevant in SLE. Based on such information and results from studies in SLE patients, we propose a hypothesis that explains how NIPC/PDC become activated and play a pivotal etiopathogenic role in SLE and perhaps also other autoimmune diseases. This hypothesis furthermore indicates new therapeutic targets.

Role of natural interferon-alpha producing cells (plasmacytoid dendritic cells) in autoimmunity.

The type I interferons (IFNs) have antiviral, cytostatic and prominent immunomodulatory effects, which all are of great importance during viral infections. However, prolonged exposure of the immune system to type I IFN can break tolerance and initiate an autoimmune reaction, eventually leading to autoimmune disease. Recent observations in patients with systemic lupus erythematosus (SLE) have revealed that such individuals have endogenous IFN-alpha inducers, causing an ongoing IFN-alpha production and consequently a continuous stimulation of the immune system. These IFN-alpha inducers consist of small immune complexes (IC) containing DNA or RNA and act on the principal IFN-alpha producing cell, the natural IFN-alpha producing cell (NIPC), also termed the plasmacytoid dendritic cell (PDC). The NIPC/PDC is a key cell in both the innate and adaptive immune response but can also, either directly or via produced IFN-alpha, have a pivotal role in autoimmunity. In this review we summarize recent data concerning NIPC/PDC, including their activation, regulation, function and possible role in autoimmune diseases, especially SLE.

Characteristics of oligodeoxyribonucleotides that induce interferon (IFN)-alpha in the pig and the phenotype of the IFN-alpha producing cells.

The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.

Regulation of the interferon-alpha production induced by RNA-containing immune complexes in plasmacytoid dendritic cells.

OBJECTIVE: Interferon-alpha (IFNalpha) is produced in several autoimmune diseases, including systemic lupus erythematosus (SLE), and may be important in their pathogenesis. We undertook this study to investigate how IFNalpha production induced by RNA-containing immune complexes (ICs) in plasmacytoid dendritic cells (PDCs) is regulated. METHODS: Normal PDCs purified from peripheral blood mononuclear cells (PBMCs) were cocultivated with other cell populations isolated from healthy individuals or SLE patients. IFNalpha production was induced by RNA-containing ICs, which consisted of anti-RNP autoantibodies and U1 small nuclear RNP particles, and the effects of prostaglandin E2 (PGE2), reactive oxygen species (ROS), or the cytokines IFNalpha2b, granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-10 (IL-10), or tumor necrosis factor alpha (TNFalpha) were explored. RESULTS: Monocytes inhibited IFNalpha production by PDCs in PBMC cultures, while natural killer (NK) cells were stimulatory. The monocytes had little effect on IFNalpha production by pure PDCs but inhibited its stimulation by NK cells. Monocytes from SLE patients were less inhibitory. Exposure of PBMCs or PDCs to IFNalpha2b/GM-CSF increased their IFNalpha production. RNA-containing ICs caused production of ROS, PGE2, and TNFalpha, especially in monocytes. These mediators and IL-10 suppressed IFNalpha production in PBMC cultures, with ROS and PGE2 also inhibiting IFNalpha production by purified PDCs. Inhibition by all of these agents, except for ROS, was abolished by IFNalpha2b/GM-CSF. The inhibitory effect of monocytes was significantly counteracted by the ROS scavengers serotonin and catalase. CONCLUSION: IFNalpha production induced by RNA-containing ICs in PDCs is regulated by a network of interactions between monocytes, NK cells, and PDCs, involving several pro- and antiinflammatory molecules. This should be considered when designing and applying new therapies.

C1q inhibits immune complex-induced interferon-alpha production in plasmacytoid dendritic cells: a novel link between C1q deficiency and systemic lupus erythematosus pathogenesis.

