Self-Powered Wireless Sensor Using a Pressure Fluctuation Energy Harvester.

Condition monitoring devices in hydraulic systems that use batteries or require wired infrastructure have drawbacks that affect their installation, maintenance costs, and deployment flexibility. Energy harvesting technologies can serve as an alternative power supply for system loads, eliminating batteries and wiring requirements. Despite the interest in pressure fluctuation energy harvesters, few studies consider end-to-end implementations, especially for cases with low-amplitude pressure fluctuations. This generates a research gap regarding the practical amount of energy available to the load under these conditions, as well as interface circuit requirements and techniques for efficient energy conversion. In this paper, we present a self-powered sensor that integrates an energy harvester and a wireless sensing system. The energy harvester converts pressure fluctuations in hydraulic systems into electrical energy using an acoustic resonator, a piezoelectric stack, and an interface circuit. The prototype wireless sensor consists of an industrial pressure sensor and a low-power Bluetooth System-on-chip that samples and wirelessly transmits pressure data. We present a subsystem analysis and a full system implementation that considers hydraulic systems with pressure fluctuation amplitudes of less than 1 bar and frequencies of less than 300 Hz. The study examines the frequency response of the energy harvester, the performance of the interface circuit, and the advantages of using an active power improvement unit adapted for piezoelectric stacks. We show that the interface circuit used improves the performance of the energy harvester compared to previous similar studies, showing more power generation compared to the standard interface. Experimental measurements show that the self-powered sensor system can start up by harvesting energy from pressure fluctuations with amplitudes starting at 0.2 bar at 200 Hz. It can also sample and transmit sensor data at a rate of 100 Hz at 0.7 bar at 200 Hz. The system is implemented with off-the-shelf circuits.

Design Optimization and Comparison of Cylindrical Electromagnetic Vibration Energy Harvesters.

Investigating the coil-magnet structure plays a significant role in the design process of the electromagnetic energy harvester due to the effect on the harvester's performance. In this paper, the performance of four different electromagnetic vibration energy harvesters with cylindrical shapes constrained in the same volume were under investigation. The utilized structures are (i) two opposite polarized magnets spaced by a mild steel; (ii) a Halbach array with three magnets and one coil; (iii) a Halbach array with five magnets and one coil; and (iv) a Halbach array with five magnets and three coils. We utilized a completely automatic optimization procedure with the help of an optimization algorithm implemented in Python, supported by simulations in ANSYS Maxwell and MATLAB Simulink to obtain the maximum output power for each configuration. The simulation results show that the Halbach array with three magnets and one coil is the best for configurations with the Halbach array. Additionally, among all configurations, the harvester with two opposing magnets provides the highest output power and volume power density, while the Halbach array with three magnets and one coil provides the highest mass power density. The paper also demonstrates limitations of using the electromagnetic coupling coefficient as a metric for harvester optimization, if the ultimate goal is maximization of output power.

Analysis of Both Lipid Metabolism and Endocannabinoid Signaling Reveals a New Role for Hypothalamic Astrocytes in Maternal Caloric Restriction-Induced Perinatal Programming.

Maternal malnutrition in critical periods of development increases the risk of developing short- and long-term diseases in the offspring. The alterations induced by this nutritional programming in the hypothalamus of the offspring are of special relevance due to its role in energy homeostasis, especially in the endocannabinoid system (ECS), which is involved in metabolic functions. Since astrocytes are essential for neuronal energy efficiency and are implicated in brain endocannabinoid signaling, here we have used a rat model to investigate whether a moderate caloric restriction (R) spanning from two weeks prior to the start of gestation to its end induced changes in offspring hypothalamic (a) ECS, (b) lipid metabolism (LM) and/or (c) hypothalamic astrocytes. Monitorization was performed by analyzing both the gene and protein expression of proteins involved in LM and ECS signaling. Offspring born from caloric-restricted mothers presented hypothalamic alterations in both the main enzymes involved in LM and endocannabinoids synthesis/degradation. Furthermore, most of these changes were similar to those observed in hypothalamic offspring astrocytes in culture. In conclusion, a maternal low caloric intake altered LM and ECS in both the hypothalamus and its astrocytes, pointing to these glial cells as responsible for a large part of the alterations seen in the total hypothalamus and suggesting a high degree of involvement of astrocytes in nutritional programming.

