RESUMO
Morocco is considered as an important producer of fish with more than one million tons of small pelagic fish caught per year, along more than 3400 km of coastline. Otherwise, few studies have investigated the zoonotic parasites of fish. The purpose of this study is to determine the prevalence of Anisakis nematodes larvae in two fish species, namely sardines Sardina pilchardus and mackerel Scomber scombrus. These two species are widely consumed in Marrakesh due to their availability and their affordable prices. A total of 948 fish, including 546 sardines and 402 mackerel, were purchased from the wholesale market of Marrakesh, from January 2016 to December 2018. Sampling was performed on the days of fish arrival from the fishing areas (Dakhla, Essaouira, Safi and Sidi Ifni). The samples were examined visually for the presence of Anisakis larvae. We obtained a prevalence of 8.4% in mackerel with different rates depending on their origins (Safi: 13.23%; Essaouira: 11.66%; Sidi Ifni: 2.5%; Dakhla: 0%) and the seasons. However, no larvae were detected in the sardines after meticulous visual inspection. The detected larvae were morphologically and genetically identified. We identified the larvae by the PCR-RFLP technique using the primers LSU5-F (TAGGTCGACCCGCTGAAYTTAAGCA) and IR16-R (ATTCACACCCATTGACTCGCG) from the 28S rDNA region. The analysis showed that all larvae belong to Anisakis simplex sensu-stricto (s.s.). According to our results mackerel presents a higher risk of contamination than sardine, while statistical studies show that there is no impact of season and fishing origin on the prevalence.
Assuntos
Anisakis/isolamento & purificação , Larva , Perciformes/parasitologia , Animais , Peixes/parasitologia , Marrocos , Alimentos Marinhos/parasitologia , Estações do AnoRESUMO
One of the ways of human parasitic infection is the accidental ingestion of vegetables contaminated with parasites, which represents a major human health hazard. This non-exhaustive review aims to evaluate studies carried out on five types of vegetables (lettuce, parsley, coriander, carrot and radish) since 2000, particularly the methods used for recovery, concentration, detection and identification of protozoan parasites such as Toxoplasma gondii, Giardia duodenalis and Cryptosporidium spp., and the results of each work. Various studies have determined the presence of pathogenic parasites in fresh vegetables with different rates; this variation in rate depends particularly on the detection method used which is related to each parasite and each vegetable type. The variation in parasitic prevalence in food could be due to different factors such as the geographical location, the size of analysed samples and the methods used for parasite detection.
Assuntos
Contaminação de Alimentos , Doenças Parasitárias/transmissão , Verduras/parasitologia , Animais , Criptosporidiose/transmissão , Cryptosporidium/isolamento & purificação , Giardia/isolamento & purificação , Giardíase/transmissão , Parasitos/isolamento & purificação , Prevalência , Toxoplasma/isolamento & purificação , Toxoplasmose/transmissãoRESUMO
Malaria has become a major public health problem in Mauritania since the 1990s, with an average of 181,000 cases per year and 2,233,066 persons at risk during 1995-2012. This paper provides the first publicly available overview of malaria incidence and distribution in Mauritania. Information on the burden and malaria species distribution is critical for guiding national efforts in malaria control. As the incidence of malaria changes over time, regular updates of epidemiological data are necessary.
Assuntos
Malária/epidemiologia , Adolescente , Adulto , Idoso , Feminino , Humanos , Incidência , Masculino , Mauritânia/epidemiologia , Pessoa de Meia-Idade , Estudos Prospectivos , Estudos Retrospectivos , Adulto JovemRESUMO
The association between the parasitic illnesses and the consumption of contaminated water has been largely reported. However, there is still a lack of studies investigating the extent of parasitic contamination in water in Morocco. This is the first study in Morocco that aimed at assessing the presence of protozoan parasites, namely Cryptosporidium spp., Giardia duodenalis, and Toxoplasma gondii, in drinking water consumed in the region of Marrakech. Samples processing was performed by membrane filtration and qPCR detection. A total of 104 drinking water samples (tap water, well, and spring waters) was collected between 2016 and 2020. The analysis revealed an overall protozoa contamination rate of 67.3% (70/104), of which 35 samples were positive for Giardia duodenalis, 18 for Toxoplasma gondii, and 17 for both parasites, whereas no sample was positive for Cryptosporidium spp. This first study showed that drinking water in the region of Marrakech contained parasites which could represent a risk for consumers. For a better understanding and estimation of the risk encountered by local inhabitants, further studies concerned with (oo)cyst viability, infectivity, and genotype identification need to be performed.