OBJECTIVE: C1q deficiency is the strongest risk factor known for the development of systemic lupus erythematosus (SLE), since almost all humans with a genetic deficiency of C1q develop this disease. Low C1q serum concentration is also a typical finding in SLE during flares, emphasizing the involvement of C1q in SLE pathogenesis. Recent studies have revealed that C1q has a regulatory effect on Toll-like receptor-induced cytokine production. Therefore, we undertook this study to investigate whether C1q could regulate production of interferon-alpha (IFNalpha). METHODS: Peripheral blood mononuclear cells (PBMCs) and plasmacytoid dendritic cells (PDCs) were stimulated with 3 known interferogenic stimuli and cultured with physiologic concentrations of C1q. IFNalpha production was determined by an immunoassay. RESULTS: C1q significantly inhibited PBMC IFNalpha production induced by RNA-containing immune complexes (ICs), herpes simplex virus (HSV), and CpG DNA. C1q also inhibited PDC IFNalpha production induced by ICs and CpG DNA but increased PDC IFNalpha production induced by HSV. The regulatory role of C1q was not specific for IFNalpha but was also seen for interleukin-6 (IL-6), IL-8, and tumor necrosis factor alpha. We demonstrated binding of C1q to PDCs both by surface plasmon resonance interaction analysis and by flow cytometry, and we also demonstrated intracellular detection of 2 C1q binding proteins. CONCLUSION: Our findings contribute to the understanding of why C1q deficiency is such a strong risk factor for SLE and suggest an explanation for the up-regulation of the type I IFN system seen in SLE patients.

A possible mechanism for endogenous activation of the type I interferon system in myositis patients with anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies.

OBJECTIVE: To investigate type I interferon (IFN) system activation and its correlation with autoantibodies and organ manifestations in polymyositis (PM), dermatomyositis (DM), and inclusion body myositis. METHODS: Sera from 30 patients and 16 healthy controls, or purified IgG, were combined with material released from necrotized cells to stimulate IFNalpha production by peripheral blood mononuclear cells (PBMCs) from healthy blood donors. Muscle biopsy specimens from 25 patients and 7 healthy controls were investigated for blood dendritic cell antigen 2 (BDCA-2)-positive plasmacytoid dendritic cells (PDCs) and IFNalpha/beta-inducible myxovirus resistance 1 (MX-1) protein. RESULTS: Sera from 13 patients who were positive for anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies induced IFNalpha production in PBMCs when combined with necrotic cell material. In addition, IgG prepared from anti-Jo-1-positive PM sera induced IFNalpha with necrotic material, but not when the latter was treated with RNase. BDCA-2 expression in PDCs in muscle tissue was increased in PM patients with anti-Jo-1 autoantibodies, while MX-1 staining in capillaries was increased in DM patients, compared with healthy individuals. IFNalpha-inducing capacity correlated with interstitial lung disease, while MX-1 expression in the capillaries correlated with DM. CONCLUSION: Immune complexes containing anti-Jo-1 or anti-Ro 52/anti-Ro 60 autoantibodies and RNA may act as endogenous IFNalpha inducers that activate IFNalpha production in PDCs. These PDCs could be of importance for inducing myositis, whereas in DM patients without autoantibodies the presence of MX-1 protein in capillaries suggests another cellular IFNalpha source and induction mechanism. Consequently, the type I IFN system may be of importance in both PM and DM, but via different pathways.

Mechanisms of Disease: primary Sjögren's syndrome and the type I interferon system.

Sjögren's syndrome is a chronic autoimmune disease of largely unknown etiology and pathogenesis. The salivary and lacrimal glands are the main target organs, and key cells and molecules involved in the autoimmune process have been detected in these glands. Chemokines, expressed by epithelial cells, can attract T cells and dendritic cells that produce proinflammatory cytokines, which stimulate the immune response and induce apoptosis in the acinar and ductal epithelial cells. The autoantigens SSA and SSB are translocated to the apoptotic blebs and trigger infiltrating B cells to produce autoantibodies against SSA and SSB. Germinal-center-like structures can form within glandular lymphocyte foci, facilitating the antigen-driven B-cell activation. Many of the autoimmune mechanisms described above can be induced by type I interferon (IFN), and activation of this system in patients with Sjögren's syndrome has been described. A possible scenario is that an initial viral infection induces type I IFN production in salivary glands with a subsequent activation of the adaptive immune system. Resultant autoantibodies form nucleic-acid-containing immune complexes that can trigger prolonged type I IFN production, leading to a self-perpetuating autoimmune reaction. Several potential therapeutic targets for Sjögren's syndrome exist within the type I IFN system.

