Benchmarking of virome metagenomic analysis approaches using a large, 60+ members, viral synthetic community.

IMPORTANCE: We report here efforts to benchmark performance of two widespread approaches for virome analysis, which target either virion-associated nucleic acids (VANA) or highly purified double-stranded RNAs (dsRNAs). This was achieved using synthetic communities of varying complexity levels, up to a highly complex community of 72 viral agents (115 viral molecules) comprising isolates from 21 families and 61 genera of plant viruses. The results obtained confirm that the dsRNA-based approach provides a more complete representation of the RNA virome, in particular, for high complexity ones. However, for viromes of low to medium complexity, VANA appears a reasonable alternative and would be the preferred choice if analysis of DNA viruses is of importance. Several parameters impacting performance were identified as well as a direct relationship between the completeness of virome description and sample sequencing depth. The strategy, results, and tools used here should prove useful in a range of virome analysis efforts.

A new geminialphasatellite associated with wheat dwarf virus identified in winter barley in France.

Using a high-throughput sequencing (HTS) approach, we report the discovery of a new alphasatellite identified in a winter barley plant collected in France in 2022 that was also infected by wheat dwarf virus (WDV). The presence of the satellite and of WDV was confirmed by several independent PCR assays, and the complete genome sequence was determined. The circular satellite genome is 1424 nt long and shows typical hallmarks of members of the subfamily Geminialphasatellitinae, including a replication-associated hairpin with a CAGTATTAC sequence and a Rep-encoding open reading frame (ORF). It also possesses a second ORF, embedded in a different frame within the Rep ORF, which is also observed in clecrusatellites and a few other members of the family Alphasatellitidae. Pairwise sequence comparisons and phylogenetic analysis showed that this satellite represents a novel species. Its closest relatives are in the genus Colecusatellite, but it likely represents a new genus given its divergence from other genera of the subfamily Geminialphasatellitinae. Given that WDV was the only virus observed in coinfection with the satellite, the name "wheat dwarf virus-associated alphasatellite" is proposed for this novel agent.

Comparative Performance Evaluation of Double-Stranded RNA High-Throughput Sequencing for the Detection of Viral Infection in Temperate Fruit Crops.

There is limited information on the compared performances of biological, serological. and molecular assays with high-throughput sequencing (HTS) for viral indexing in temperate fruit crops. Here, using a range of samples of predetermined virological status, we compared two performance criteria (inclusivity and analytical sensitivity) of enzyme-linked immunosorbent assay (ELISA), molecular hybridization, reverse transcription (RT)-PCR, and double-stranded RNA (dsRNA) HTS for the detection of a total of 14 viruses (10 genera) and four viroids (three genera). When undiluted samples from individual plants were used, ELISA had the lowest performance, with an overall detection rate of 68.7%, followed by RT-PCR (82.5%) and HTS (90.7%; 100% if considering only viruses). The lower performance of RT-PCR reflected the inability to amplify some isolates as a consequence of point mutations affecting primer-binding sites. In addition, HTS identified viruses that had not been identified by other assays in nearly two-thirds of the samples. Analysis of serial dilutions of fruit tree samples allowed comparison of analytical sensitivities for various viruses. ELISA showed the lowest analytical sensitivity, but RT-PCR showed higher analytical sensitivity than HTS for most of the samples. Overall, these results confirm the superiority of HTS over biological indexing in terms of speed and inclusivity and show that while the absolute analytical sensitivity of RT-PCR tends to be higher than that of HTS, PCR inclusivity is affected by viral genetic diversity. Taken together, these results make a strong case for the implementation of HTS-based approaches in fruit tree viral testing protocols supporting quarantine and certification programs.

Key Challenges in Plant Pathology in the Next Decade.

Plant diseases significantly impact food security and food safety. It was estimated that food production needs to increase by 50% to feed the projected 9.3 billion people by 2050. Yet, plant pathogens and pests are documented to cause up to 40% yield losses in major crops, including maize, rice, and wheat, resulting in annual worldwide economic losses of approximately US$220 billion. Yield losses due to plant diseases and pests are estimated to be 21.5% (10.1 to 28.1%) in wheat, 30.3% (24.6 to 40.9%) in rice, and 22.6% (19.5 to 41.4%) in maize. In March 2023, The American Phytopathological Society (APS) conducted a survey to identify and rank key challenges in plant pathology in the next decade. Phytopathology subsequently invited papers that address those key challenges in plant pathology, and these were published as a special issue. The key challenges identified include climate change effect on the disease triangle and outbreaks, plant disease resistance mechanisms and its applications, and specific diseases including those caused by Candidatus Liberibacter spp. and Xylella fastidiosa. Additionally, disease detection, natural and man-made disasters, and plant disease control strategies were explored in issue articles. Finally, aspects of open access and how to publish articles to maximize the Findability, Accessibility, Interoperability, and Reuse of digital assets in plant pathology were described. Only by identifying the challenges and tracking progress in developing solutions for them will we be able to resolve the issues in plant pathology and ultimately ensure plant health, food security, and food safety.

Identification of divergent isolates of cherry latent virus 1 in Greek sweet cherry orchards.

In this study, samples collected from eight sweet cherry trees in northern Greece were analyzed by high-throughput sequencing for the presence of viruses. Bioinformatic analysis revealed the presence of divergent isolates of cherry latent virus 1 (CLV-1), a recently identified trichovirus in a sweet cherry accession imported into the USA from the Republic of Georgia. The complete genome sequences of seven CLV-1 isolates were determined, and phylogenetic analysis indicated that they belonged to a separate clade from the previously characterized Georgian isolate. A small-scale survey confirmed the presence of CLV-1 in 47 out of 151 sweet cherry samples tested, and partial sequencing of 15 isolates showed a high degree of nucleotide sequence similarity among them.

Molecular diversity of yam virus Y and identification of banana mild mosaic virus isolates infecting yam (Dioscorea spp.).

Two members of the family Betaflexiviridae associated with yam (Dioscorea spp.) have been described so far: yam latent virus (YLV) and yam virus Y (YVY). However, their geographical distribution and molecular diversity remain poorly documented. Using a nested RT-PCR assay, we detected YVY in D. alata, D. bulbifera, D. cayenensis, D. rotundata, and D. trifida in Guadeloupe, and in D. rotundata in Côte d'Ivoire, thus extending the known host range of this virus and geographical distribution. Using amplicon sequencing, we determined that the molecular diversity of YVY in the yam samples analyzed in this work ranged between 0.0 and 29.1% and that this diversity is partially geographically structured. We also identified three isolates of banana mild mosaic virus (BanMMV) infecting D. alata in Guadeloupe, providing the first evidence for BanMMV infection in yam.

Molecular and Biological Characterization of Novel and Known Family Secoviridae Members Infecting Lettuce.

High-throughput sequencing of two lettuces showing virus-like symptoms in France provided evidence of infection by members of the family Secoviridae. One plant (JG1) had a complex mixed infection that involved, among others, a novel waikavirus (lettuce waikavirus 1) and two isolates of a sequivirus related to lettuce mottle virus (LeMoV). The second lettuce plant (JG2) was singly infected by LeMoV. Complete genomic sequences were obtained for all four isolates and, in addition, near complete genome sequences were obtained for other LeMoV or LeMoV-related isolates (from French cultivated and wild lettuces and from a Brazilian cultivated lettuce) and for two isolates of another family Asteraceae-infecting sequivirus, dandelion yellow mosaic virus (DaYMV). Analysis of these genomic sequences allows the proposal of tentative genome organization for the various viruses and clarification of their phylogenetic relationships. Sequence and host range comparisons point to significant differences between the two sequivirus isolates identified in the JG1 plant and LeMoV isolates from France and Brazil, suggesting they belong to a novel species for which the name lettuce star mosaic virus is proposed.

Diversity and Pathobiology of an Ilarvirus Unexpectedly Detected in Diverse Plants and Global Sequencing Data.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years, and implementing them with classical plant virology techniques results in a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (Bromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and several Fabaceae and Rosaceae plant species. Such a diverse set of source organisms is atypical for ilarviruses, thus warranting further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and a literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared with other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, whereas the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 in Solanum villosum and its mechanical and graft transmissibility to solanaceous species were demonstrated. Near-identical SnIV1 genomes from the inoculum (S. villosum) and inoculated Nicotiana benthamiana were sequenced, thus partially fulfilling Koch's postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infected N. benthamiana leaf tissues. Overall, this study provides information to better understand the diversity, global presence, and pathobiology of SnIV1; however, its possible emergence as a destructive pathogen remains uncertain. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

The Expanding Menagerie of Prunus-Infecting Luteoviruses.

Members of the genus Luteovirus are responsible for economically destructive plant diseases worldwide. Over the past few years, three luteoviruses infecting Prunus trees have been characterized. However, the biological properties, prevalence, and genetic diversity of those viruses have not yet been studied. High-throughput sequencing of samples of various wild, cultivated, and ornamental Prunus species enabled the identification of four novel species in the genus Luteovirus for which we obtained complete or nearly complete genomes. Additionally, we identified another new putative species recovered from Sequence Read Archive data. Furthermore, we conducted a survey on peach-infecting luteoviruses in eight European countries. Analyses of 350 leaf samples collected from germplasm, production orchards, and private gardens showed that peach-associated luteovirus (PaLV), nectarine stem pitting-associated virus (NSPaV), and a novel luteovirus, peach-associated luteovirus 2 (PaLV2), are present in all countries; the most prevalent virus was NSPaV, followed by PaLV. The genetic diversity of these viruses was also analyzed. Moreover, the biological indexing on GF305 peach indicator plants demonstrated that PaLV and PaLV2, like NSPaV, are transmitted by graft at relatively low rates. No clear viral symptoms have been observed in either graft-inoculated GF305 indicators or different peach tree varieties observed in an orchard. The data generated during this study provide a broader overview of the genetic diversity, geographical distribution, and prevalence of peach-infecting luteoviruses and suggest that these viruses are likely asymptomatic in peach under most circumstances.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

A new flavi-like virus identified in populations of wild carrots.

We report the discovery of a new flavi-like virus identified in wild carrots (Daucus carota subsp. carota), using a double-stranded (ds)RNA high-throughput sequencing (HTS) approach. The new virus, tentatively named "carrot flavi-like virus 1" (CtFLV-1), has a large genome of 21.8 kb that harbours a single open reading frame encoding a 7,078-aa polyprotein with conserved RNA helicase (Hel) and RNA-dependent RNA polymerase (RdRp) domains. The new virus is phylogenetically related to recently described flavi-like viruses from arthropods, but its closest relative is a plant-associated virus, gentian Kobu-sho-associated virus (GKSaV). A pairwise comparison showed that these two viruses share 38.4% amino acid (aa) sequence identity in their polyproteins and 73% and 47.8% aa sequence identity in their conserved RdRp and Hel domains, respectively. Based on their similar genome organization and phylogenetic relationship, GKSaV and CtFLV-1 could form the basis for a new genus of plant-associated viruses, possibly within the family Flaviviridae, for which the name "Koshovirus" is proposed.

Complete genome sequence of a novel cytorhabdovirus infecting elderberry (Sambucus nigra L.) in the Czech Republic.

The genus Cytorhabdovirus includes plant viruses with an unsegmented, single-stranded, negative-sense RNA genome that infect various plant hosts. In this work, we report the detection of a new cytorhabdovirus infecting elderberry (Sambucus nigra L.). Total RNA was purified from infected leaves and, after ribodepletion, sequenced using an Illumina system. The RNA genome of viral isolate B15 is 12,622 nucleotides (nt) long, and that of isolate B42 is 12,621 nt long. A nearly complete sequence (12,592 nt) was also obtained for a third isolate (B160). The RNA genomes of all three isolates showed an organisation typical of cytorhabdoviruses, harbouring all six of the expected genes (3´ N-P-P3-M-G-L 5´), separated by intergenic regions. These isolates were closely related to each other (99.5-99.6% nt sequence identity) and showed the highest overall similarity to trichosanthes associated rhabdovirus 1 (63.5% identity) and Wuhan insect virus 5 (58% identity), and similar results were obtained when comparing individual coding sequences or proteins. Phylogenetic analysis confirmed that this elderberry virus, for which we propose the name "sambucus virus 1" belongs to the genus Cytorhabdovirus and fulfils the criteria to represent a novel species.

