Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Downregulation of RWA genes in hybrid aspen affects xylan acetylation and wood saccharification.

High acetylation of angiosperm wood hinders its conversion to sugars by glycoside hydrolases, subsequent ethanol fermentation and (hence) its use for biofuel production. We studied the REDUCED WALL ACETYLATION (RWA) gene family of the hardwood model Populus to evaluate its potential for improving saccharification. The family has two clades, AB and CD, containing two genes each. All four genes are expressed in developing wood but only RWA-A and -B are activated by master switches of the secondary cell wall PtNST1 and PtMYB21. Histochemical analysis of promoter::GUS lines in hybrid aspen (Populus tremula × tremuloides) showed activation of RWA-A and -B promoters in the secondary wall formation zone, while RWA-C and -D promoter activity was diffuse. Ectopic downregulation of either clade reduced wood xylan and xyloglucan acetylation. Suppressing both clades simultaneously using the wood-specific promoter reduced wood acetylation by 25% and decreased acetylation at position 2 of Xylp in the dimethyl sulfoxide-extracted xylan. This did not affect plant growth but decreased xylose and increased glucose contents in the noncellulosic monosaccharide fraction, and increased glucose and xylose yields of wood enzymatic hydrolysis without pretreatment. Both RWA clades regulate wood xylan acetylation in aspen and are promising targets to improve wood saccharification.

Populus GT43 family members group into distinct sets required for primary and secondary wall xylan biosynthesis and include useful promoters for wood modification.

The plant GT43 protein family includes xylosyltransferases that are known to be required for xylan backbone biosynthesis, but have incompletely understood specificities. RT-qPCR and histochemical (GUS) analyses of expression patterns of GT43 members in hybrid aspen, reported here, revealed that three clades of the family have markedly differing specificity towards secondary wall-forming cells (wood and extraxylary fibres). Intriguingly, GT43A and B genes (corresponding to the Arabidopsis IRX9 clade) showed higher specificity for secondary-walled cells than GT43C and D genes (IRX14 clade), although both IRX9 and IRX14 are required for xylosyltransferase activity. The remaining genes, GT43E, F and G (IRX9-L clade), showed broad expression patterns. Transient transactivation analyses of GT43A and B reporters demonstrated that they are activated by PtxtMYB021 and PNAC085 (master secondary wall switches), mediated in PtxtMYB021 activation by an AC element. The high observed secondary cell wall specificity of GT43B expression prompted tests of the efficiency of its promoter (pGT43B), relative to the CaMV 35S (35S) promoter, for overexpressing a xylan acetyl esterase (CE5) or downregulating REDUCED WALL ACETYLATION (RWA) family genes and thus engineering wood acetylation. CE5 expression was weaker when driven by pGT43B, but it reduced wood acetyl content substantially more efficiently than the 35S promoter. RNAi silencing of the RWA family, which was ineffective using 35S, was achieved when using GT43B promoter. These results show the utility of the GT43B promoter for genetically engineering properties of wood and fibres.

Cell-Type-Specific Proteomics Analysis of a Small Number of Plant Cells by Integrating Laser Capture Microdissection with a Nanodroplet Sample Processing Platform.

Plant organs and tissues contain multiple cell types, which are well organized in 3-dimensional structure to efficiently perform physiological functions such as homeostasis and response to environmental perturbation and pathogen infection. It is critically important to perform molecular measurements at the cell-type-specific level to discover mechanisms and unique features of cell populations that govern differentiation and respond to external perturbations. Although mass spectrometry-based proteomics has been demonstrated as an enabling discovery tool for studying plant physiology, conventional approaches require millions of cells to generate robust biological conclusions. Such requirements mask the cell-to-cell heterogeneities and limit the comprehensive profiling of plant proteins at spatially resolved and cell-type-specific resolutions. This article describes a recently developed proteomics workflow for studying a small number of plant cells by integrating laser capture microdissection, microfluidic nanodroplet-based sample preparation, and ultrasensitive liquid chromatography-mass spectrometry. Using poplar as a model tree species, we provide detailed protocols, including plant leaf and root tissue harvest, sample preparation, cryosectioning, laser microdissection, protein digestion, mass spectrometry measurement, and data analysis. We show that the workflow enables the precise identification and quantification of thousands of proteins from hundreds of isolated plant root and leaf cells. © 2021 Wiley Periodicals LLC. Basic Protocol 1: Plant tissue fixation and embedding Support Protocol 1: Preparation of 2.5% CMC solution Support Protocol 2: Slow freezing of CMC blocks to avoid crack development in the block Basic Protocol 2: Preparation of cryosections Alternate Protocol: Using a vacuum manifold to dehydrate the cryosection slides (primarily for root tissues) Basic Protocol 3: Laser capture microdissection of specific types of plant cells Basic Protocol 4: Nanodroplet-based sample preparation for ultrasensitive proteomic analysis Support Protocol 3: Fabrication of nanowell chips Basic Protocol 5: Liquid chromatography and mass spectrometry.

Identification, Characterization, and Expression Analysis of Cell Wall Related Genes in Sorghum bicolor (L.) Moench, a Food, Fodder, and Biofuel Crop.

Biomass based alternative fuels offer a solution to the world's ever-increasing energy demand. With the ability to produce high biomass in marginal lands with low inputs, sorghum has a great potential to meet second-generation biofuel needs. Despite the sorghum crop importance in biofuel and fodder industry, there is no comprehensive information available on the cell wall related genes and gene families (biosynthetic and modification). It is important to identify the cell wall related genes to understand the cell wall biosynthetic process as well as to facilitate biomass manipulation. Genome-wide analysis using gene family specific Hidden Markov Model of conserved domains identified 520 genes distributed among 20 gene families related to biosynthesis/modification of various cell wall polymers such as cellulose, hemicellulose, pectin, and lignin. Chromosomal localization analysis of these genes revealed that about 65% of cell wall related genes were confined to four chromosomes (Chr. 1-4). Further, 56 tandem duplication events involving 169 genes were identified in these gene families which could be associated with expansion of genes within families in sorghum. Additionally, we also identified 137 Simple Sequence Repeats related to 112 genes and target sites for 10 miRNAs in some important families such as cellulose synthase, cellulose synthase-like, and laccases, etc. To gain further insight into potential functional roles, expression analysis of these gene families was performed using publically available data sets in various tissues and under abiotic stress conditions. Expression analysis showed tissue specificity as well as differential expression under abiotic stress conditions. Overall, our study provides a comprehensive information on cell wall related genes families in sorghum which offers a valuable resource to develop strategies for altering biomass composition by plant breeding and genetic engineering approaches.