Induction of interferon-alpha by immune complexes or liposomes containing systemic lupus erythematosus autoantigen- and Sjögren's syndrome autoantigen-associated RNA.

OBJECTIVE: To investigate the ability of systemic lupus erythematosus (SLE) autoantigen- and Sjögren's syndrome (SS) autoantigen-associated U1 small nuclear RNA (U1 snRNA) and hY1RNA to induce interferon-alpha (IFNalpha) production. METHODS: In vitro-transcribed U1 snRNA or hY1RNA and lipofectin were added to peripheral blood mononuclear cell (PBMC) cultures. Purified U1 snRNP particles and IgG from SLE patients (SLE-IgG) were added to cultures of PBMCs, enriched monocytes, or natural interferon-producing cells (NIPCs); the latter are also known as plasmacytoid dendritic cells (pDC). Cells were double-stained for IFNalpha and either blood dendritic cell antigen 2 (NIPCs/pDC) or CD14 (monocytes) and then analyzed by flow cytometry. In some experiments, RNase or inhibitors of Fc gamma receptor IIa (Fc gammaRIIa) (specific antibodies), endocytosis (chloroquine, bafilomycin A), or Toll-like receptors (TLRs; oligodeoxynucleotide 2088) were used. The produced IFNalpha was measured by immunoassay. RESULTS: Lipofected U1 snRNA and hY1RNA both induced IFNalpha production in monocytes, but not in NIPC/pDC. In contrast, U1 snRNP combined with SLE-IgG induced IFNalpha production only in NIPCs/pDC, and this response was decreased by RNase treatment or inhibition of the Fc gammaRIIa, the endocytosis pathways, or the TLRs. CONCLUSION: Our finding that U1 snRNA and hY1RNA have IFNalpha-inducing capacity indicates that immune complexes containing such RNA, for example U1 snRNP particles, can be at least partly responsible for the ongoing IFNalpha production seen in SLE and SS. These results may help to explain the molecular mechanisms behind the pathogenesis of these and other autoimmune diseases in which autoantibodies to RNA-binding proteins occur.

Activation of the type I interferon system in primary Sjögren's syndrome: a possible etiopathogenic mechanism.

OBJECTIVE: The etiopathogenesis of primary Sjögren's syndrome (SS) is largely unknown. In other autoimmune diseases, type I interferon (IFN) may play a pivotal role by triggering and sustaining the disease process. We therefore aimed to determine whether patients with primary SS had an activated type I IFN system. METHODS: Salivary gland biopsy specimens and sera from patients with primary SS were investigated for the occurrence of IFNalpha-producing cells and measurable IFNalpha levels, respectively. The ability of primary SS sera together with apoptotic or necrotic cells to induce IFNalpha production in normal peripheral blood mononuclear cells was examined. The IFNalpha inducer was characterized, and IFNalpha-producing cells were identified. Clinical data were correlated with the IFNalpha-inducing capacity of primary SS sera. RESULTS: Numerous IFNalpha-producing cells were detected in salivary gland biopsy specimens, despite low serum IFNalpha levels. Autoantibodies to RNA-binding proteins, combined with material released by necrotic or late apoptotic cells, were potent inducers of IFNalpha production in plasmacytoid dendritic cells (PDCs). This appeared to be attributable to RNA-containing immune complexes triggering PDCs by means of RNA and interaction with Fcgamma receptor IIa. The IFNalpha-inducing capacity of sera was associated with positive results of a labial salivary gland biopsy (focus score >/=1) and with dermatologic, hematologic, and pulmonary manifestations. CONCLUSION: Patients with primary SS have an activated type I IFN system. Although virus may initiate the production of IFN, the continued IFNalpha synthesis is caused by RNA-containing immune complexes that activate PDCs to prolong IFNalpha production at the tissue level. This IFNalpha promotes the autoimmune process by a vicious circle-like mechanism, with increased autoantibody production and formation of more endogenous IFNalpha inducers.