Roles of Efflux Pumps from Different Superfamilies in the Surface-Associated Motility and Virulence of Acinetobacter baumannii ATCC 17978.

Although the relationship between Acinetobacter baumannii efflux pumps and antimicrobial resistance is well documented, less is known about the involvement of these proteins in the pathogenicity of this nosocomial pathogen. In previous work, we identified the AbaQ major facilitator superfamily (MFS) efflux pump and demonstrated its participation in the motility and virulence of A. baumannii In the present study, we examined the role in these processes of A. baumannii transporters belonging to different superfamilies of efflux pumps. Genes encoding known or putative permeases belonging to efflux pump superfamilies other than the MFS were selected, and the corresponding knockouts were constructed. The antimicrobial susceptibilities of these mutants were consistent with previously reported data. In mutants of A. baumannii strain ATCC 17978 carrying inactivated genes encoding the efflux pumps A1S_2736 (resistance nodulation division [RND]), A1S_3371 (multidrug and toxic compound extrusion [MATE]), and A1S_0710 (small multidrug resistance [SMR]), as well as the newly described ATP-binding cassette (ABC) permeases A1S_1242 and A1S_2622, both surface-associated motility and virulence were reduced compared to the parental strain. However, inactivation of the genes encoding the known ABC permeases A1S_0536 and A1S_1535, the newly identified putative ABC permeases A1S_0027 and A1S_1057, or the proteobacterial antimicrobial compound efflux (PACE) transporters A1S_1503 and A1S_2063 had no effects on bacterial motility or virulence. Our results demonstrate the involvement of antimicrobial transporters belonging at least to five of the six known efflux pump superfamilies in both surface-associated motility and virulence in A. baumannii ATCC 17978.

Functional Characterization of AbaQ, a Novel Efflux Pump Mediating Quinolone Resistance in Acinetobacter baumannii.

Acinetobacter baumannii has emerged as an important multidrug-resistant nosocomial pathogen. In previous work, we identified a putative MFS transporter, AU097_RS17040, involved in the pathogenicity of A. baumannii (M. Pérez-Varela, J. Corral, J. A. Vallejo, S. Rumbo-Feal, G. Bou, J. Aranda, and J. Barbé, Infect Immun 85:e00327-17, 2017, https://doi.org/10.1128/IAI.00327-17). In this study, we analyzed the susceptibility to diverse antimicrobial agents of A. baumannii cells defective in this transporter, referred to as AbaQ. Our results showed that AbaQ is mainly involved in the extrusion of quinolone-type drugs in A. baumannii.

Emergence of High-Level Colistin Resistance in an Acinetobacter baumannii Clinical Isolate Mediated by Inactivation of the Global Regulator H-NS.

Colistin is a crucial last-line drug used for the treatment of life-threatening infections caused by multidrug-resistant strains of the Gram-negative bacterium Acinetobacter baumannii However, colistin-resistant A. baumannii isolates can still be isolated following failed colistin therapy. Resistance is most often mediated by the addition of phosphoethanolamine (pEtN) to lipid A by PmrC, following missense mutations in the pmrCAB operon encoding PmrC and the two-component signal transduction system PmrA/PmrB. We recovered a pair of A. baumannii isolates from a single patient before (6009-1) and after (6009-2) failed colistin treatment. These strains displayed low and very high levels of colistin resistance (MICs, 8 to 16 µg/ml and 128 µg/ml), respectively. To understand how increased colistin resistance arose, we sequenced the genome of each isolate, which revealed that 6009-2 had an extra copy of the insertion sequence element ISAba125 within a gene encoding an H-NS family transcriptional regulator. To confirm the role of H-NS in colistin resistance, we generated an hns deletion mutant in 6009-1 and showed that colistin resistance increased upon the deletion of hns We also provided 6009-2 with an intact copy of hns and showed that the strain was no longer resistant to high concentrations of colistin. Transcriptomic analysis of the clinical isolates identified more than 150 genes as being differentially expressed in the colistin-resistant hns mutant 6009-2. Importantly, the expression of eptA, encoding a second lipid A-specific pEtN transferase but not pmrC, was increased in the hns mutant. This is the first time an H-NS family transcriptional regulator has been associated with a pEtN transferase and colistin resistance.

Mutations in the ß-Subunit of the RNA Polymerase Impair the Surface-Associated Motility and Virulence of Acinetobacter baumannii.

Acinetobacter baumannii is a major cause of antibiotic-resistant nosocomial infections worldwide. In this study, several rifampin-resistant spontaneous mutants obtained from the A. baumannii ATCC 17978 strain that differed in their point mutations in the rpoB gene, encoding the ß-subunit of the RNA polymerase, were isolated. All the mutants harboring amino acid substitutions in position 522 or 540 of the RpoB protein were impaired in surface-associated motility and had attenuated virulence in the fertility model of Caenorhabditis elegans The transcriptional profile of these mutants included six downregulated genes encoding proteins homologous to transporters and metabolic enzymes widespread among A. baumannii clinical isolates. The construction of knockout mutants in each of the six downregulated genes revealed a significant reduction in the surface-associated motility and virulence of four of them in the A. baumannii ATCC 17978 strain, as well as in the virulent clinical isolate MAR002. Taken together, our results provide strong evidence of the connection between motility and virulence in this multiresistant nosocomial pathogen.

Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii.

Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis.

Differential roles of antimicrobials in the acquisition of drug resistance through activation of the SOS response in Acinetobacter baumannii.

The effect of antimicrobials on SOS-mediated mutagenesis induction depends on the bacterial species and the antimicrobial group. In this work, we studied the effect of different families of antimicrobial agents used in clinical therapy against Acinetobacter baumannii in the induction of mutagenesis in this multiresistant Gram-negative pathogen. The data showed that ciprofloxacin and tetracycline induce SOS-mediated mutagenesis, whereas colistin and meropenem, which are extensively used in clinical therapy, do not.

The transcriptomic response of Acinetobacter baumannii to colistin and doripenem alone and in combination in an in vitro pharmacokinetics/pharmacodynamics model.

OBJECTIVES: Colistin remains a last-line treatment for MDR Acinetobacter baumannii and combined use of colistin and carbapenems has shown synergistic effects against MDR strains. In order to understand the bacterial responses to these antibiotics, we analysed the transcriptome of A. baumannii following exposure to each. METHODS: RNA sequencing was employed to determine changes in the transcriptome following treatment with colistin and doripenem, both alone and in combination, using an in vitro pharmacokinetics (PK)/pharmacodynamics model to mimic the PK of both antibiotics in patients. RESULTS: After treatment with colistin (continuous infusion at 2 mg/L), >400 differentially regulated genes were identified, including many associated with outer membrane biogenesis, fatty acid metabolism and phospholipid trafficking. No genes were differentially expressed following treatment with doripenem (Cmax 25 mg/L, t1/2 1.5 h) for 15 min, but 45 genes were identified as differentially expressed after 1 h of growth under this condition. Treatment of A. baumannii with both colistin and doripenem together for 1 h resulted in >450 genes being identified as differentially expressed. More than 70% of these gene expression changes were also observed following colistin treatment alone. CONCLUSIONS: These data suggest that colistin causes gross damage to the outer membrane, facilitates lipid exchange between the inner and outer membrane and alters the normal asymmetric outer membrane composition. The transcriptional response to colistin was highly similar to that observed for an LPS-deficient strain, indicating that many of the observed changes are responses to outer membrane instability resulting from LPS loss.

Public health services and their relationship with rapid HIV test utilization and access for key populations in Morelos, Mexico.

OBJECTIVE: In 2009, 4 749 rapid HIV tests were run in Morelos, Mexico, despite lacking evidence on their results. This article seeks to analyze how public health organization relates to utility of rapid HIV test among healthcare users. MATERIALS AND METHODS: Joint study: comparison of differences in applied test and positive results for each group with the Bonferroni statistical tool, observational study in 34 health subsystems, and 11 interviews with public healthcare users. RESULTS: Each subsystem processes influenced the use and usefulness of screening; for instance, primary care centers test only pregnant women and exclude men who have sex with men (MSM). That group shows significant differences (p<0.007) in the HIV-positive test with respect to other groups. CONCLUSIONS: Despite the availability of rapid detection tests and epidemiological evidence, the way public health services are organized impedes an efficient diagnosis in the group with higher risk, namely MSM. The distribution of rapid HIV tests was guided by stigmatization.

Role of Acinetobacter baumannii UmuD homologs in antibiotic resistance acquired through DNA damage-induced mutagenesis.

The role of Acinetobacter baumannii ATCC 17978 UmuDC homologs A1S_0636-A1S_0637, A1S_1174-A1S_1173, and A1S_1389 (UmuDAb) in antibiotic resistance acquired through UV-induced mutagenesis was evaluated. Neither the growth rate nor the UV-related survival of any of the three mutants was significantly different from that of the wild-type parental strain. However, all mutants, and especially the umuDAb mutant, were less able to acquire resistance to rifampin and streptomycin through the activities of their error-prone DNA polymerases. Furthermore, in the A. baumannii mutant defective in the umuDAb gene, the spectrum of mutations included a dramatic reduction in the frequency of transition mutations, the mutagenic signature of the DNA polymerase V encoded by umuDC.

Biological cost of different mechanisms of colistin resistance and their impact on virulence in Acinetobacter baumannii.

Two mechanisms of resistance to colistin have been described in Acinetobacter baumannii. One involves complete loss of lipopolysaccharide (LPS), resulting from mutations in lpxA, lpxC, or lpxD, and the second is associated with phosphoethanolamine addition to LPS, mediated through mutations in pmrAB. In order to assess the clinical impacts of both resistance mechanisms, A. baumannii ATCC 19606 and its isogenic derivatives, AL1851 ΔlpxA, AL1852 ΔlpxD, AL1842 ΔlpxC, and ATCC 19606 pmrB, were analyzed for in vitro growth rate, in vitro and in vivo competitive growth, infection of A549 respiratory alveolar epithelial cells, virulence in the Caenorhabditis elegans model, and virulence in a systemic mouse infection model. The in vitro growth rate of the lpx mutants was clearly diminished; furthermore, in vitro and in vivo competitive-growth experiments revealed a reduction in fitness for both mutant types. Infection of A549 cells with ATCC 19606 or the pmrB mutant resulted in greater loss of viability than with lpx mutants. Finally, the lpx mutants were highly attenuated in both the C. elegans and mouse infection models, while the pmrB mutant was attenuated only in the C. elegans model. In summary, while colistin resistance in A. baumannii confers a clear selective advantage in the presence of colistin treatment, it causes a noticeable cost in terms of overall fitness and virulence, with a more striking reduction associated with LPS loss than with phosphoethanolamine addition. Therefore, we hypothesize that colistin resistance mediated by changes in pmrAB will be more likely to arise in clinical settings in patients treated with colistin.

Hepatitis C virus point-of-care microelimination approach in a vulnerable population in the South of Spain.

Background: Since the introduction of direct-acting antivirals, thousands of chronic hepatitis C patients have been successfully treated. However, vulnerable populations have a higher prevalence of hepatitis C virus (HCV) infection and face barriers that impede their access to antivirals. We carried out an HCV microelimination program focused on vulnerable population groups in Malaga. Methods: People in drug addiction treatment centers and homeless shelters in Malaga who participated in the program between October 2020 and October 2021 were included. After providing participants with educational information on HCV, a dry drop test (DDT) was used to collect blood for subsequent screening for HCV infection. The participants who were diagnosed with HCV infection were scheduled for comprehensive healthcare assessments, including blood tests, ultrasonography, elastography, and the prescription of antivirals, all conducted in a single hospital visit. Sustained viral response (SVR) was analysed 12 weeks after end of treatment. Results: Of the 417 persons invited to participate, 271 (65%) agreed to participate in the program. These participants were screened for HCV infection and 28 of them were diagnosed with HCV infection (10%). These hepatitis C-infected patients had a mean age of 53 ± 9 years; 86% were males and 93% were or had been drug users. Among 23 patients with HCV infection, HCV genotype 1a predominated (74%). Medical exams showed that 19% (4/21) had advanced fibrosis (F3-4), and 5% (1/21) had portal hypertension. Finally, 23 infected patients received treatment with glecaprevir/pibrentasvir or sofosbuvir/velpatasvir and SVR was confirmed in 22 patients (96%). Conclusions: Drug users and homeless people have a higher prevalence of HCV infection than the general population. The microelimination program with educational activity and screening tools achieved a high participation rate, easy healthcare access, and a high rate of SVR despite the SARS-CoV-2 pandemic.

Identification of a DNA-damage-inducible regulon in Acinetobacter baumannii.

The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii.

Extracellular proteome of a highly invasive multidrug-resistant clinical strain of Acinetobacter baumannii.

The study of the extracellular proteomes of pathogenic bacteria is essential for gaining insights into the mechanisms of pathogenesis and for the identification of virulence factors. Through the use of different proteomic approaches, namely Nano-LC and 2DE combined with MALDI-TOF/TOF, we have characterized the extracellular proteome of a highly invasive, multidrug-resistant strain of A. baumannii (clone AbH12O-A2). This study focused on two main protein fractions of the extracellular proteome: proteins that are exported by outer membrane vesicles (OMVs) and freely soluble extracellular proteins (FSEPs) present in the culture medium of A. baumannii. Herein, a total of 179 nonredundant proteins were identified in the OMV protein fraction and a total of 148 nonredundant proteins were identified in FSEP fraction. Of the OMV proteins, 39 were associated with pathogenesis and virulence, including proteins associated with attachment to host cells (e.g., CsuE, CsuB, CsuA/B) and specialized secretion systems for delivery of virulence factors (e.g., P. pilus assembly and FilF), whereas the FSEP fraction possesses extracellular enzymes with degradative activity, such as alkaline metalloprotease. Furthermore, among the FSEP we have detected at least 18 proteins with a known role in oxidative stress response (e.g., catalase, thioredoxin, oxidoreductase, superoxide dismutase). Further assays demonstrated that in the presence of FSEPs, bacterial cells withstand much higher concentrations of H2O2 showing higher survival rate (approximately 2.5 fold) against macrophages. In this study we have identified an unprecedented number of novel extracellular proteins of A. baumannii and we provide insight into their potential role in relevant processes such as oxidative stress response and defense against macrophage attack.

Deciphering the function of the outer membrane protein OprD homologue of Acinetobacter baumannii.

The increasing number of carbapenem-resistant Acinetobacter baumannii isolates is a major cause for concern which restricts therapeutic options to treat severe infections caused by this emerging pathogen. To identify the molecular mechanisms involved in carbapenem resistance, we studied the contribution of an outer membrane protein homologue of the Pseudomonas aeruginosa OprD porin. Suspected to be the preferred pathway of carbapenems in A. baumannii, the oprD homologue gene was inactivated in strain ATCC 17978. Comparison of wild-type and mutant strains did not confirm the expected increased resistance to any antibiotic tested. OprD homologue sequence analysis revealed that this protein actually belongs to an OprD subgroup but is closer to the P. aeruginosa OprQ protein, with which it could share some functions, e.g., allowing bacterial survival under low-iron or -magnesium growth conditions or under poor oxygenation. We thus overexpressed and purified a recombinant OprD homologue protein to further examine its functional properties. As a specific channel, this porin presented rather low single-channel conductance, i.e., 28 pS in 1 M KCl, and was partially closed by micro- and millimolar concentrations of Fe(3+) and Mg(2+), respectively, but not by imipenem and meropenem or basic amino acids. The A. baumannii OprD homologue is likely not involved in the carbapenem resistance mechanism, but as an OprQ-like protein, it could contribute to the adaptation of this bacterium to magnesium- and/or iron-depleted environments.

Effect of transcriptional activators SoxS, RobA, and RamA on expression of multidrug efflux pump AcrAB-TolC in Enterobacter cloacae.

Control of membrane permeability is a key step in regulating the intracellular concentration of antibiotics. Efflux pumps confer innate resistance to a wide range of toxic compounds such as antibiotics, dyes, detergents, and disinfectants in members of the Enterobacteriaceae. The AcrAB-TolC efflux pump is involved in multidrug resistance in Enterobacter cloacae. However, the underlying mechanism that regulates the system in this microorganism remains unknown. In Escherichia coli, the transcription of acrAB is upregulated under global stress conditions by proteins such as MarA, SoxS, and Rob. In the present study, two clinical isolates of E. cloacae, EcDC64 (a multidrug-resistant strain overexpressing the AcrAB-TolC efflux pump) and Jc194 (a strain with a basal AcrAB-TolC expression level), were used to determine whether similar global stress responses operate in E. cloacae and also to establish the molecular mechanisms underlying this response. A decrease in susceptibility to erythromycin, tetracycline, telithromycin, ciprofloxacin, and chloramphenicol was observed in clinical isolate Jc194 and, to a lesser extent in EcDC64, in the presence of salicylate, decanoate, tetracycline, and paraquat. Increased expression of the acrAB promoter in the presence of the above-described conditions was observed by flow cytometry and reverse transcription-PCR, by using a reporter fusion protein (green fluorescent protein). The expression level of the AcrAB promoter decreased in E. cloacae EcDC64 derivates deficient in SoxS, RobA, and RamA. Accordingly, the expression level of the AcrAB promoter was higher in E. cloacae Jc194 strains overproducing SoxS, RobA, and RamA. Overall, the data showed that SoxS, RobA, and RamA regulators were associated with the upregulation of acrAB, thus conferring antimicrobial resistance as well as a stress response in E. cloacae. In summary, the regulatory proteins SoxS, RobA, and RamA were cloned and sequenced for the first time in this species. The involvement of these proteins in conferring antimicrobial resistance through upregulation of acrAB was demonstrated in E. cloacae.

Pharmacokinetics and Endocrine Effects of an Oral Dose of D-Pinitol in Human Fasting Healthy Volunteers.

The present study characterizes the oral pharmacokinetics of D-Pinitol, a natural insulin mimetic inositol, in human healthy volunteers (14 males and 11 females). D-Pinitol absorption was studied in (a) subjects receiving a single oral dose of 15 mg/kg (n = 10), or (b) 5 mg/kg pure D-Pinitol (n = 6), and (c) subjects receiving D-Pinitol as part of carbohydrate-containing carob pods-derived syrup with a 3.2% D-Pinitol (Dose of 1600 mg/subject, n = 9). The volunteers received a randomly assigned single dose of either D-Pinitol or carob pod-derived syrup. Blood samples were collected at 0, 15, 30, 45, 60, 90, 120, 180, 240, 360 and 1440 min after intake. Plasma concentration of D-Pinitol was measured and pharmacokinetic parameters obtained. The data indicate that when given alone, the oral absorption of D-Pinitol is dose-dependent and of extended duration, with a Tmax reached after almost 4 h, and a half-life greater than 5 h. When the source of D-Pinitol was a carob pods-derived syrup, Cmax was reduced to 40% of the expected based on the data of D-Pinitol alone, suggesting a reduced absorption probably because of competition with monosaccharide transport. In this group, Tmax was reached before that of D-Pinitol alone, but the estimated half-life remained the same. In the D-Pinitol groups, plasma concentrations of glucose, insulin, glucagon, ghrelin, free fatty acids, and pituitary hormones were additionally measured. A dose of 15 mg/kg of D-Pinitol did not affect glucose levels in healthy volunteers, but reduced insulin and increased glucagon and ghrelin concentrations. D-Pinitol did not increase other hormones known to enhance plasma glucose, such as cortisol or GH, which were surprisingly reduced after the ingestion of this inositol. Other pituitary hormones (gonadotropins, prolactin, and thyroid-stimulating hormone) were not affected after D-Pinitol ingestion. In a conclusion, D-Pinitol is absorbed through the oral route, having an extended half-life and displaying the pharmacological profile of an endocrine pancreas protector, a pharmacological activity of potential interest for the treatment or prevention of insulin resistance-associated conditions.

Acinetobacter baumannii RecA protein in repair of DNA damage, antimicrobial resistance, general stress response, and virulence.

RecA is the major enzyme involved in homologous recombination and plays a central role in SOS mutagenesis. In Acinetobacter spp., including Acinetobacter baumannii , a multidrug-resistant bacterium responsible for nosocomial infections worldwide, DNA repair responses differ in many ways from those of other bacterial species. In this work, the function of A. baumannii RecA was examined by constructing a recA mutant. Alteration of this single gene had a pleiotropic effect, showing the involvement of RecA in DNA damage repair and consequently in cellular protection against stresses induced by DNA damaging agents, several classes of antibiotics, and oxidative agents. In addition, the absence of RecA decreased survival in response to both heat shock and desiccation. Virulence assays in vitro (with macrophages) and in vivo (using a mouse model) similarly implicated RecA in the pathogenicity of A. baumannii . Thus, the data strongly suggest a protective role for RecA in the bacterium and indicate that inactivation of the protein can contribute to a combined therapeutic approach to controlling A. baumannii infections.