RESUMO
BACKGROUND: The sorghum aphid Melanaphis sacchari (Zehntner) (Homoptera: Aphididae) is an important insect in the late growth phase of sorghum (Sorghum bicolor L.). However, the mechanisms of sorghum response to aphid infestation are unclear. RESULTS: In this paper, the mechanisms of aphid resistance in different types of sorghum varieties were revealed by studying the epidermal cell structure and performing a transcriptome and metabolome association analysis of aphid-resistant and aphid-susceptible varieties. The epidermal cell results showed that the resistance of sorghum to aphids was positively correlated with epidermal cell regularity and negatively correlated with the intercellular space and leaf thickness. Transcriptome and metabolomic analyses showed that differentially expressed genes in the resistant variety HN16 and susceptible variety BTX623 were mainly enriched in the flavonoid biosynthesis pathway and differentially expressed metabolites were mainly related to isoflavonoid biosynthesis and flavonoid biosynthesis. The q-PCR results of key genes were consistent with the transcriptome expression results. Meanwhile, the metabolome test results showed that after aphidinfestation, naringenin and genistein were significantly upregulated in the aphid-resistant variety HN16 and aphid-susceptible variety BTX623 while luteolin was only significantly upregulated in BTX623. These results show that naringenin, genistein, and luteolin play important roles in plant resistance to aphid infestation. The results of exogenous spraying tests showed that a 1 concentration of naringenin and genistein is optimal for improving sorghum resistance to aphid feeding. CONCLUSIONS: In summary, the physical properties of the sorghum leaf structure related to aphid resistance were studied to provide a reference for the breeding of aphid-resistant varieties. The flavonoid biosynthesis pathway plays an important role in the response of sorghum aphids and represents an important basis for the biological control of these pests. The results of the spraying experiment provide insights for developing anti-aphid substances in the future.
Assuntos
Afídeos , Metaboloma , Sorghum , Transcriptoma , Sorghum/genética , Sorghum/parasitologia , Sorghum/metabolismo , Afídeos/fisiologia , Animais , Perfilação da Expressão Gênica , Regulação da Expressão Gênica de Plantas , Folhas de Planta/metabolismo , Folhas de Planta/genéticaRESUMO
Maize is the largest crop planted in China. Nine species of cyst nematodes have been reported to affect maize production. Heterodera zeae, H. avenae and Punctodera chalcoensis can cause significant maize yield losses annually (Luc et al. 2005). In 1971, the maize cyst nematode H. zeae was first detected in Rajasthan, India (Koshy et al. 1971). Subsequently, it has been reported in many other countries such as the United States, Greece, Pakistan, and Egypt. In China, H. zeae was first identified in the maize fields of Laibin City, Guangxi Zhuang Autonomous Region (Wu et al., 2017). Cui et al. (2020) identified H. zeae in a maize field of Yuzhou City, Henan Province of Central China in 2018. From 2018 to 2022, a survey of cyst-forming nematodes was conducted in Southwest China. Fifteen soil samples of about 500 g each were collected from Luding County, Ganzi Prefecture of Sichuan Province. No major aboveground symptoms were shown on maize, but a few females were observed on the roots of maize in one field. The cysts and second-stage juveniles (J2s) were collected from each soil sample using Cobb's screening gravity method. A total of 8.50±2.0 cysts per 100 ml of soil on the average were observed in the field. A thin subcrystalline layer was discernible only in young cysts. Morphological and molecular studies of cysts and J2s indicated that the nematodes were identified to be H. zeae in a maize-field. Morphologically, the cysts were in a lemon shape, light brown or pearly white in color. The vulval cone was prominent. Fenestra ambifenestrate, and semifenestra were separated by a fairly wide vulval bridge, fenestral length and width were variable, and the cyst wall was shown in a zigzag pattern. The J2s' body was in a vermiform, tapering at both ends, with a hyaline tail. Stylet was strongly developed with round or slightly anteriorly directed knobs. Morphological measurements of the cysts (n = 9) determined that the mean body length was 417.2 µm (403.6 to 439.4 µm), body width was 429.7 µm (397.6 to 456.9µm); length-width ratio was 1.4 (0.75 to 3); fenestra length was 525.3 µm (498.5 to 570.7 µm); and the mean semifenestra width was 458.6 µm (403.6 to 546.3 µm). Morphometric measurements of second-stage juveniles (n = 20) showed a body length of 419.7µm (355.8 to 492.5 µm); a stylet length of 20.8 µm (19.51 to 23.3µm); a tail length of 41.5 µm (20 to 49.4 µm); and a hyaline tail length of 20.7 µm (16.6 to 24 µm). The main morphological characteristics and measured values were basically consistent with those described by Cui et al. (2022), and all of which were similar to those of H. zeae. Amplification of DNA from random single cysts (n = 5) was conducted using the protocol described by Cui et al. (2022). The rDNA-internal transcribed spacer (ITS) was amplified and sequenced using a pair of universal primers TW81 (5'-GTTTCCGTAGGTGAA CCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3'). The ITS sequences were deposited at GenBank with the accession number OR811029.1. Alignments of sequences showed an identity of 98% with H. zeae sequences from China (OP692769.2, MW785772.1) and the USA (GU145616.1), which were confirmed using a pair of species-specific primers HzF1 (5'-GGGGAGGTGAATGTGGG-3') and HzR1 (5'-CCTTTGGCAATCGGTGA-3') of H. zeae with a targeted PCR fragment of 393 bp (Cui et al. 2022). Pathogenicity was conducted and confirmed by infection and reproduction on maize. Seeds (cv. Zhengda 619) were sown in three pots that contained 150 ml of a sterile soil mixture (loamy soil: sand=1:1), and 5 cysts (103 eggs/cyst on the average) were inoculated in each pot at 25/30°C, under a 12-h dark/12-h light condition (Cui et al. 2023). Fifteen days after sowing, third- and fourth-stage juveniles were observed in the rootstained with acid fuchsin, and a total of 32 cysts per maize plant on the average were collected at 40 days after sowing. The new cysts' morphological and molecular characteristics were identical to the cysts from the original soil samples. To the best of our knowledge, this is the first report of H. zeae as a pathogen on maize in Sichuan Province, Southwest China. Our findings will be useful for management and further research of maize cyst nematodes.