Systemic lupus erythematosus and the type I interferon system.

Patients with systemic lupus erythematosus (SLE) have ongoing interferon-alpha (IFN-alpha) production and serum IFN-alpha levels are correlated with both disease activity and severity. Recent studies of patients with SLE have demonstrated the presence of endogenous IFN-alpha inducers in such individuals, consisting of small immune complexes (ICs) containing IgG and DNA. These ICs act specifically on natural IFN-alpha-producing cells (NIPCs), often termed plasmacytoid dendritic cells (PDCs). Given the fact that the NIPC/PDC has a key role in both the innate and adaptive immune response, as well as the many immunoregulatory effects of IFN-alpha, these observations might be important for the understanding of the etiopathogenesis of SLE. In this review we briefly describe the biology of the type I IFN system, with emphasis on inducers, producing cells (especially NIPCs/PDCs), IFN-alpha actions and target immune cells that might be relevant in SLE. On the basis of this information and results from studies in SLE patients, we propose a hypothesis that explains how NIPCs/PDCs become activated and have a pivotal etiopathogenic role in SLE. This hypothesis also indicates new therapeutic targets in this autoimmune disease.

Expression of the markers BDCA-2 and BDCA-4 and production of interferon-alpha by plasmacytoid dendritic cells in systemic lupus erythematosus.

OBJECTIVE: To study the expression of blood dendritic cell antigen 2 (BDCA-2) and BDCA-4 molecules by plasmacytoid dendritic cells (PDCs) in the blood of patients with systemic lupus erythematosus (SLE), and to study PDC production of interferon-alpha (IFN alpha) and its inhibition by anti-BDCA-2 and anti-BDCA-4 antibodies. METHODS: Peripheral blood mononuclear cells (PBMCs) from SLE patients (SLE PBMCs) and from healthy controls were induced to produce IFN alpha in vitro by SLE serum containing an endogenous IFN alpha-inducing factor (SLE-IIF) or by herpes simplex virus type 1 (HSV-1). The frequencies and numbers of BDCA-2-, BDCA-3-, and BDCA-4-expressing cells were analyzed by flow cytometry, and the effects of anti-BDCA-2 and anti-BDCA-4 monoclonal antibodies (mAb) on IFN alpha production were investigated. RESULTS: IFN alpha production by SLE PBMCs induced by SLE-IIF or HSV-1 was decreased compared with that of healthy control PBMCs (P = 0.002 and P = 0.0007, respectively). The proportions of BDCA-2- and BDCA-3-expressing cells in SLE PBMCs were reduced compared with those in PBMCs from healthy controls (P = 0.01 and P = 0.004, respectively). IFN alpha producers in culture, especially among SLE PBMCs, displayed reduced BDCA-2 expression and constituted only a minority of the BDCA-2-positive cells, at least in healthy control PBMCs (median 18%). IFN alpha production by both SLE and healthy control PBMCs stimulated by SLE-IIF or HSV-1 was markedly reduced by anti-BDCA-2 mAb (median 81-98% inhibition). Anti-BDCA-4 mAb only partially inhibited SLE-IIF-induced IFN alpha production. CONCLUSION: SLE patients had a reduced number of BDCA-2-expressing PDCs, also termed natural IFN alpha-producing cells, and their IFN alpha production could be inhibited by anti-BDCA-2/4 mAb. Such mAb may be a therapeutic option for inhibiting the ongoing IFN alpha production in SLE patients.