Assuntos
Criptosporidiose , Cryptosporidium , Água Potável , Giardia lamblia , Giardíase , Toxoplasma , Humanos , Marrocos , Giardíase/parasitologiaRESUMO
PURPOSE: The aim of this study was to assess the presence of T. gondii, Cryptosporidium spp. oocysts, and G. duodenalis cysts, in three leafy greens (coriander, lettuce, and parsley) commonly consumed raw. Despite the recognition of the association between the parasitic illnesses and the consumption of contaminated food, there is still a lack of studies investigating the occurrence of parasitic contamination in food matrices. METHODS: A total of 152 leafy green samples were collected in Marrakech from April 2018 to October 2019. Parasites were eluted and concentrated before detection of their DNA by real-time qPCR. RESULTS: The analysis revealed an overall rate of contamination of 32.2% (49/152), with 29.6% (45/152) positive for T. gondii and 2.6% (4/152) for G. duodenalis, while none was positive for Cryptosporidium spp. CONCLUSION: The results showed that humans can be exposed to protozoan parasites through vegetables consumption. Further investigations can be performed to acquire new epidemiological data to assess the public health impact of these protozoan diseases in Morocco.
Assuntos
Criptosporidiose , Cryptosporidium , Giardíase , Parasitos , Toxoplasma , Animais , Cryptosporidium/genética , DNA de Protozoário/genética , Giardíase/parasitologia , Humanos , Oocistos , Parasitos/genética , Toxoplasma/genéticaRESUMO
BACKGROUND: Protozoan parasites such as Toxoplasma gondii, Giardia duodenalis, and Cryptosporidium spp., can be transmitted to humans via accidental consumption of contaminated water, fresh produce and foodstuffs. There is a lack of epidemiological data about these pathogens in Morocco. Hence the aim of this study, which is the determination of their prevalence in some leafy greens and root vegetables sold in Marrakech. METHODS: A total of 132 vegetable samples including carrot, coriander, lettuce, parsley and radish were purchased monthly from three different markets in Marrakech from March 2017 to January 2018, pre-treated and subjected to microscopic and molecular analyses. RESULTS: Of the 132 samples of vegetables analyzed by qPCR, the overall rate of protozoan was 21.21% (28/132); 22 samples were found to be contaminated with T. gondii, 6 with G. duodenalis, and none was positive for C. parvum/hominis. Whereas, modified Ziehl-Neelsen staining allowed the detection of Cryptosporidium spp. in 3% (4/132) of examined samples. CONCLUSION: This survey on the presence of protozoan parasites in fresh vegetables revealed that vegetables sold in Marrakech are contaminated by these protozoan parasites, as it showed that leafy green vegetables were more susceptible for parasitic contamination than root ones.
Assuntos
Cryptosporidium/isolamento & purificação , Contaminação de Alimentos/análise , Giardia lamblia/isolamento & purificação , Toxoplasma/isolamento & purificação , Verduras/parasitologia , Cryptosporidium/genética , Contaminação de Alimentos/estatística & dados numéricos , Giardia lamblia/genética , Humanos , Marrocos , Reação em Cadeia da Polimerase em Tempo Real , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Toxoplasma/genéticaRESUMO
BACKGROUND: Toxoplasmosis is a parasitic infection caused by an intracellular protozoan named Toxoplasma gondii. Its prevalence had been investigated in several studies throughout the world showing that it varied from one country to another. In contrast, few studies had been carried out on this infection across the kingdom of Morocco, hence the objective of this work, which is the determination of Toxoplasma gondii seroprevalence in the region of Marrakech-Safi. METHODS: The serological results of a cohort of 5692 patients were reviewed retrospectively. Those patients had been into different public and private medical laboratories in the region of Marrakech-Safi for a toxoplasmosis serology, requested between the 1st January, 2014 and 31st December, 2016. According to each laboratory, the techniques adopted for this serology were ELISA (ELFA, MEIA, EIA) and CMIA. RESULTS: The results showed that for pregnant women, the overall seroprevalence in the study region were 28.88%. CONCLUSION: The variation of Toxoplasma gondii seroprevalence is related not only to climatic factors but also to lifestyle, eating habits, socio-economic status and hygiene conditions. In this study, we noticed that in Morocco, as in other countries, pregnant women encounter several difficulties when serologic screening for toxoplasmosis.