A new potyvirus from hedge mustard (Sisymbrium officinale (L.) Scop.) sheds light on the evolutionary history of turnip mosaic virus.

A novel potyvirus was identified in symptomatic hedge mustard (Sisymbrium officinale (L.) Scop.) and wild radish (Raphanus raphanistrum L.) in France. The nearly complete genome sequence of hedge mustard mosaic virus (HMMV) was determined, demonstrating that it belongs to a sister species to turnip mosaic virus (TuMV). HMMV readily infected several other members of the family Brassicaceae, including turnip, shepherd's purse (Capsella bursa-pastoris), and arabidopsis. The identification of HMMV as a Brassicaceae-infecting virus closely related to TuMV leads us to question the current scenario of TuMV evolution and suggests a possible alternative one in which transition from a monocot-adapted ancestral lifestyle to a Brassicaceae-adapted one could have occurred earlier than previously recognized.Please check and confirm that the authors and their respective affiliations have been correctly identified and amend if necessary.all OK.

Host range and molecular variability of the sadwavirus dioscorea mosaic associated virus.

Dioscorea mosaic associated virus (DMaV) is a member of the genus Sadwavirus, family Secoviridae, that is associated with mosaic symptoms in Dioscorea rotundata in Brazil. The genome of a DMaV isolate detected in D. trifida in Guadeloupe was sequenced by high-throughput sequencing. Using an RT-PCR-based detection assay, we found that DMaV infects D. alata, D. bulbifera, D. cayenensis-rotundata, D. esculenta, and D. trifida accessions conserved in Guadeloupe and Côte d'Ivoire and displays a very high level of molecular diversity in a relatively small region of the genome targeted by the assay. We also provide evidence that DMaV is also present in D. rotundata in Benin and in D. alata in Nigeria.

Molecular characterization of Cordyline virus 1 isolates infecting yam (Dioscorea spp).

Cordyline virus 1 (CoV1) is a velarivirus that has so far only been reported in ornamental Ti plants (Cordyline fruticosa). Using high-throughput sequencing, we identified CoV1 infection in yam accessions from Vanuatu. Using a specific RT-PCR assay, we found that CoV1 is also present and highly prevalent in Dioscorea alata, D. cayenensis, and D. trifida in Guadeloupe. Phylogenetic analysis showed that CoV1 isolates infecting yam in Guadeloupe display a low level of molecular diversity. These data provide insights into the transmission of CoV1 in yam in Guadeloupe.

Identification of a novel vitivirus from pineapple in Reunion Island.

We report the complete genome sequence of a novel member of the genus Vitivirus (family Betaflexiviridae, subfamily Trivirinae) infecting pineapple. The complete genome sequence of this virus was obtained from total RNA extracted from pineapple leaf samples collected in Reunion Island, using a combination of high-throughput sequencing technologies. The viral genome is 6,757 nt long, excluding the poly(A) tail, and shares all the hallmarks of vitiviruses. Phylogenetic analysis performed on the replication-associated protein and capsid protein gene sequences unambiguously place this new virus, for which we propose the name "pineapple virus A", in the genus Vitivirus.

2022 taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales.

In March 2022, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by two new families (bunyaviral Discoviridae and Tulasviridae), 41 new genera, and 98 new species. Three hundred forty-nine species were renamed and/or moved. The accidentally misspelled names of seven species were corrected. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV.

Virion-Associated Nucleic Acid-Based Metagenomics: A Decade of Advances in Molecular Characterization of Plant Viruses.

Over the last decade, viral metagenomic studies have resulted in the discovery of thousands of previously unknown viruses. These studies are likely to play a pivotal role in obtaining an accurate and robust understanding of how viruses affect the stability and productivity of ecosystems. Among the metagenomics-based approaches that have been developed since the beginning of the 21st century, shotgun metagenomics applied specifically to virion-associated nucleic acids (VANA) has been used to disentangle the diversity of the viral world. We summarize herein the results of 24 VANA-based studies, focusing on plant and insect samples conducted over the last decade (2010 to 2020). Collectively, viruses from 85 different families were reliably detected in these studies, including capsidless RNA viruses that replicate in fungi, oomycetes, and plants. Finally, strengths and weaknesses of the VANA approach are summarized and perspectives of applications in detection, epidemiological surveillance, environmental monitoring, and ecology of plant viruses are provided. [Formula: see text] Copyright © 2022 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

First report of grapevine red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) infecting grapevine (Vitis vinifera L.) in Portugal.

Grapevine Red globe virus (GRGV) and grapevine rupestris vein feathering virus (GRVFV) are relatively recently described grape viruses that respectively belong to the genera Maculavirus and Marafivirus in the family Tymoviridae [1]. Owing to their rather recent description, still limited information on their biology, on their molecular variability and on their geographic distribution is available. Both viruses are apparently completely or largely asymptomatic in European grapevine and have likely been overlooked in a wide range of situations (Martelli, 2014). According to sequences in GenBank, GRGV has been identified in Asia (Iran, Japan, China), the Americas (USA, Brazil) and Europe (Spain, France, Slovenia, Hungary, Czech Republic and Germany). GRVFV has been reported from the same countries but also in Oceania (New Zealand, Australia) and from a range of other countries including India, Pakistan and South Korea for Asia, Canada for North America and Switzerland, Slovakia, Italy and Russia for Europe. Evidence for the presence of GRGV and GRVFV in grapevine plants from northern Portugal (variety(ies) unknown) was obtained through the bioinformatic analysis [2] of RNASeq Illumina data obtained from phloem scrapings from five grapevine samples collected in different plots in 2016 [3]. Following grapevine genome substraction, contigs assembly and Blast-based contigs annotation using CLC Genomics Workbench, two plants, #4 and #5b, yielded contigs representing near complete GRGV genomes. The plant #4 contig integrated 474 reads (0.15% of reads for an average coverage of 10.1x) while the corresponding values for the contig for plant #5b are 2185 reads (2.4% of total reads) for a coverage of 47.2x. The two GRGV contigs show 91.4% nucleotide (nt) identity and the closest GRGV full genome sequence in GenBank, MZ451067 from Canada, shares respectively 98.9% and 91.6% nt identity with them. The near complete genome contigs have been deposited in GenBank (ON603917 and ON603918). Simultaneously, two near full length genomic contigs for GRVFV were identified from plant #5b and have also been deposited in GenBank (ON603919 and ON603920). These contigs show 84.4% nt identity to each other and were respectively assembled from 4643 (5.2% of total reads) and 5326 reads (6.0% of total reads) for respective average coverages of 102.3x and 117.3x. The closest full GRVFV genome in GenBank is MZ027155 from the USA, with 84.3-85.3% nt identity. Confirmation of the presence of GRVG and GRVFV in the doubly infected plant #5b was achieved by specific RT-PCR assays. A published assay [4] was used for GRGV and primers GRVFV-Cp-F 5'AAYCCTGTCACHCTCCACTG3' and GRVFV-Cp-R 5'TTCATGGTGGTGCCDGTGAG3' (Tm 55°C) were used for GRVFV. The obtained 447nt GRGV amplicon showed a single difference with the HTS contig while the 218 nt GRVFV amplicon showed 3 mutations as compared to one of the HTS contigs. The different grapevines had initially been sampled because they showed relatively poor and stunted growth but besides GRVFV and/or GRGV the HTS analysis indicated that they were also infected by hop stunt viroid, grapevine yellow speckle viroid 1, grapevine rupestris stem pitting virus, plus respectively a novel nepovirus (plant #4) and grapevine leafroll-associated virus 2 and grapevine Pinot gris virus (plant #5b) so that the results reported here do not shed novel light on the potential pathogenicity of GRGV or GRVFV. To the best of our knowledge, this is the first report of GRGV and GRVFV in Portugal.