RESUMO
Heterodera avenae, H. filipjevi, and H. laptipons are considered to be the major cyst nematode pathogens affecting most cereals and causing severe crop losses (Smiley and Yan 2015). In China, H. filipjevi was first recorded in Xuchang, Henan Province (Peng et al. 2010). Recently, H. filipjevi has been found in Anhui, Hebei, Shandong and Xinjiang provinces of China (Cui et al. 2021). To further understand the latest occurrence and distribution of H. filipjevi in China, a survey of cyst nematodes was conducted in the wheat planting area of Shanxi Province of North China from June 2018 to November 2020. White female cysts (5.8 ± 2.99 cysts per plant) were found on wheat roots in the sandy soil, and wheat was displaying symptoms of dwarfing, yellowing, and had few tillers in Licheng of Changzhi (N36°32´010´´, E113°27´039´´; N36°29´050´´, E113°23´023´´; N36°29´035´´, E113°22´020´´) and Zezhou of Jincheng (N35°33´057´´, E112°56´020´´) in Shanxi Province, and second-stage juveniles (J2s) were obtained from 13 soil samples using the sieving-decanting method. Four of the 13 samples were identified as H. filipjevi on the basis of morphological and molecular studies of female cysts and J2s. Morphologically, the cysts were lemon shaped and featured a pronounced vulval cone. The color ranged from light to dark brown. The white female shell was covered with a white crystalline layer. The vulval cone was bifenestrate with horseshoe-shaped bullae numerous and distinct, and a strongly developed underbridge. The main measurements (mean ± SD, range) of cysts (n = 13) were as follows: body length including neck 780.5 ± 53.9 µm (692 to 843 µm); body width 527.3 ± 55.5 µm (435 to 620 µm); length/width ratio 1.50 ± 0.21 (1.20 to 1.93); fenestra length 55.5 ± 4.1 µm (49 to 61 µm); fenestra width 24.8 ± 2.2 µm (21.1 to 28.8 µm); vulval slit length 9.0 ± 0.7 µm (7.8 to 9.6 µm); and underbridge length 66.8 ± 5.0 µm (61 to 77 µm). The measurements of J2s (n = 13) were as follows: body length 554.4 ± 23.4 µm (520to 587 µm); stylet length 22.7 ± 0.7 µm (21.5 to 23.8 µm); tail length 61.0 ± 5.5 µm (51.2 to 68.9 µm); and hyaline tail terminus length 37.3 ± 2.7 µm (33.4 to 42.3 µm). These morphological measurements are within the range characteristic of H. filipjevi (Peng et al. 2010). Genomic DNA was extracted from individual cyst (n = 6) and the rDNA internal transcribed spacer (ITS) sequence was amplified using the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR test for each sample was repeated five times. The obtained ITS sequences (GenBank accession No. OQ421499 to OQ421502, 1054 bp) showed more than 99.5% similarity to those of H. filipjevi from the United States (GU079654 and KP878490), Turkey (KR704304 and KR704292), and China (MW789611, KY448473 and KT314234). The results were confirmed again by the species-specific primers HfF1 and HfR1of H. filipjevi and the target PCR fragments of 646 bp were obtained (Peng et al. 2013). The pathogenicity of H. filipjevi was verified by infesting winter wheat (Triticum aestivum 'Wenmai 19') and studying nematode developmentand reproduction with growth chamber (Cui et al. 2015). Eggs were hatched at 14-16°C, and freshly hatched J2s were used to inoculate wheat plants when the roots were approximately 1-centimeter long. Fifteen wheat plants were inoculated with 200 J2s, and three wheat plants without J2s were set as controls (Cui et al. 2021). Parasitic J2s and third- and fourth-stage juveniles were found in roots stained with acid fuchsin at 5, 15, and 25 days after inoculation (DAI), adult females were detected at 50 DAI, and a mean of 23.7 cysts per pot were extracted at 70 DAI (Cui et al. 2015). The morphological and molecular characteristics of the new cysts were identical to those of the H. filipjevi cysts from the original field samples, and no cysts formed in the control groups. Wheat is the main food and economic crop in Shanxi, and H. filipjevi, a potential threat to cereal crop production in Shanxi, should arouse sufficient attention. H. filipjevi is major cyst nematode pathogens of wheat and shows high prevalence in China. The loss of wheat production due to H. filipjevi is as high as 32.3% when the initial density ≥ 64 eggs/mL in soil (Li 2018). To the best of our knowledge, this is the first report of H. filipjevi in Shanxi Province of North China.
RESUMO
We sequenced DNA from spleens of rodents captured in rural areas of Qingdao, East China, during 2013-2015. We found 1 Apodemus agrarius mouse infected with Rickettsia conorii, indicating a natural Mediterranean spotted fever foci exists in East China and that the range of R. conorii could be expanding.
Assuntos
Febre Botonosa , Camundongos , Animais , Febre Botonosa/epidemiologia , Febre Botonosa/microbiologia , Roedores , China/epidemiologiaRESUMO
BACKGROUND: Fifty percent of Asians are born without a supratarsal fold (also called single eyelid), and double eyelid blepharoplasty is one of the most commonly performed and most popular facial cosmetic surgeries in the Asian population. However, patients with single eyelid frequently present with concomitant mild blepharoptosis (degree of ptosis, ≤2 mm), which often fails to cause the attention of surgeons and misses correction. METHODS: A retrospective study of all patients who underwent double eyelid blepharoplasty and blepharoptosis correction simultaneously with the modified levator aponeurosis plication technique was performed from June of 2017 to June of 2020. RESULTS: A total of 108 patients (155 eyelids) underwent double eyelid blepharoplasty and blepharoptosis correction simultaneously with the modified levator aponeurosis plication technique and were enrolled in the study. The average follow-up period was 11.8 ± 4.5 months. There was a statistically significant difference between the preoperative margin reflex distance 1 (MRD1) and postoperative MRD1 (2.93 ± 0.37 vs 4.21 ± 0.39 mm, P = 0.000), and the mean MRD1 improvement was 1.28 ± 0.50 mm. Sufficient correction was obtained in 148 eyelids (95.5%), whereas undercorrection was observed in 5 eyelids (3.2%) and overcorrection was observed in 2 eyelids (1.3%). One hundred two patients (94.4%) were completely satisfied with the final result.All patients had smooth and elegant upper eyelid margin curve, and no patients complained of distortion of the eyelid margin contour and foreign body sensation.There were no cases of hematoma, infection, suture exposure, corneal abrasion, and keratitis in any patient. CONCLUSIONS: This modified levator aponeurosis plication introduced in this study is a simple and effective method for creating double-eyelid crease and correcting mild blepharoptosis simultaneously, and provides a satisfactory outcome. As such, we recommend this method in treating patients with both single eyelid and mild blepharoptosis.
Assuntos
Blefaroplastia , Blefaroptose , Aponeurose/cirurgia , Blefaroplastia/métodos , Blefaroptose/cirurgia , Pálpebras/cirurgia , Feminino , Humanos , Músculos Oculomotores/cirurgia , Estudos Retrospectivos , Resultado do TratamentoRESUMO
Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L) â¯= 609.0⯠±â¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0 ⯱⯠28.6 µm (329.7 to 436.1 µm); stylet length â¯=⯠17.0 ⯱⯠1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =⯠3.3 ⯱⯠0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n⯠=⯠20) were measured (mean ± SD; range) as follows: L â¯=⯠401.2⯠±â¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W â¯= 28.6⯠±â¯ 1.0 (26.7 to 30.4); stylet length =⯠10.3 ⯱⯠0.6 µm (9.1 to 11.2 µm); DGO⯠=⯠2.4 ⯱⯠0.1 µm (2.1 to 2.6 µm); and tail length â¯= â¯49.3⯠± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.
RESUMO
Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027â³ and E113° 39' 059â³) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.
RESUMO
BACKGROUND: Blepharoptosis is defined as an abnormally low-positioned upper eyelid margin in the primary gaze position, which results in cosmetic discomfort and functional visual dysfunction. Recurrence is one of the common complications after ptosis correction and requires further revision. Conjoint fascial sheath (CFS) suspension has become increasingly popular for ptosis. In this article, we described our experience of CFS suspension in the treatment of recurrent blepharoptosis and evaluated the postoperative outcomes so as to guide the clinical application of CFS suspension. METHODS: Thirty-eight patients (48 eyelids) who had recurrent blepharoptosis and received CFS suspension were included in this study. Before the surgery, the degree of ptosis and levator function were assessed. The postoperative evaluation consisted of the correction effect, eyelid symmetry, protective closure function of eyelid, and surgical complications. RESULTS: At the final follow-up, 46 eyelids (95.8%) showed an ideal correction, of which 24 eyelids (50%) showed sufficient correction and 22 eyelids (45.8%) showed normal correction. The remaining 2 eyelids (4.2%) showed under-correction. Among all 38 patients, 26 patients (68.4%) achieved good symmetry, and 10 patients (26.3%) achieved fair symmetry, while only 2 patients (5.3%) showed poor symmetry. Recovery time of eyelid protective closure function was 3.9 ± 1.04 months (range, 2.5-6 months). There were no complications except residual lagophthalmos (9 eyelids) residual conjunctival prolapse (10 eyelids). CONCLUSION: CFS suspension is an effective method for the correction of recurrent blepharoptosis due to its sufficient correction effect, recovery of eyelid protective closure function, and less complication rate. LEVEL OF EVIDENCE IV: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .
Assuntos
Blefaroplastia , Blefaroptose , Blefaroplastia/métodos , Blefaroptose/cirurgia , Humanos , Músculos Oculomotores/cirurgia , Estudos Retrospectivos , Resultado do TratamentoRESUMO
BACKGROUND: As periorbital aesthetic commonly improved in blepharoptosis patients after correction surgery, the aim of this study was to elaborate the brow-eyelid continuum changes in moderate-severe ptosis patients who underwent conjoint fascial sheath suspension systematically. METHODS: Patients with moderate-severe ptosis who underwent conjoint fascial sheath suspension were assessed by using pre- and post-operative digital photographs in the primary gaze position of the eye. The main outcome measurements included marginal reflex distance1 (MRD1), palpebral fissure height (PFH), eyebrow position, the symmetry of face and the horizontal forehead lines condition. RESULTS: There were 43 patients (53 eyelids) in our study, including 33 unilateral and 10 bilateral patients. The mean levator function was 3.00 ± 1.07 mm. Before surgery, the mean MRD1 and PFH were 0.60 ± 1.14 mm and 6.75 ± 1.71 mm, respectively. The mean eyebrow height at medial, center, lateral position was 33.16 ± 3.95 mm, 35.99 ± 4.02 mm and 34.35 ± 4.80 mm, respectively. It was found that MRD1 and PFH symmetry both were 23.26% and eyebrow symmetry was 62.79%. For forehead wrinkles, 48.84% of the patients was mild, 34.88% was moderate, and 16.28% was severe. The average follow-up was 12.78 months (ranged from 12 to 18 months). One month after surgery, the mean MRD1 and PFH were 5.68 ± 0.86 mm, 11.61 ± 0.97 mm, respectively, both of which improved significantly (P < 0.0001). The mean eyebrow height at medial, center, lateral position descended to 28.22 ± 4.77 mm (P = 0.017), 31.41 ± 4.58 mm (P = 0.033) and 30.28 ± 3.41 mm (P = 0.018), respectively. The result showed that the rate of patients with MRD1 symmetry was 32.56%, PFH symmetry was 30.23%, and eyebrow symmetry was 90.7%. For forehead wrinkles, 69.77% was mild and 30.23% was moderate. Then, patients' eyebrow gradually elevated, while their upper eyelid dropped. At the last follow-up, the mean MRD1 and PFH were 3.83 ± 0.98 mm and 9.84 ± 1.56 mm, respectively. The mean eyebrow height at medial, center, lateral position improved to 30.52 ± 4.59 mm (P = 0.031), 32.40 ± 4.68 mm (P = 0.033), 31.19 ± 4.16 mm (P = 0.028), respectively. The patients with MRD1 symmetry accounted for 86.05%, PFH symmetry 86.05%, and eyebrow symmetry 90.7%. For forehead wrinkles, 67.44% was mild and 32.56% was moderate. CONCLUSION: CFS suspension can effectively reconstruct moderate-severe ptosis patients' aesthetics of the brow-eyelid continuum by descending elevated eyebrow, improving facial symmetry and reducing forehead rhytids. LEVEL OF EVIDENCE IV: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .
RESUMO
Three of the cereal cyst nematodes, Heterodera avenae, H. filipjevi and H. latipons are considered to be the most economically important cyst nematodes that affect cultivated cereals around the world. H. filipjevi was first detected in China from Xuchang, Henan Province in 2010 (Peng et al. 2010) and now has been recorded in the Central China of Henan, Shandong and Anhui provinces and the Northwest China of Xinjiang Uygur Autonomous Region (Cui et al. 2020). In June 2019, 42 samples consisting of roots and soil were collected from winter wheat fields in Hebei Province of North China. Cysts were detected in 37 soil samples with a mean of 6.4 ± 1.67 cysts per 100 ml of soil. Cysts and second-stage juveniles (J2s) were extracted from root and soil following Cobb's sieving gravity method. Morphological and molecular studies of J2s and cysts confirmed its identity with H. filipjevi in 5 samples from Handan (N36°10'052" and E114°35'056"; N36°37'054" and E114°22'052"), Xingtai (N36°53'060" and E114°30'011") and Shijiazhuang (N 37°26'048" and E 116°05'039") in Hebei Province, China. Morphologically, the cysts are lemon-shaped, light or dark brown in color. The vulval cone is bifenestrate with horseshoe-shaped semifenestrae, strongly globular bullae, and well-developed underbridge. Measurements (mean +_ sd (range)) of cysts (n=10), body length not including neck is 743.0 ± 36.1 µm (665 - 780 µm), body width is 559.0 ± 50.0 µm (455 - 639 µm), length / width ratio is 1.33 ± 0.07 (1.20 - 1.46); neck length is 99.3 ± 8.8 µm (85 - 122 µm); fenestrae length is 56.8 ± 5.0 µm (49 - 65 µm) and width is 25.5 ± 1.8 µm (21.1 - 27.8 µm); underbridge length is 84.0 ± 8.1 µm (62 - 93 µm); and vulval slit length is 8.6 ± 0.5 µm (7.2 - 9.1 µm). Measurements of J2s (n = 12), body length is 541 ± 11.4 µm (490 - 578 µm); stylet length is 22.3 ± 0.5 µm (22.0 - 25.0 µm) with anchor-shaped basal knobs; tail length is 57.7 ± 3.7 µm (52.7 - 65.2 µm), and hyaline tail terminal length is 36.5 ± 2.8 µm (32 - 39.8 µm). The tail had a sharp terminus. Morphology of the cysts and J2s were consistent with the record of H. filipjevi (Peng et al. 2010; Subbotin et al. 2010). The amplifications of rDNA-internal transcribed spacer (ITS) fragments were generated with a PCR fragment of 1054 bp from single cysts of each population, using primers TW81 and AB28 (Joyce et al. 1994). The PCR tests for each sample were repeated five times. The PCR product was purified and sequenced. All nucleotide sequences of ITS-rDNA were submitted to GenBank under accession numbers MW282843-6. Sequences from the ITS region were more than 99.5% identical to those of H. filipjevi from Egypt (KF225725), Turkey (KR704308, KR704293 and MN848333) and China (KT314234, MT254744 and KY448473). These results from ITS supported its identity as H. filipjevi. The results were also confirmed by species specific sequence characterized amplified region primers of H. filipjevi (Peng et al. 2013). Pathogenicity of the H. filipjevi was confirmed by infection of winter wheat (Triticum aestivum L cv. 'Aikang58') and examination of the nematode development and reproduction. Wheat seeds were germinated in petri dishes and then transplanted into five polyvinyl chloride tubs (3 cm in diameter, 25 cm in length) that contained 150 cm3 of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 252.0 eggs/cyst). Plants were grown in an artificial climate box for one week at 14/18°C, two weeks at 16/20°C, five weeks at 18/25°C and two weeks at 22/30°C, under 8 h of darkness/16 h light and normal culturing practices (Cui et al. 2015). The parasitic J2s, third and fourth-stage juveniles, and adult females were observed in roots stained with acid fuchsin at 10, 20, 30, and 50 days after inoculation (DAI), and an average of 32.0 cysts per tubes were extracted 70 DAI. The new cyst' morphological and molecular characteristics were identical to the H. filipjevi cysts from the original soil samples. Three other tubes without cysts were set as control and there were no newly formed cysts. Heterodera avenae and H. filipjevi had been detected in a total of 16 wheat-producing provinces in China, which resulted in losses of 1.9 billion CNY year-1 (Cui et al. 2015). To our knowledge, this is the first report of H. filipjevi in Hebei Province of North China. Cereal cyst nematodes are easily transferred to non-infested areas by many avenues, resulting in increased species and pathotype complexity (Cui et al. 2020). Once H. filipjevi continues to spread in main wheat producing area of China, it could become be a new threat to cereals production. It is time to take effective control methods to prevent H. filipjevi further dispersal, especially through the farming machinery transmission. Hebei Province is one of the most important major grain-producing areas, our findings will be very beneficial for H. filipjevi management and further research on winter wheat in Hebei Province, North China.
RESUMO
A 46-year-old male patient came to the gastroenterology department with recurrent abdominal pain, distension, and delayed defecation. Also, three bowel obstructions had occurred within six months. He presented to his local emergency department and received intestinal dredging and antibiotic treatment. Computed tomography of the abdomen showed local dilation of the small bowel in the middle and lower abdomen, with contents visible in the lumen of the bowel. The bowels were surrounded by multiple fibrous, cable-like envelopments and thickened mesentery, as though in a cocoon.
Assuntos
Obstrução Intestinal , Dor Abdominal/diagnóstico por imagem , Dor Abdominal/etiologia , Humanos , Obstrução Intestinal/diagnóstico por imagem , Obstrução Intestinal/etiologia , Obstrução Intestinal/cirurgia , Intestino Delgado , Masculino , Mesentério/diagnóstico por imagem , Pessoa de Meia-Idade , Tomografia Computadorizada por Raios XRESUMO
Cellular stress or injury induces release of endogenous danger signals such as ATP, which plays a central role in activating immune cells. ATP is essential for the release of nonclassically secreted cytokines such as IL-1ß but, paradoxically, has been reported to inhibit the release of classically secreted cytokines such as TNF. Here, we reveal that ATP does switch off soluble TNF (17 kDa) release from LPS-treated macrophages, but rather than inhibiting the entire TNF secretion, ATP packages membrane TNF (26 kDa) within microvesicles (MVs). Secretion of membrane TNF within MVs bypasses the conventional endoplasmic reticulum- and Golgi transport-dependent pathway and is mediated by acid sphingomyelinase. These membrane TNF-carrying MVs are biologically more potent than soluble TNF in vivo, producing significant lung inflammation in mice. Thus, ATP critically alters TNF trafficking and secretion from macrophages, inducing novel unconventional membrane TNF signaling via MVs without direct cell-to-cell contact. These data have crucial implications for this key cytokine, particularly when therapeutically targeting TNF in acute inflammatory diseases.-Soni, S., O'Dea, K. P., Tan, Y. Y., Cho, K., Abe, E., Romano, R., Cui, J., Ma, D., Sarathchandra, P., Wilson, M. R., Takata, M. ATP redirects cytokine trafficking and promotes novel membrane TNF signaling via microvesicles.
Assuntos
Trifosfato de Adenosina/imunologia , Membrana Celular/imunologia , Vesículas Extracelulares/imunologia , Macrófagos/imunologia , Pneumonia/imunologia , Transdução de Sinais/imunologia , Fator de Necrose Tumoral alfa/imunologia , Doença Aguda , Trifosfato de Adenosina/genética , Animais , Comunicação Celular/genética , Comunicação Celular/imunologia , Membrana Celular/genética , Retículo Endoplasmático/genética , Retículo Endoplasmático/imunologia , Vesículas Extracelulares/genética , Complexo de Golgi/genética , Complexo de Golgi/imunologia , Inflamação/induzido quimicamente , Inflamação/genética , Inflamação/imunologia , Lipopolissacarídeos/toxicidade , Masculino , Camundongos , Camundongos Knockout , Pneumonia/induzido quimicamente , Pneumonia/genética , Transdução de Sinais/efeitos dos fármacos , Transdução de Sinais/genética , Fator de Necrose Tumoral alfa/genéticaRESUMO
BACKGROUND: Sevoflurane is commonly used for cervical cancer surgery, but its effect on cervical cancer cell biology remains unclear. This mechanistic study explores how sevoflurane affects the proliferation and metastatic potential of immortalized cervical cancer cell lines. METHODS: Cultured cervical cancer Caski and HeLa lines were exposed to 1, 2, or 3% sevoflurane for 2 or 4 h. Cell proliferation was determined through the Kit-8 assay and Ki-67 immunofluorescent staining. Cell migration and invasion were evaluated with the Transwell assay. Immunofluorescent staining and Western blot analysis were used to identify sevoflurane-induced morphological and biochemical changes. RESULTS: Sevoflurane exposure for either 2 or 4 h significantly increased HeLa cell proliferation in a time- and concentration-dependent manner to be 106 ± 2.7% and 107 ± 1.4% relative to the controls (n = 10; P = 0.036; P = 0.022) at 24 h after exposure and to be 106 ± 2.2% and 106 ± 1.7% relative to the controls (n = 10; P = 0.031; P = 0.023) at the highest concentration of 3% sevoflurane studied, respectively, but not Caski cells. Sevoflurane promoted invasion ability (1.63 ± 0.14 and 1.92 ± 0.12 relative to the controls) and increased cell size (1.69 ± 0.21 and 1.76 ± 0.13 relative to the controls) of Caski and HeLa cells (n = 6; all P < 0.001), respectively. Sevoflurane increased histone deacetylase 6 expression in both cells, and histone deacetylase 6 knockdown abolished the prometastatic effects of sevoflurane. Sevoflurane also induced deacetylation of α-tubulin in a histone deacetylase 6-dependent manner. The protein kinase B (AKT) or extracellular regulated protein kinase (ERK1/2) phosphorylation inhibition attenuated sevoflurane-induced histone deacetylase 6 expression. CONCLUSIONS: Sevoflurane enhanced proliferation, migration, and invasion of immortalized cervical cancer cells, which was likely associated with increasing histone deacetylase 6 expression caused by phosphatidylinositide 3-kinase/AKT- and ERK1/2-signaling pathway activation.
Assuntos
Anestésicos Inalatórios/farmacologia , Proliferação de Células/efeitos dos fármacos , Desacetilase 6 de Histona/metabolismo , Sevoflurano/farmacologia , Neoplasias do Colo do Útero/metabolismo , Neoplasias do Colo do Útero/patologia , Linhagem Celular Tumoral , Movimento Celular , Feminino , Humanos , Técnicas In Vitro , Metástase Neoplásica , Transdução de SinaisRESUMO
From June 2018 to November 2019, a survey for cyst-forming nematodes was conducted in rice fields in Henan Province of central China. Cysts were recovered from two rice fields (N32° 14' 048â³8 and E115° 4' 008â³) at Huangchuan County, leading to more intensive sampling. A further 25 soil samples were then collected with a valve bag from each of these two locations. Cysts and second-stage juveniles (J2) were recovered from roots and soil following Cobb's gravity sieving method. Live cysts were detected in all soil samples with a mean of 6.7±1.5 cysts per 100 ml of soil. Morphologically, the cysts were spherical to lemon-shaped, light to dark brown in color with subcrystalline layer. The vulval cone was well developed, cone terminus with a few large, peripheral, dark brown bullae lacking finger-like projections, and the ambifenestrae were almost rounded with two semifenestrae; width and length of the semifenestrae were similar. The vulval bridge was narrow, with a medium sized underbridge. Cyst measurements (n = 8) determined a mean body length of 431.1 ± 47.23 (351.0 - 516.0) µm, body width 304.3 ± 47.40 (240.0 - 381.0) µm; body length to width ratio 1.42 ± 0.10 (1.2 to 1.6); fenestrae length 39.4 ± 7.06 (26.0 - 47.0) µm; fenestrae width 36.5 ± 5.96 (25.0 - 43.0) µm; vulva slit length 37.1 ± 3.62 (30.0 - 42.0) µm; and the mean underbridge length 75.0 ± 3.39 (70.0 - 81.0) µm. Morphometric J2 measurements (n = 10) included a body length of 432.3 ± 53.26 (379.0 - 512.0) µm; stylet length 20.8 ± 1.87 (18.0 - 24) µm with rounded knobs; tail length 63.1 ± 7.92 (52.0 - 75.0) µm with a hyaline terminal tail length of 35.8 ± 6.14 (28.0 - 45.0) µm. The key morphometrics of this isolate were intermediate to those of the Japanese isolates (Nobbs et al. 1992.) and Chinese isolates (Ding et al. 2012), and other morphological character values were within the range of those reported for Heterodera elachista (Nobbs et al. 1992; Tanha Maafi et al. 2003). Amplification of DNA from single cysts (n = 7) was conducted using the protocol described by Ding et al. (2012). rDNA - ITS sequences were amplified with the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR product was purified and sequenced. The ITS sequences were submitted to GenBank under accession numbers MT579616. Comparisons showed a sequence identity of more than 99.9% for H. elachista sequence MN720080 from Korea and 99.5% for H. elachista sequences JN864884 and JN202916 from China. Species identification was also confirmed using sequence characterized amplified region (SCAR) methods with H. elachista-specific primers He-F/He-R (Qi, 2012). An expected PCR fragment of approximately 434 bp was obtained, which was consistent with those previously reported for H. elachista. Pathogenicity was confirmed by infection and reproduction on rice (Oryza sativa cv. 'Nipponbare'). Seeds were sown into three tubes containing 150 ml of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 185 eggs/cyst) and cultivated in an artificial climate box at 25/30°C, under a 12-h dark/12-h light cycle. Three other tubes without cysts were set as control. Two weeks after sowing, stunting and reduction of leaf length were observed and third- and fourth-stage juveniles were observed in roots stained with acid fuchsin. On average, 142 cysts per 150 ml soil were recovered at 5 weeks after sowing. The newly formed cysts corresponded morphologically and molecularly to the cysts from the original soil samples. The globally recognized and economically important rice-damaging cyst nematodes include H. oryzae, H. oryzicola, H. elachista, H. sacchari and H. graminophila (Zhuo et al. 2014). Ohshima (1974) first reported H. elachista, which was originally recorded as H. oryzae in Japan by Luc and Brizuela (1961). H. elachista was then detected from a rice field at Mazandaran Province in Iran (Tanha Maafi et al., 2003), and in upland rice fields in Hunan (Ding et al., 2012) and Guangxi, China (Zhuo et al. 2014). To the best of our knowledge, this is the first report of H. elachista as a pathogen on rice in Henan Province, in central China. According to our field observations, H. elachista was much more serious in direct-seeded rice field than in the transplanted rice fields. H. elachista was also reported attacking corn (Xiao et al., 2019). Henan is the most important corn-producing province in China, thus H. elachista is a potential threat to corn production in Henan. Our findings will be very beneficial for H. elachista management and further research on direct-seeded rice and corn in Henan Province, central China.
RESUMO
BACKGROUND: Respiratory complications after surgery are associated with morbidity and mortality. Acute lung injury can result from the systemic inflammatory response after acute kidney injury. The mechanisms behind this remote injury are not fully understood. In this study, a renal transplantation model was used to investigate remote lung injury and the underlying molecular mechanisms, especially the role of osteopontin (OPN). METHODS: In vitro, human lung epithelial cell line (A549) and monocyte/macrophage cell line (U937) were challenged with tumour necrosis factor-alpha (TNF-α) in combination with OPN. In vivo, the Fischer rat renal grafts were extracted and stored in 4°C University of Wisconsin preserving solution for up to 16 h, and transplanted into Lewis rat recipients. Lungs were harvested on Day 1 after grafting for further analysis. RESULTS: Renal engraftment was associated with pathological changes and an increase in TNF-α and interleukin-1 beta in the lung of the recipient. OPN, endoplasmic reticulum (ER) stress, and necroptosis were increased in both the recipient lung and A549 cells challenged with TNF-α. Exogenous OPN exacerbated lung injury and necroptosis. Suppression of OPN through siRNA reduced remote lung injury by mitigation of ER stress, necroptosis, and the inflammatory response. CONCLUSIONS: Renal allograft transplant triggers recipient remote lung injury, which is, in part, mediated by OPN signalling. This study may provide a molecular basis for strategies to be developed to treat such perioperative complications.
Assuntos
Lesão Pulmonar Aguda/prevenção & controle , Transplante de Rim/efeitos adversos , Osteopontina/farmacologia , Complicações Pós-Operatórias/prevenção & controle , Animais , Apoptose , Células Cultivadas , Modelos Animais de Doenças , Humanos , Técnicas In Vitro , Masculino , Necrose , Ratos , Ratos Endogâmicos F344 , Ratos Endogâmicos LewRESUMO
Clinical evidence has indicated a possible link between renal injury and remote liver injury. We investigated whether extracellular histone mediates remote hepatic damage after renal graft ischemia-reperfusion injury, while vascular endothelial growth factor (VEGF) is protective against remote hepatic injury. In vitro, hepatocyte HepG2 cultures were treated with histone. In vivo, the Brown-Norway renal graft was stored in 4°C preservation solution for 24 hours and then transplanted into a Lewis rat recipient; blood samples and livers from recipients were harvested 24 hours after surgery. Prolonged cold ischemia in renal grafts enhanced liver injury 24 hours after engraftment. Caspase-1, ASC, NLRP3, and AIM2 expressions in hepatocyte, CD68+ -infiltrating macrophages, tissue, and serum interleukin-1ß and -18 were greatly elevated, indicating that pyroptosis occurred in the liver and resulted in acute liver functional impairment. Blocking the caspase-1 pathway decreased the number of necrotic hepatocytes. VEGF treatment suppressed the hepatocyte pyroptosis and liver function was partially restored. Our data suggested that renal allograft ischemia-reperfusion injury is likely associated with acute liver damage due to hepatocyte pyroptosis induced by histone and such injury may be protected by VEGF administration. VEGF, therefore, may serve as a new strategy against other remote organ injuries related to renal transplantation.
Assuntos
Histonas/toxicidade , Inflamação/prevenção & controle , Transplante de Rim/efeitos adversos , Hepatopatias/prevenção & controle , Piroptose , Traumatismo por Reperfusão/cirurgia , Fator A de Crescimento do Endotélio Vascular/metabolismo , Aloenxertos , Animais , Citoproteção , Inflamação/etiologia , Inflamação/metabolismo , Hepatopatias/etiologia , Hepatopatias/metabolismo , Masculino , Ratos , Ratos Endogâmicos BN , Ratos Endogâmicos Lew , Fator A de Crescimento do Endotélio Vascular/genéticaRESUMO
Organic substrates and biochar are important in controlling arsenic release from sediments and soils; however, little is known about their impact on arsenic-reducing bacteria and genes during arsenic transformation in flooded paddy soils. In this study, microcosm experiments were established to profile transcriptional activity of As(V)-respiring gene (arrA) and arsenic resistance gene (arsC) as well as the associated bacteria regulated by lactate and/or biochar in anaerobic arsenic-contaminated paddy soils. Chemical analyses revealed that lactate as the organic substrate stimulated microbial reduction of As(V) and Fe(III), which was simultaneously promoted by lactate+biochar, due to biochar's electron shuttle function that facilitates electron transfer from bacteria to As(V)/Fe(III). Sequencing and phylogenetic analyses demonstrated that both arrA closely associated with Geobacter (>60%, number of identical sequences/number of the total sequences) and arsC related to Enterobacteriaceae (>99%) were selected by lactate and lactate+biochar. Compared with the lactate microcosms, transcriptions of the bacterial 16S rRNA gene, Geobacter spp., and Geobacter arrA and arsC genes were increased in the lactate+biochar microcosms, where transcript abundances of Geobacter and Geobacter arrA closely tracked with dissolved As(V) concentrations. Our findings indicated that lactate and biochar in flooded paddy soils can stimulate the active As(V)-respiring bacteria Geobacter species for arsenic reduction and release, which probably increases arsenic bioavailability to rice plants.
Assuntos
Arsênio , Oryza , Poluentes do Solo , Bactérias , Carvão Vegetal , Compostos Férricos , Ácido Láctico , Filogenia , RNA Ribossômico 16S , SoloRESUMO
Few molecular details of effectors of Heterodera avenae parasitism are known. We performed a high-throughput sequencing analysis of the H. avenae transcriptome at five developmental stages. A total of 82,549 unigenes were ultimately obtained, and 747 transcripts showed best hits to genes putatively encoding carbohydrate-active enzymes in plant-parasitic nematodes that play an important role in the invasion process. A total of 1,480 unigenes were homologous to known phytonematode effectors, and 63 putative novel effectors were identified in the H. avenae transcriptomes. Twenty-three unigenes were analyzed by qRT-PCR and confirmed to be highly expressed during at least one developmental stage. For in situ hybridization, 17 of the 22 tested putative effectors were specifically expressed and located in the subventral gland cells, and five putative novel effectors were specifically expressed in the dorsal gland. Furthermore, 115 transcripts were found to have putative lethal RNA interference (RNAi) phenotypes. Three target genes with lethal RNAi phenotypes and two of the four tested putative effectors were associated with a decrease in the number of cysts through in vitro RNAi technology. These transcriptomic data lay a foundation for further studies of interactions of H. avenae with cereal and H. avenae parasitic control.
Assuntos
Grão Comestível/parasitologia , Proteínas de Helminto/genética , Doenças das Plantas/parasitologia , Transcriptoma , Tylenchoidea/genética , Animais , Feminino , Hibridização In Situ , Óvulo , Fenótipo , Interferência de RNA , Análise de Sequência de RNA , Tylenchoidea/citologia , Tylenchoidea/crescimento & desenvolvimentoRESUMO
BACKGROUND: There are different and inconsistent conclusions regarding the genetic relationship between the human tumor suppressor p53 (TP53) rs1042522 polymorphism and the risk of oral squamous cell carcinoma (OSCC) and oral leukoplakia (OL). Therefore, the aim of the study was to comprehensively reassess this association through the performance of an updated meta-analysis. METHODS: After searching the available databases, we systematically screened and included the eligible case-control studies, which contain the full genotype frequency data of the TP53 rs1042522 polymorphism for both OSCC/OL patients and the negative control groups. PA (P-value of the association test) and ORs (odd ratios) with their corresponding 95% CIs (confidence intervals) were calculated to quantitatively evaluate the influence of TP53 rs1042522 on the susceptibility of patients to OSCC or OL. RESULTS: In total, twenty eligible case-control articles were finally enrolled. Compared with the controls, no increased or decreased risk of OSCC was observed in the cases for six genetic models including allele C vs. G (PA = 0.741), carrier C vs. G (PA = 0.853), homozygote CC vs. GG (PA = 0.085), heterozygote GC vs. GG (PA = 0.882), dominant GC + CC vs. GG (PA = 0.969), and recessive CC vs. GG + GC (PA = 0.980). Furthermore, no statistically significant difference between the cases and controls was detected in most subgroup meta-analyses (PA > 0.05). For the risk of OL, we did not observe the difference between the cases and controls for most genetic models in the overall meta-analysis and subsequent subgroup analysis (PA > 0.05). Begg's test and Egger's test excluded the large risk of publication bias within the included studies in the meta-analysis of OSCC. The sensitivity analysis indicated the above relatively stable results. CONCLUSIONS: Our updated meta-analysis (based on the current evidence) shows that TP53 rs1042522 may not confer susceptibility to OSCC. In addition, for the first time, we provided evidence regarding the negative association between TP53 rs1042522 and OL risk.
Assuntos
Carcinoma de Células Escamosas/genética , Predisposição Genética para Doença , Leucoplasia Oral/genética , Neoplasias Bucais/genética , Polimorfismo de Nucleotídeo Único , Proteína Supressora de Tumor p53/genética , HumanosRESUMO
Cereal cyst nematodes (Heterodera avenae and H. filipjevi) and root lesion nematodes (Pratylenchus spp.) have been found to infect cereals in 16 provinces of China. To develop a nematicide that effectively controls nematodes, two novel chemical products, methylene bis thiocyanate (MBT) and MBT + thiamethoxam (MTT); four common pesticides, fipronil + chlorpyrifos (FIC), emamectin benzoate, imidacloprid, and Bacillus thuringiensis; and one fungicide, iprodione, were tested as seed coatings for the control of cereal cysts and root lesion nematodes from 2013 to 2015. Wheat seeds were treated with these seven seed coatings before sowing, and changes in the numbers of Heterodera spp. and Pratylenchus spp. were recorded during three different growth stages. Wheat yields were also compared after harvest. All treatments reduced the numbers of Pratylenchus in wheat and of cysts and eggs of Heterodera in the soil compared with the untreated control. Among the treatments, application of MTT or FIC was more effective than that of the other treatments for nematode control, and the other treatments had similar effects. The results of this study have demonstrated that MTT and FIC applied as seed treatments effectively reduce the number of cysts, inhibit the reproduction of Heterodera and Pratylenchus, and enhance wheat yields. MTT and FIC are thus suitable for controlling nematodes on wheat under natural field conditions.