Induction of interferon-alpha production in plasmacytoid dendritic cells by immune complexes containing nucleic acid released by necrotic or late apoptotic cells and lupus IgG.

OBJECTIVE: To investigate the release of interferon-alpha (IFN alpha)-inducing material by necrotic or apoptotic cells, its properties, and the necessity of autoantibodies from systemic lupus erythematosus (SLE) patients for the interferogenic activity. METHODS: U937 monocytic leukemia cells or peripheral blood mononuclear cells (PBMCs) were rendered necrotic by freeze-thawing or apoptotic by treatment with ultraviolet light. Cell culture supernatants from these cells and IgG from SLE patients (SLE IgG) were added to cultures of normal PBMCs or purified plasmacytoid dendritic cells (PDCs). The importance of nucleic acids for IFN alpha induction was investigated by RNase and DNase treatment. The IFN alpha levels were measured by immunoassay. RESULTS: Both necrotic and apoptotic U937 cells released material that, combined with SLE IgG, induced IFN alpha production in PDCs. The release from apoptotic cells occurred with a 16-hour delay, in late apoptosis. Also, normal PBMCs released IFN alpha-inducing material, but only during necrosis. The interferogenic activity of the necrotic material required the presence of RNA, while both RNA and DNA were important in the apoptotic material. In both cases, the presence of SLE IgG was necessary, and its activity correlated with the presence of antibodies to RNA-binding proteins, but not anti-DNA antibodies. CONCLUSION: Necrotic and late apoptotic cells release material that, combined with SLE IgG, induces production of IFN alpha in PDCs. The IFN alpha inducers probably consist of immune complexes (ICs) containing RNA and possibly DNA as essential interferogenic components. The presence of such interferogenic ICs could explain the ongoing production of IFN alpha in SLE and could be of etiopathogenic importance.

Fc gamma RIIa is expressed on natural IFN-alpha-producing cells (plasmacytoid dendritic cells) and is required for the IFN-alpha production induced by apoptotic cells combined with lupus IgG.

An ongoing production of IFN-alpha may be of etiopathogenic significance in systemic lupus erythematosus (SLE). It may be due to the natural IFN-producing cells (NIPC), also termed plasmacytoid dendritic cells (PDC), activated by immune complexes that contain nucleic acids derived from apoptotic cells. We here examined the role of FcgammaR in the IFN-alpha production in vitro by PBMC induced by the combination of apoptotic U937 cells and autoantibody-containing IgG from SLE patients (SLE-IgG). The Fc portion of the SLE-IgG was essential to induce IFN-alpha production, because Fab fragments or F(ab')(2) were ineffective. Normal, especially heat-aggregated, IgG inhibited the IFN-alpha production, suggesting a role for FcgammaR on PBMC. Using blocking anti-FcgammaR Abs, the FcgammaRIIa,c (CD32) but not FcgammaRI or FcgammaRIII were shown to be involved in the IFN-alpha induction by apoptotic cells combined with SLE-IgG, but not by HSV or CpG DNA. In contrast, the action of all of these inducers was inhibited by the anti-FcgammaRIIa,b,c mAb AT10 or heat-aggregated IgG. Flow cytometric analysis revealed that approximately 50% of the BDCA-2-positive PBMC, i.e., NIPC/PDC, expressed low but significant levels of FcgammaRII, as did most of the actual IFN-alpha producers activated by HSV. RT-PCR applied to NIPC/PDC purified by FACS demonstrated expression of FcgammaRIIa, but not of FcgammaRIIb or FcgammaRIIc. We conclude that FcgammaRIIa on NIPC/PDC is involved in the activation of IFN-alpha production by interferogenic immune complexes, but may also mediate inhibitory signals. The FcgammaRIIa could therefore have a key function in NIPC/PDC and be a potential therapeutic target in SLE.

Veterinary immunology: opportunities and challenges.

The 6th International Veterinary Immunology Symposium (6IVIS) was held in Uppsala, Sweden from 15-20 July 2001.