Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 7 de 7
Filtrar
1.
BMC Infect Dis ; 24(1): 1162, 2024 Oct 15.
Artigo em Inglês | MEDLINE | ID: mdl-39407144

RESUMO

BACKGROUND: A comprehensive assessment of combined modifiable risk factors in relation to infectious diseases among individuals with hypertension is lacking, and the potential mechanisms of these associations remain unclear. To investigate the prospective associations of a combination of lifestyle behaviors and cardiometabolic factors with the risk of infectious diseases among individuals with hypertension and to estimate whether and to what extent blood biomarkers mediate these associations. METHODS: This cohort study included 147,188 participants with hypertension and complete data on modifiable risk factors from the UK Biobank. Health score was constructed from eight modifiable risk factors, including four lifestyle behaviors (diet, physical activity, smoking, and sleep duration) and four cardiometabolic factors (body mass index, blood lipids, blood glucose, and blood pressure). Cox proportional hazards regression analysis was used to estimate hazard ratios (HRs) and 95% confidence intervals (CIs) for the health score and infectious diseases. The mediation analysis was performed to assess the potential intermediation effects of blood biomarkers. RESULTS: Over a median follow-up of 12.5 years, 27,398 participants with infectious diseases were documented, with 960 respiratory infectious diseases and 7940 digestive infectious diseases. After adjusting for potential confounders, the HR (95% CI) for the highest versus the lowest quartile of health score was 0.64 (0.62, 0.66) for infectious diseases, 0.72 (0.60, 0.86) for respiratory infectious diseases, and 0.66 (0.62, 0.71) for digestive infectious diseases. Stratified factors including duration of hypertension did not modify the associations between the health score and infectious diseases. In addition, biomarkers including inflammation and renal function collectively explained 46.60% of the associations between the combined lifestyle factors and infectious disease risk among individuals with hypertension. CONCLUSIONS AND RELEVANCE: Ideal management of combined modifiable risk factors was associated with lower risks of infectious diseases and might produce profound changes in blood biomarkers among individuals with hypertension. Additionally, specific biomarkers appeared to serve as an intermediate between combined lifestyle factors and infectious diseases. These insights highlighted the important role of a combination of healthy lifestyle and favorable cardiometabolic status in reducing disease burden and facilitated the understanding of biological mechanisms underlying modifiable risk factors with infectious diseases.


Assuntos
Doenças Transmissíveis , Hipertensão , Estilo de Vida , Humanos , Masculino , Hipertensão/epidemiologia , Hipertensão/complicações , Estudos Prospectivos , Feminino , Pessoa de Meia-Idade , Doenças Transmissíveis/epidemiologia , Doenças Transmissíveis/sangue , Fatores de Risco , Idoso , Biomarcadores/sangue , Adulto , Reino Unido/epidemiologia , Modelos de Riscos Proporcionais , Estudos de Coortes , Pressão Sanguínea
2.
Cell Mol Biol (Noisy-le-grand) ; 68(2): 70-80, 2022 Feb 28.
Artigo em Inglês | MEDLINE | ID: mdl-35869726

RESUMO

This work was developed to explore the relationship between intestinal microflora composition and immune function changes in children with asthma and to provide theoretical references for clinical diagnosis and treatment. Forty-eight children with asthma who received standardized treatment in the outpatient department of pediatric respiratory asthma in Children's Hospital were selected as the research objects, which were rolled into 24 cases of S0 group (complete control) and 24 cases of S1 group (incomplete control group). In addition, ten healthy children with general data matching the research objects were selected as a blank control (D0 group). The intestinal microbial composition and immune function indexes of each group were detected. The results showed that there were differences in the intestinal microbes of the three groups of children with Bifidobacterium, Megasphaera, Oscillibacter, Bilophila, and f_Ruminococcaceae. Among them, the proportions of Bifidobacterium, Megasphaera, and f_Ruminococcaceae in the intestinal microbes of the children in the S1 group were notably less than those in the S0 and D0 groups. The proportion of these three bacterial genera in the S0 group was also considerably smaller than that in the D0 group (P<0.05). In addition, the CD3+ levels of children in the S1 group were notably lower than those in the S0 and D0 groups, while the CD4+ and CD4+/CD3+ were higher than the S0 and D0 groups (P<0.05). The differences between CD3+, CD4+, and CD4+/CD3+ in the S0 and D0 groups were not considerable (P<0.05). The proportions of Bifidobacterium, Megasphaera, f_Ruminococcaceae, and Parasutterella in children with intestinal microbes were significantly positively correlated with CD3+ levels (P<0.05), and significantly negatively correlated with CD4+ and CD4+/CD3+ levels (P<0.05). In short, children with different levels of asthma control had a certain degree of flora disorder and decreased immune function in the intestinal flora. The decrease in the relative abundance of Bifidobacterium, f_Ruminococcaceae of Firmicutes, and Parasutterella of Riken Bacteria, and the increase in the relative abundance of Oscillatoria meant the decline of the immune function of the children.


Assuntos
Asma , Microbioma Gastrointestinal , Bactérias , Criança , Humanos , Intestinos
3.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 38(7): 671-673, 2021 Jul 10.
Artigo em Zh | MEDLINE | ID: mdl-34247375

RESUMO

OBJECTIVE: To retrospectively analyze the clinical phenotype and genetic characteristics of a child with severe mental retardation, language and motor development delays and autism. METHODS: High-throughput sequencing was carried out for the patient. Candidate variant was verified by Sanger sequencing and bioinformatics analysis. RESULTS: The child was found to harbor a heterozygous variant of exon 11:c.1421_1422insTGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) of the ASXL3 gene. The same variant was found in neither of her parents, suggesting that it has a de novo origin. CONCLUSION: The exon 11:c.1421_1422ins TGAATTTTCTGAGGAGGCTGAAAGT(p.Leu483*) variant of the ASXL3 gene probably underlay the pathogenesis of Bainbridge-Ropers syndrome in this patient. Above finding has enriched the spectrum of ASXL3 gene variants.


Assuntos
Transtorno Autístico , Deficiências do Desenvolvimento , Transtorno Autístico/genética , Criança , Feminino , Humanos , Mutação , Estudos Retrospectivos , Síndrome , Fatores de Transcrição/genética
4.
Front Immunol ; 15: 1357307, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38590518

RESUMO

The 2019 novel coronavirus, SARS-CoV-2, was highly prevalent in China as of December 2022, causing a range of symptoms, predominantly affecting the respiratory tract. While SARS-CoV-2 infection in children is generally mild, severe cases, especially in infants, are rare. We present a case of a previously healthy 7-month-old infant who developed cerebral infarction and coagulation dysfunction three days after COVID-19 onset. Clinically, the infant had weakness in the left limbs and pinpoint bleeding spots. A cranial magnetic resonance imaging showed ischemic strokes in the right basal ganglia and thalamus. Laboratory tests indicated thrombocytopenia and coagulation dysfunction. Inflammatory cytokines like interleukin-10 were elevated, with increased CD3+, CD4+, and CD8+ T lymphocytes but decreased CD3- CD16+ CD56+ natural killer cells. Treatment included mannitol, dexamethasone, oral aspirin, and vitamins B1 and B6 for reducing intracranial pressure, antiinflammation, anticoagulation, and nerve support, respectively. During the recovery phase, rehabilitation therapy focused on strength training, fine motor skills, and massage therapy. The infant gradually improved and successfully recovered. While rare, such cases can lead to severe complications. These combined efforts were instrumental in achieving significant functional recovery in the patient, demonstrating that even in severe instances of pediatric cerebral infarction due to COVID-19, positive outcomes are attainable with early and comprehensive medical response.


Assuntos
Transtornos da Coagulação Sanguínea , COVID-19 , Lactente , Humanos , Criança , COVID-19/complicações , SARS-CoV-2 , Citocinas , Infarto Cerebral/etiologia
5.
IEEE Trans Med Imaging ; PP2024 Jun 14.
Artigo em Inglês | MEDLINE | ID: mdl-38875087

RESUMO

Foundation models pretrained on large-scale datasets via self-supervised learning demonstrate exceptional versatility across various tasks. Due to the heterogeneity and hard-to-collect medical data, this approach is especially beneficial for medical image analysis and neuroscience research, as it streamlines broad downstream tasks without the need for numerous costly annotations. However, there has been limited investigation into brain network foundation models, limiting their adaptability and generalizability for broad neuroscience studies. In this study, we aim to bridge this gap. In particular, (1) we curated a comprehensive dataset by collating images from 30 datasets, which comprises 70,781 samples of 46,686 participants. Moreover, we introduce pseudo-functional connectivity (pFC) to further generates millions of augmented brain networks by randomly dropping certain timepoints of the BOLD signal. (2) We propose the BrainMass framework for brain network self-supervised learning via mask modeling and feature alignment. BrainMass employs Mask-ROI Modeling (MRM) to bolster intra-network dependencies and regional specificity. Furthermore, Latent Representation Alignment (LRA) module is utilized to regularize augmented brain networks of the same participant with similar topological properties to yield similar latent representations by aligning their latent embeddings. Extensive experiments on eight internal tasks and seven external brain disorder diagnosis tasks show BrainMass's superior performance, highlighting its significant generalizability and adaptability. Nonetheless, BrainMass demonstrates powerful few/zero-shot learning abilities and exhibits meaningful interpretation to various diseases, showcasing its potential use for clinical applications.

6.
Materials (Basel) ; 16(12)2023 Jun 13.
Artigo em Inglês | MEDLINE | ID: mdl-37374535

RESUMO

Over the past 20 years, as the depth and diameter of shaft lines increased in China, the cracking and water leakage of the inner walls of frozen shafts have become increasingly severe, resulting in significant safety threats and economic losses. Understanding the stress variation patterns of cast-in-place inner walls under the combined effects of temperature and constraint during construction is a prerequisite for evaluating the crack resistance performance of inner walls and preventing water leakage in frozen shafts. The temperature stress testing machine is an important instrument for studying the early-age crack resistance performance of concrete materials under the combined effects of temperature and constraint. However, existing testing machines have shortcomings in terms of applicable specimen cross-sectional shapes, temperature control methods for concrete structures, and axial loading capacity. In this paper, a novel temperature stress testing machine suitable for the inner wall structure shape, capable of simulating the hydration heat of the inner walls, was developed. Then, a reduced-scale model of the inner wall according to similarity criteria was manufactured indoors. Finally, preliminary investigations of the temperature, strain, and stress variations of the inner wall under 100% end constraint conditions were conducted by simulating the actual hydration heating and cooling process of the inner walls. Results show that the hydration heating and cooling process of the inner wall can be accurately simulated. After approximately 69 h of concrete casting, the accumulated relative displacement and strain of the end-constrained inner wall model were -244.2 mm and 187.8 µÎµ, respectively. The end constraint force of the model increased to a maximum value of 1.7 MPa and then rapidly unloaded, causing the model concrete to crack in tension. The temperature stress testing method presented in this paper provides a reference for scientifically formulating technical approaches to prevent cracking in cast-in-place concrete inner walls.

7.
J Immunother Cancer ; 11(12)2023 12 01.
Artigo em Inglês | MEDLINE | ID: mdl-38040417

RESUMO

BACKGROUND: Limited response to programmed death ligand-1 (PD-L1)/programmed death 1 (PD-1) immunotherapy is a major hindrance of checkpoint immunotherapy in non-small cell lung cancer (NSCLC). The abundance of PD-L1 on the tumor cell surface is crucial for the responsiveness of PD-1/PD-L1 immunotherapy. However, the negative control of PD-L1 expression and the physiological significance of the PD-L1 inhibition in NSCLC immunotherapy remain obscure. METHODS: Bioinformatics analysis was performed to profile and investigate the long non-coding RNAs that negatively correlated with PD-L1 expression and positively correlated with CD8+T cell infiltration in NSCLC. Immunofluorescence, in vitro PD-1 binding assay, T cell-induced apoptosis assays and in vivo syngeneic mouse models were used to investigate the functional roles of LINC02418 and mmu-4930573I07Rik in regulating anti-PD-L1 therapeutic efficacy in NSCLC. The molecular mechanism of LINC02418-enhanced PD-L1 downregulation was explored by immunoprecipitation, RNA immunoprecipitation (RIP), and ubiquitination assays. RIP, luciferase reporter, and messenger RNA degradation assays were used to investigate the m6A modification of LINC02418 or mmu-4930573I07Rik expression. Bioinformatics analysis and immunohistochemistry (IHC) verification were performed to determine the significance of LINC02418, PD-L1 expression and CD8+T cell infiltration. RESULTS: LINC02418 is a negative regulator of PD-L1 expression that positively correlated with CD8+T cell infiltration, predicting favorable clinical outcomes for patients with NSCLC. LINC02418 downregulates PD-L1 expression by enhancing PD-L1 ubiquitination mediated by E3 ligase Trim21. Both hsa-LINC02418 and mmu-4930573I07Rik (its homologous RNA in mice) regulate PD-L1 therapeutic efficacy in NSCLC via Trim21, inducing T cell-induced apoptosis in vitro and in vivo. Furthermore, METTL3 inhibition via N6-methyladenosine (m6A) modification mediated by YTHDF2 reader upregulates hsa-LINC02418 and mmu-4930573I07Rik. In patients with NSCLC, LINC02418 expression is inversely correlated with PD-L1 expression and positively correlated with CD8+T infiltration. CONCLUSION: LINC02418 functions as a negative regulator of PD-L1 expression in NSCLC cells by promoting the degradation of PD-L1 through the ubiquitin-proteasome pathway. The expression of LINC02418 is regulated by METTL3/YTHDF2-mediated m6A modification. This study illuminates the underlying mechanisms of PD-L1 negative regulation and presents a promising target for improving the effectiveness of anti-PD-L1 therapy in NSCLC.


Assuntos
Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , Humanos , Animais , Camundongos , Carcinoma Pulmonar de Células não Pequenas/patologia , Neoplasias Pulmonares/patologia , Antígeno B7-H1/metabolismo , Receptor de Morte Celular Programada 1 , Imunoterapia , RNA/metabolismo , RNA/uso terapêutico , Ubiquitinação , Metiltransferases/genética , Metiltransferases/metabolismo , Metiltransferases/uso terapêutico
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA