Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 82
Filtrar
Mais filtros

Bases de dados
Tipo de documento
Intervalo de ano de publicação
1.
Hematol Oncol ; 42(3): e3274, 2024 May.
Artigo em Inglês | MEDLINE | ID: mdl-38711253

RESUMO

Venetoclax, a highly selective BCL-2 inhibitor, combined with hypomethylating agents (HMAs) azacitidine or decitabine, is approved for the treatment of newly diagnosed acute myeloid leukemia (ND AML) in patients who are ineligible to receive intensive chemotherapy. Previous clinical studies initiated venetoclax plus HMA in an inpatient setting owing to concerns of tumor lysis syndrome (TLS). This study (NCT03941964) evaluated the efficacy and safety of venetoclax plus HMA in a United States community-based outpatient setting in patients with ND AML (N = 60) who were treatment naïve for AML, ineligible to receive intensive chemotherapy, had no evidence of spontaneous TLS at screening, and were deemed as appropriate candidates for outpatient initiation of venetoclax plus HMA by the investigator. Patients received venetoclax in combination with azacitidine (75 mg/m2) or decitabine (20 mg/m2) for up to 6 cycles during the study. With a median time on study of 18.3 weeks, the best response rate of composite complete remission was 66.7%, and the overall post-baseline red blood cell (RBC) and platelet transfusion independence rate was 55.0%, consistent with results of studies in which treatment was initiated in an inpatient setting. Key adverse events included nausea, anemia, thrombocytopenia, neutropenia, and white blood cell count decrease of any grade (≥50% of patients). The observed safety profile was generally consistent with that of venetoclax plus HMA observed in inpatient AML studies. With close monitoring, 2 cases of TLS were identified, appropriately managed, and the patients were able to continue study treatment. CLINICAL TRIALS REGISTRATION: This study is registered at ClinicalTrials.gov. The registration identification number is NCT03941964.


Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica , Azacitidina , Compostos Bicíclicos Heterocíclicos com Pontes , Decitabina , Leucemia Mieloide Aguda , Sulfonamidas , Humanos , Sulfonamidas/administração & dosagem , Sulfonamidas/uso terapêutico , Sulfonamidas/efeitos adversos , Azacitidina/administração & dosagem , Azacitidina/uso terapêutico , Azacitidina/efeitos adversos , Leucemia Mieloide Aguda/tratamento farmacológico , Compostos Bicíclicos Heterocíclicos com Pontes/uso terapêutico , Compostos Bicíclicos Heterocíclicos com Pontes/administração & dosagem , Compostos Bicíclicos Heterocíclicos com Pontes/efeitos adversos , Decitabina/administração & dosagem , Decitabina/uso terapêutico , Decitabina/efeitos adversos , Feminino , Masculino , Idoso , Pessoa de Meia-Idade , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Idoso de 80 Anos ou mais , Adulto , Pacientes Ambulatoriais
2.
Theor Appl Genet ; 136(11): 221, 2023 Oct 11.
Artigo em Inglês | MEDLINE | ID: mdl-37819543

RESUMO

KEY MESSAGE: A 4.43-Kb structural variation in the sesame genome results in the deletion of the Siofp1 gene and induces the long capsule length trait. Capsule length (CL) has a positive effect on seed weight and yield in various agronomically important species; however, the molecular mechanism underlying long capsule trait regulation in sesame remains unknown. The inheritance analysis showed that long capsule traits (CL > 4.0 cm) were dominant over normal length (average CL = 3.0 cm) and were controlled by a single gene pair. Association mapping with a RIL population and 259 natural sesame germplasm accessions indicated that the target interval was 52,830-730,961 bp of SiChr.10 in sesame. Meanwhile, the structural variation (SV) of the association mapping revealed that only SV_414325 on chromosome 10 was significantly associated with the CL trait, with a P value of 1.1135E-19. SV_414325 represents a 4430-bp deletion from 414,325 to 418,756 bp on SiChr.10, covering Sindi_2155000 (named SiOFP1). In the normal length type, Siofp1 encodes 411 amino acids of the ovate family proteins and is highly expressed in the leaf, stem, bud, and capsule tissues of sesame. In accordance with the transcriptional repressor character, Siofp1 overexpression in transgenic Arabidopsis (T0 and T1 generations) induced a 25-39% greater shortening of silique length than the wild type (P < 0.05), as well as round cauline leaves and short carpels. These results confirm that SiOFP1 plays a key role in regulating CL trait in sesame and other flowering plants. These findings provide a theoretical and material basis for sesame capsule development and high-yield breeding research.


Assuntos
Sesamum , Sesamum/genética , Mapeamento Cromossômico/métodos , Melhoramento Vegetal , Fenótipo , Padrões de Herança
3.
J Korean Med Sci ; 38(44): e345, 2023 Nov 13.
Artigo em Inglês | MEDLINE | ID: mdl-37967874

RESUMO

BACKGROUND: Although most elderly patients with acute myeloid leukemia (AML) are ineligible for intensive chemotherapy (ICT), treatment options remain limited. CURRENT (UMIN000037786), a real-world, non-interventional, retrospective chart review, evaluated clinical outcomes, clinicopathologic characteristics, and treatment patterns in these patients. We present results from a subanalysis of Korean patients in this study. METHODS: Patients were aged ≥ 18 years with primary or secondary AML ineligible for ICT who initiated first-line systemic therapy or best supportive care (BSC) between 2015 and 2018 across four centers in Korea. Primary endpoint was overall survival (OS) from diagnosis. Secondary endpoints included progression-free survival (PFS), time to treatment failure, and response rates. Data analyses were primarily descriptive, with time-to-event outcomes estimated using the Kaplan-Meier method, and Cox regression used to determine prognostic factors for survival. RESULTS: Among 194 patients enrolled, 84.0% received systemic therapy and 16.0% received BSC. Median age at diagnosis was 74 and 78 years, and Eastern Cooperative Oncology Group (ECOG) performance status 0 or 1 was reported in 73.0% and 48.4% of patients, respectively; poor cytogenetic risk was reported in 30.1% and 16.1% of patients. Median OS was 7.83 vs. 4.50 months, and median PFS was 6.73 vs. 4.50 months in the systemic therapy vs. BSC groups. Prognostic factors affecting OS included secondary AML (hazard ratio, 1.67 [95% confidence interval, 1.13-2.45]), ECOG performance status ≥ 2 (2.41 [1.51-3.83]), poor cytogenetic risk (2.10 [1.36-3.24]), and Charlson comorbidity index ≥ 1 (2.26 [1.43-3.58]). CONCLUSION: Clinical outcomes are poor in Korean patients with AML ineligible for ICT who are prescribed current systemic therapies or BSC. There is a substantial unmet need for novel agents (monotherapy or in combination) to improve clinical outcomes in this patient population.


Assuntos
Leucemia Mieloide Aguda , Idoso , Humanos , Estudos Retrospectivos , Leucemia Mieloide Aguda/tratamento farmacológico , Modelos de Riscos Proporcionais , Intervalo Livre de Progressão , República da Coreia , Resultado do Tratamento , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos
4.
Eur J Haematol ; 109(1): 58-68, 2022 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-35298049

RESUMO

OBJECTIVES: This retrospective chart review examined real-world healthcare resource utilization (HRU) in patients with AML ineligible for intensive therapy who received first-line systemic therapy or best supportive care (BSC). METHODS: Data were collected anonymously on patients with AML who initiated first-line hypomethylating agents (HMA), low-dose cytarabine (LDAC), other systemic therapy, or BSC. HRU endpoints included hospitalizations, outpatient consultations, transfusions, and supportive care. RESULTS: Of 1762 patients included, 46% received HMA, 11% received LDAC, 17% received other systemic therapy, 26% received BSC; median treatment durations were 118, 35, 33, and 57 days, respectively. Most patients were hospitalized, most commonly for treatment administration, transfusion, or infection (HMA 82%, LDAC 93%, other systemic therapy 83%, BSC 83%). A median number of hospitalizations were 2-6 across systemic groups and two for BSC, with median durations of 8-18 days. Transfusion rates and outpatient consultations were highest for HMA (80% and 79%) versus LDAC (57% and 53%), other systemic therapy (57% and 63%), and BSC (71% and 66%). Antivirals/antibiotics and antifungals were used more frequently than growth factors (72-92%, 34-63%, and 7-27%, respectively). CONCLUSION: Patients with AML ineligible for intensive therapy have high HRU; novel therapies are needed to alleviate this burden.


Assuntos
Leucemia Mieloide Aguda , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Citarabina , Humanos , Leucemia Mieloide Aguda/diagnóstico , Leucemia Mieloide Aguda/tratamento farmacológico , Leucemia Mieloide Aguda/epidemiologia , Aceitação pelo Paciente de Cuidados de Saúde , Estudos Retrospectivos
5.
Int J Mol Sci ; 22(23)2021 Nov 29.
Artigo em Inglês | MEDLINE | ID: mdl-34884723

RESUMO

This study aimed to characterize different natural killer (NK) cell phenotypes on bone marrow and peripheral blood cells from acute myeloid leukemia (AML) patients and healthy donors (HDs). Our data show that CD56dimCD16- and CD56brightCD16- NK cells represent the predominant NK cell subpopulations in AML, while the CD56dimCD16+ NK cells are significantly reduced compared to HDs. Moreover, TIGIT+ and PVRIG+ cells cluster on the CD56dimCD16+ subset whereas CD39+ and CD38+ cells do so on CD56brightCD16- NK cells in AML. Furthermore, functional effects of (co-)blockade of TIGIT and CD39 or A2AR on NK cell functionality were analyzed. These experiments revealed that the single blockade of the TIGIT receptor results in an increased NK-92 cell-mediated killing of AML cells in vitro. Combined targeting of CD39 or A2AR significantly augments the anti-TIGIT-mediated lysis of AML cells. Our data indicate that distinct NK cell subsets in AML exhibit different immunosuppressive patterns (via the TIGIT/PVRIG receptors and the purinergic pathway). In summary, we conclude that TIGIT, CD39, and A2AR constitute relevant inhibitory checkpoints of NK cells in AML patients. A combinatorial blockade synergistically strengthens NK-92 cell-mediated cytotoxicity. As inhibitors of TIGIT, CD39, and A2AR are clinically available, studies on their combined use could be conducted in the near future.


Assuntos
Apirase/metabolismo , Células Matadoras Naturais/metabolismo , Leucemia Mieloide Aguda/imunologia , Receptor A2A de Adenosina/metabolismo , Receptores Imunológicos/metabolismo , Adulto , Idoso , Idoso de 80 Anos ou mais , Apirase/antagonistas & inibidores , Estudos de Casos e Controles , Humanos , Imunoterapia , Leucemia Mieloide Aguda/terapia , Pessoa de Meia-Idade , Receptores Imunológicos/antagonistas & inibidores , Adulto Jovem
6.
Theor Appl Genet ; 133(1): 73-86, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31686114

RESUMO

KEY MESSAGE: SiDWF1 encodes a gibberellin receptor GID1B-like protein controlling the internode length and plant height in sesame. Sesame is a high-height crop. Here we systematically analyzed the morphological and genetic characters of the sesame dwarf mutant dw607 (dwf1 type). The plant height and the internode length of dw607 significantly declined, while the thousand seed weight (TSW) significantly increased (P < 0.01). The cell size of stem parenchyma and pith tissue reduced, and vascular bundle cells and parenchyma tissue arranged much tighter in the dwarf mutant. Based on the cross-population association mapping of a RIL population of the cross 'dw607 (dwf1) × 15N41 (wt type),' the target interval linked to the short internode length was located on C9.scaffold2 of SiChr.4 in sesame. We further screened the 58 variants using the genomic variant data of 824 germplasm and BSA DNA pools and determined the target gene Sidwf1. The SNP mutation of C1057 to T1057 resulted in the amino acid change of P150 (proline) to S150 (serine) in SiDWF1. SiDWF1 gene allele is 1,638 bp and encodes a gibberellin receptor GID1B-like protein. Transcription profile assay reflected that Sidwf1 is highly expressed in leaf, stem, bud, and capsule tissues. The dynamic variation in endogenous GA3 content in dw607 and the wild type was also monitored in this study. The results revealed the molecular genetic mechanism of the internode length and plant height trait in sesame for the first time. The findings supply the theoretical and material basis for developing the marker-assisted selection (MAS) breeding in sesame.


Assuntos
Genes de Plantas , Mutação/genética , Caules de Planta/anatomia & histologia , Caules de Planta/genética , Característica Quantitativa Herdável , Sesamum/anatomia & histologia , Sesamum/genética , Alelos , Sequência de Aminoácidos , Cruzamentos Genéticos , Regulação da Expressão Gênica de Plantas , Testes Genéticos , Genótipo , Giberelinas/metabolismo , Padrões de Herança/genética , Fenótipo , Filogenia , Proteínas de Plantas/química , Proteínas de Plantas/genética , Caules de Planta/citologia , Homologia de Sequência de Aminoácidos
7.
Phytopathology ; 110(5): 1093-1104, 2020 May.
Artigo em Inglês | MEDLINE | ID: mdl-32065037

RESUMO

Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1α gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame.


Assuntos
Fusarium , China , Filogenia , Doenças das Plantas , Virulência
8.
BMC Plant Biol ; 19(1): 588, 2019 Dec 27.
Artigo em Inglês | MEDLINE | ID: mdl-31881840

RESUMO

BACKGROUND: Sesame (Sesamum indicum L., 2n = 2x = 26) is an important oilseed crop with high oil content but small seed size. To reveal the genetic loci of the quantitative seed-related traits, we constructed a high-density single nucleotide polymorphism (SNP) linkage map of an F2 population by using specific length amplified fragment (SLAF) technique and determined the quantitative trait loci (QTLs) of seed-related traits for sesame based on the phenotypes of F3 progeny. RESULTS: The genetic map comprised 2159 SNP markers distributed on 13 linkage groups (LGs) and was 2128.51 cM in length, with an average distance of 0.99 cM between adjacent markers. QTL mapping revealed 19 major-effect QTLs with the phenotypic effect (R2) more than 10%, i.e., eight QTLs for seed coat color, nine QTLs for seed size, and two QTLs for 1000-seed weight (TSW), using composite interval mapping method. Particularly, LG04 and LG11 contained collocated QTL regions for the seed coat color and seed size traits, respectively, based on their close or identical locations. In total, 155 candidate genes for seed coat color, 22 for seed size traits, and 54 for TSW were screened and analyzed. CONCLUSIONS: This report presents the first QTL mapping of seed-related traits in sesame using an F2 population. The results reveal the location of specific markers associated with seed-related traits in sesame and provide the basis for further seed quality traits research.


Assuntos
Cromossomos de Plantas , Sesamum/genética , Análise do Polimorfismo de Comprimento de Fragmentos Amplificados , Mapeamento Cromossômico/métodos , Marcadores Genéticos , Genótipo , Fenótipo , Polimorfismo de Nucleotídeo Único , Locos de Características Quantitativas , Sementes/genética , Sesamum/crescimento & desenvolvimento
9.
Plant Biotechnol J ; 17(5): 956-968, 2019 05.
Artigo em Inglês | MEDLINE | ID: mdl-30451367

RESUMO

Calcineurin B-like interacting protein kinase (CIPKs) has been shown to be required for biotic stress tolerance of plants in plant-pathogen interactions. However, the roles of CIPKs in immune signalling of cereal crops and an in-depth knowledge of substrates of CIPKs in response to biotic stress are under debate. In this study, we identified and cloned a CIPK homologue gene TaCIPK10 from wheat. TaCIPK10 was rapidly induced by Puccinia striiformis f. sp. tritici (Pst) inoculation and salicylic acid (SA) treatment. In vitro phosphorylation assay demonstrated that the kinase activity of TaCIPK10 is regulated by Ca2+ and TaCBL4. Knockdown TaCIPK10 significantly reduced wheat resistance to Pst, whereas TaCIPK10 overexpression resulted in enhanced wheat resistance to Pst by the induction of defense response in different aspects, including hypersensitive cell death, ROS accumulation and pathogenesis-relative genes expression. Moreover, TaCIPK10 physically interacted with and phosphorylated TaNH2, which was homologous to AtNPR3/4. Silencing of TaNH2 in wheat resulted in enhanced susceptibility to the avirulent Pst race, CYR23, indicating its positive role in wheat resistance. Our results demonstrate that TaCIPK10 positively regulate wheat resistance to Pst as molecular links between of Ca2+ and downstream components of defense response and TaCIPK10 interacts with and phosphorylates TaNH2 to regulate wheat resistance to Pst.


Assuntos
Basidiomycota , Resistência à Doença , Imunidade Vegetal , Proteínas de Plantas/fisiologia , Triticum/microbiologia , Cálcio/metabolismo , Técnicas de Silenciamento de Genes , Fosforilação , Proteínas de Plantas/metabolismo , Plantas Geneticamente Modificadas , Triticum/genética , Triticum/imunologia
10.
Int J Mol Sci ; 20(16)2019 Aug 20.
Artigo em Inglês | MEDLINE | ID: mdl-31434218

RESUMO

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.


Assuntos
Proteínas de Plantas/metabolismo , Sementes/metabolismo , Sesamum/metabolismo , Éxons/genética , Regulação da Expressão Gênica de Plantas/genética , Pleiotropia Genética/genética , Pleiotropia Genética/fisiologia , Ácidos Indolacéticos/metabolismo , Íntrons/genética , Mutação , Proteínas de Plantas/genética , Polimorfismo de Nucleotídeo Único/genética , Sementes/genética , Sesamum/genética
11.
BMC Plant Biol ; 18(1): 296, 2018 Nov 22.
Artigo em Inglês | MEDLINE | ID: mdl-30466401

RESUMO

BACKGROUND: Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. RESULTS: For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553-6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. CONCLUSIONS: SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.


Assuntos
Frutas/genética , Genes de Plantas , Folhas de Planta/genética , Sesamum/genética , Alelos , Mapeamento Cromossômico , Cromossomos de Plantas , Clonagem Molecular , DNA de Plantas , Frutas/crescimento & desenvolvimento , Genes Recessivos , Variação Genética , Padrões de Herança , Mutação , Folhas de Planta/crescimento & desenvolvimento , Proteínas de Plantas/genética , Proteínas Repressoras/genética , Análise de Sequência de DNA , Transcriptoma
12.
J Exp Bot ; 69(18): 4443-4457, 2018 08 14.
Artigo em Inglês | MEDLINE | ID: mdl-29931351

RESUMO

Calcineurin B-like proteins (CBLs) act as Ca2+ sensors to activate specific protein kinases, namely CBL-interacting protein kinases (CIPKs). Recent research has demonstrated that the CBL-CIPK complex is not only required for abiotic stress signaling, but is also probably involved in biotic stress perception. However, the role of this complex in immune signaling, including pathogen perception, is unknown. In this study, we isolated one signaling component of the TaCBL-TaCIPK complex (TaCBL4-TaCIPK5) and characterized its role in the interaction between wheat (Triticum aestivum) and Puccinia striiformis f. sp. tritici (Pst, stripe rust fungus). Among all TaCBLs in wheat, TaCBL4 mRNA accumulation markedly increased after infection by Pst. Silencing of TaCBL4 resulted in enhanced susceptibility to avirulent Pst infection. In addition, screening determined that TaCIPK5 physically interacted with TaCBL4 in planta and positively contributed to wheat resistance to Pst. Moreover, the disease resistance phenotype of TaCBL4 and TaCIPK5 co-silenced plants was consistent with that of single-knockdown plants. The accumulation of reactive oxygen species (ROS) was significantly altered in all silenced plants during Pst infection. Together these findings demonstrate that the TaCBL4-TaCIPK5 complex positively modulates wheat resistance in a ROS-dependent manner, and provide new insights into the roles of CBL-CIPK in wheat.


Assuntos
Basidiomycota/fisiologia , Resistência à Doença/genética , Doenças das Plantas/microbiologia , Proteínas de Plantas/genética , Triticum/genética , Cálcio/metabolismo , Regulação da Expressão Gênica de Plantas , Proteínas de Plantas/metabolismo , Triticum/metabolismo , Triticum/microbiologia
13.
Pharmacoepidemiol Drug Saf ; 27(3): 340-348, 2018 03.
Artigo em Inglês | MEDLINE | ID: mdl-29316005

RESUMO

PURPOSE: Clinicians use tamsulosin, an α1-adrenoceptor antagonist, to manage symptomatic benign prostatic hyperplasia (BPH). Because α1-adrenoceptors are also present in the brain, the potential exists for adverse effects on cognitive functions. We explored the association between tamsulosin use and dementia risk. METHODS: We used Medicare data (2006-2012) to conduct a cohort study among patients aged ≥65 years and diagnosed with BPH. Men taking tamsulosin (n = 253 136) were matched at a 1:1 ratio using propensity-scores to each of 6 comparison cohorts: patients who used no BPH-medication (n = 180 926), and patients who used the following alternative-BPH-medications: doxazosin (n = 28 581), terazosin (n = 23 858), alfuzosin (n = 17 934), dutasteride (n = 34 027), and finasteride (n = 38 767). Assessment began following the first fill of BPH-medication to identify incident dementia by ICD-9 diagnosis codes. We estimated hazard ratios (HR) and 95% confidence intervals (CI) for dementia using Cox proportional hazard regression for each of the 6 propensity-score-matched cohort-pairs. RESULTS: The median follow-up period for all cohorts was 19.8 months. After propensity-score matching, the tamsulosin cohort had an incidence of dementia of 31.3/1000 person-years compared with only 25.9/1000 person-years in the no-BPH-medication cohort. The risk of dementia was significantly higher in the tamsulosin cohort, when compared with the no-BPH-medication cohort (HR [95% CI]: 1.17 [1.14, 1.21]) and each of the alternative-BPH-medication cohorts: doxazosin (1.20 [1.12, 1.28]), terazosin (1.11 [1.04, 1.19]), alfuzosin (1.12 [1.03, 1.22]), dutasteride (1.26 [1.19, 1.34]), and finasteride (1.13 [1.07, 1.19]). The significance of these findings persisted in sensitivity analyses. CONCLUSION: Tamsulosin may increase the risk of dementia in older men with BPH.


Assuntos
Inibidores de 5-alfa Redutase/administração & dosagem , Antagonistas de Receptores Adrenérgicos alfa 1/efeitos adversos , Demência/epidemiologia , Hiperplasia Prostática/tratamento farmacológico , Tansulosina/efeitos adversos , Inibidores de 5-alfa Redutase/efeitos adversos , Antagonistas de Receptores Adrenérgicos alfa 1/administração & dosagem , Fatores Etários , Idoso , Idoso de 80 Anos ou mais , Demência/induzido quimicamente , Dutasterida/administração & dosagem , Dutasterida/efeitos adversos , Finasterida/administração & dosagem , Finasterida/efeitos adversos , Seguimentos , Humanos , Incidência , Masculino , Medicare/estatística & dados numéricos , Estudos Retrospectivos , Fatores de Risco , Tansulosina/administração & dosagem , Estados Unidos/epidemiologia
14.
Curr Urol Rep ; 19(9): 69, 2018 Jul 03.
Artigo em Inglês | MEDLINE | ID: mdl-29971698

RESUMO

PURPOSE OF REVIEW: Lower urinary tract symptoms (LUTS) result from age-related changes in detrusor function and prostatic growth that are driven by alterations in the ratio of circulating androgens and estrogens. Alpha-adrenergic receptor blockers are commonly used to treat LUTS because they influence urethral tone and intra-urethral pressure. Molecular cloning studies have identified three α1-adrenergic receptor subtypes (α1A, α1B, and α1D). The α1A subtype is predominant in the human prostate but is also present in many parts of the brain that direct cognitive function. Tamsulosin is the most widely used α1-adrenergic receptor antagonist with 12.6 million prescriptions filled in 2010 alone. When compared to the other common types of α1-adrenergic receptor antagonists (i.e., terazosin, doxazosin, and alfuzosin), tamsulosin is 10- to 38-fold more selective for the α1A versus the α1B subtype. RECENT FINDINGS: Duan et al. have recently shown that men taking tamsulosin have a higher risk of developing dementia when compared to men taking other α-adrenergic antagonists or no α-adrenergic antagonists at all (HR 1.17; 95% CI 1.14-1.21). Based upon this retrospective analysis, we believe that tamsulosin, because of its unique affinity for α1A-adrenergic receptors, may increase the risk of developing dementia when used for an extended period of time. If these findings are confirmed, they carry significant public health implications for an aging society.


Assuntos
Demência/induzido quimicamente , Sintomas do Trato Urinário Inferior/tratamento farmacológico , Sulfonamidas/efeitos adversos , Agentes Urológicos/efeitos adversos , Antagonistas de Receptores Adrenérgicos alfa 1/efeitos adversos , Antagonistas de Receptores Adrenérgicos alfa 1/farmacologia , Antagonistas de Receptores Adrenérgicos alfa 1/uso terapêutico , Idoso , Encéfalo/efeitos dos fármacos , Cognição/efeitos dos fármacos , Cognição/fisiologia , Humanos , Sulfonamidas/uso terapêutico , Tansulosina , Agentes Urológicos/farmacologia , Agentes Urológicos/uso terapêutico
15.
Violence Vict ; 33(2): 259-274, 2018 04 01.
Artigo em Inglês | MEDLINE | ID: mdl-29609675

RESUMO

This study compared severity of physical violence, intimate partner violence (IPV)-related injury, and lifetime diagnoses of psychiatric disorders among women in relationships with bidirectional, unidirectional, or no IPV. The sample includes 763 low-income women from community-based family planning clinics. Results showed that women in relationships with bidirectional IPV were more likely to experience severe physical violence and severe IPV-related injury compared to women in the unidirectional IPV category. These women were also more likely to be diagnosed with drug abuse and depression than women in relationships without IPV. Similarly, women in the bidirectional IPV category were more likely to be diagnosed with drug abuse when compared to women in the victim-only unidirectional IPV category. Recommendations for health-care providers are discussed.


Assuntos
Vítimas de Crime , Relações Interpessoais , Violência por Parceiro Íntimo , Transtornos Mentais , Abuso Físico , Pobreza , Ferimentos e Lesões/etiologia , Adolescente , Adulto , Depressão , Transtorno Depressivo , Feminino , Humanos , Masculino , Transtornos Relacionados ao Uso de Substâncias , Adulto Jovem
16.
Crit Care Med ; 45(9): 1515-1522, 2017 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-28622167

RESUMO

OBJECTIVES: To examine the association between statin use and the risk of delirium in hospitalized patients with an admission to the medical ICU. DESIGN: Retrospective propensity-matched cohort analysis with accrual from September 1, 2012, to September 30, 2015. SETTING: Hartford Hospital, Hartford, CT. PATIENTS: An initial population of patients with an admission to a medical ICU totaling 10,216 visits were screened for delirium by means of the Confusion Assessment Method. After exclusions, a population of 6,664 was used to match statin users and nonstatin users. The propensity-matched cohort resulted in a sample of 1,475 patients receiving statin matched 1:1 with control patients not using statin. INTERVENTIONS: None. MEASUREMENTS AND MAIN RESULTS: Delirium defined as a positive Confusion Assessment Method assessment was the primary end point. The prevalence of delirium was 22.3% in the unmatched cohort and 22.8% in the propensity-matched cohort. Statin use was associated with a significant decrease in the risk of delirium (odds ratio, 0.47; 95% CI, 0.38-0.56). Considering the type of statin used, atorvastatin (0.51; 0.41-0.64), pravastatin (0.40; 0.28-0.58), and simvastatin (0.33; 0.21-0.52) were all significantly associated with a reduced frequency of delirium. CONCLUSIONS: The use of statins was independently associated with a reduction in the risk of delirium in hospitalized patients. When considering types of statins used, this reduction was significant in patients using atorvastatin, pravastatin, and simvastatin. Randomized trials of various statin types in hospitalized patients prone to delirium should validate their use in protection from delirium.


Assuntos
Delírio/prevenção & controle , Inibidores de Hidroximetilglutaril-CoA Redutases/administração & dosagem , Unidades de Terapia Intensiva/estatística & dados numéricos , Idoso , Atorvastatina/administração & dosagem , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Razão de Chances , Pravastatina/administração & dosagem , Pontuação de Propensão , Reprodutibilidade dos Testes , Estudos Retrospectivos , Sinvastatina/administração & dosagem
20.
J Asian Nat Prod Res ; 17(5): 519-31, 2015 May.
Artigo em Inglês | MEDLINE | ID: mdl-26043754

RESUMO

Cochinchinones M-U (1-9), together with 12 known compounds (10-21), were isolated from the stems of Cratoxylum cochinchinense (Lour.) Blume. Their structures were determined on the basis of extensive spectroscopic data analyses. In addition, their retinoid X receptor-α transcriptional activities were evaluated using an in vitro assay.


Assuntos
Clusiaceae/química , Medicamentos de Ervas Chinesas/isolamento & purificação , Medicamentos de Ervas Chinesas/farmacologia , Receptor X Retinoide alfa/efeitos dos fármacos , Xantonas/isolamento & purificação , Xantonas/farmacologia , Medicamentos de Ervas Chinesas/química , Humanos , Luciferases de Vaga-Lume/metabolismo , Estrutura Molecular , Caules de Planta/química , Prenilação , Xantonas/química
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA