PI3K inhibition by BKM120 results in anti-proliferative effects on corticotroph tumor cells.

PURPOSE: Cushing's disease is associated with significant morbidity; thus, additional tumor-directed drugs with the potential to exert antineoplastic effects on corticotroph adenoma cells are desired. The phosphoinositide-3-kinase (PI3K)/protein kinase B (AKT) pathway, which plays regulatory role in cell survival and proliferation, is activated in pituitary adenomas. The present study evaluated the effects of BKM120 (Buparlisib), an oral PI3K inhibitor, on cell viability, apoptosis, cell cycle phase distribution, and ACTH production in mouse corticotroph tumor cells. METHODS: AtT-20/D16v-F2 mouse pituitary corticotroph tumor cells were treated with increasing concentrations of BKM120 or vehicle. Cell viability was measured using an MTS-based assay. Apoptosis was evaluated by Annexin V staining. Cell cycle analysis was performed by propidium iodide DNA staining and flow cytometry. Gene expression of cell cycle regulators (Cdkn1b, Ccnd1, Ccne1, Cdk2, Cdk4, Myc, and Rb1) was assessed by qPCR. Protein expression of p27, total and phosphorylated Akt was assessed by Western blot. ACTH levels were measured in the culture supernatants by chemiluminescent immunometric assay. RESULTS: Treatment with BKM120 decreased AtT-20/D16v-F2 cell viability, induced a G0/G1 cell cycle arrest, reduced the phosphorylation of Akt at Serine 473, and increased p27 expression. Furthermore, BKM120 treatment diminished ACTH levels in the cell culture supernatants. CONCLUSION: In vitro inhibition of PI3K/AKT pathway by BKM120 resulted in anti-proliferative effects on corticotroph tumor cells, decreasing cell viability and ACTH production. These encouraging findings shape the path for further experiments with the inhibition of PI3K/AKT pathway in Cushing's disease.

Suicide risk in people living with AIDS/HIV: the effect of childhood trauma is mediated by mental disorders and social vulnerability.

Suicide is an important problem in people living with HIV/AIDS (PLWHA). The importance of mental disorders and social vulnerability on suicidal behaviors is described in the literature; however, the impact of childhood traumatic events in this scenario is not clear. The aim of this study was to verify the mediation effect of mental disorder comorbidities and social vulnerability in association with childhood trauma intensity and suicide risk level. This cross-sectional study of HIV-positive outpatients was conducted in a specialized care service in the city of Pelotas in Southern Brazil. Sociodemographic data and HIV-related information were collected and the Childhood Trauma Questionnaire was applied. A total of 364 patients underwent psychiatric evaluation using MINI Plus including module C of suicide risk severity. Suicide risk was present in 39.3% of the sample. The relation between childhood traumatic events and the level of suicide risk is mediated by mental disorder comorbidities and socioeconomic vulnerability. Specific psychosocial interventions in PLWHA should consider the potential role of abusive traumatic experiences in the current mental health conditions and suicidal behaviors.

P27/CDKN1B Translational Regulators in Pituitary Tumorigenesis.

In pituitary tumors, P27(CDKN1B) is underexpressed. We aimed to clarify whether translational regulation underlies this phenomenon. This study evaluated the expression of P27/CDKN1B, its targets (CCNE1, CDK2) and translational regulators (DKC1, RPS13, miR221, miR222) and screened for DKC1 variants in sporadic pituitary adenomas. Samples were obtained during transsphenoidal surgery from 48 patients with pituitary adenomas: 10 ACTH-, 17 GH-secreting, and 21 nonfunctioning (NFPA). The control group comprised 7 normal pituitaries (NP) obtained during autopsies. Gene expression was assessed by RT-PCR and protein expression by immunohistochemistry. The 15 exons of DKC1 were sequenced. P27 protein underexpression was observed in all adenomas subtypes (p=0.001). CCNE1 mRNA (p=0.01) overexpression, but not protein, was observed in NFPA. No differential gene expression among groups was observed in CDKN1B regulators RPS13 (p=0.23) and DKC1 (p=0.34). The expression of miR221 and miR222 was similar among tumors and NP. Frequent DKC1 variants (SNPs) were found in exon 14 and in the 3'-UTR in similar frequency to NCBI-dsSNP databases. We also observed rare DKC1 variants in 11% of the studied tumor samples, indicating a high prevalence in pituitary adenomas, however, in silico studies failed to indicate deleterious effects. The high frequency of DKC1 variants may influence, in some extent, pituitary tumors development, without clear role in its tumorigenesis. Our data reinforce the P27 underexpression in pituitary adenomas and provide further evidence of the post-translational machinery involvement, although this phenomenon cannot be explained either by mis-expression of P27 translational regulators - DKC1, RPS13, miR221, miR222 - or directly by DKC1 mutations.

Telomere length and telomerase expression in pituitary tumors.

PURPOSE: Telomere dysfunction and telomerase activation underlie cancer transformation. This study aims to investigate the contribution of telomere biology to pituitary tumor behavior. SUBJECTS AND METHODS: Samples from 50 patients with pituitary tumors (11 ACTH-secreting, 18 GH-secreting, and 21 non-secreting tumors) and 7 subjects without pituitary lesions were collected. The expressions of telomerase essential components TERT and TERC and tumor telomere content were measured by quantitative PCR techniques. RESULTS: Telomerase (TERT) expression was detected in 36% of tumors. No correlation was observed between TERT and TERC expression level and tumor size in any tumor type. There was no association between gene expression and clinical findings. Telomere content (T/S ratio) was similar between pituitary adenomas (0.39 ± 0.16) and normal pituitaries (0.47 ± 0.12; p = 0.24) and also was between the different adenoma types: ACTH-secreting (0.43 ± 0.08), GH-secreting (0.31 ± 0.12), and non-secreting (0.42 ± 0.20; p = 0.10) tumors. CONCLUSIONS: The telomere content and expression of telomerase components are comparable between normal pituitary glands and tumor tissues, suggesting that telomere biology does not play an important role in pituitary tumor development.

Clostridium difficile toxins or infection induce upregulation of adenosine receptors and IL-6 with early pro-inflammatory and late anti-inflammatory pattern.

Clostridium difficile causes intestinal inflammation, which increases adenosine. We compared the expression of adenosine receptors (AR) subtypes A1, A2A, A2B, and A3 in HCT-8, IEC-6 cells, and isolated intestinal epithelial cells, challenged or not with Clostridium difficile toxin A and B (TcdA and TcdB) or infection (CDI). In HCT-8, TcdB induced an early A2BR expression at 6 h and a late A2AR expression at 6 and 24 h. In addition, both TcdA and TcdB increased IL-6 expression at all time-points (peak at 6 h) and PSB603, an A2BR antagonist, decreased IL-6 expression and production. In isolated cecum epithelial cells, TcdA induced an early expression of A2BR at 2s and 6 h, followed by a late expression of A2AR at 6 and 24 h and of A1R at 24 h. In CDI, A2AR and A2BR expressions were increased at day 3, but not at day 7. ARs play a role in regulating inflammation during CDI by inducing an early pro-inflammatory and a late anti-inflammatory response. The timing of interventions with AR antagonist or agonists may be of relevance in treatment of CDI.

A Brazilian regional basic diet-induced chronic malnutrition drives liver inflammation with higher ApoA-I activity in C57BL6J mice.

Malnutrition is still considered endemic in many developing countries. Malnutrition-enteric infections may cause lasting deleterious effects on lipid metabolism, especially in children living in poor settings. The regional basic diet (RBD), produced to mimic the Brazilian northeastern dietary characteristics (rich in carbohydrate and low in protein) has been used in experimental malnutrition models, but few studies have explored the effect of chronic RBD on liver function, a central organ involved in cholesterol metabolism. This study aimed to investigate whether RBD leads to liver inflammatory changes and altered reverse cholesterol metabolism in C57BL6/J mice compared to the control group, receiving a standard chow diet. To evaluate liver inflammation, ionized calcium-binding adapter protein-1 (IBA-1) positive cell counting, interleukin (IL)-1ß immunohistochemistry, and tumor necrosis factor (TNF)-α and IL-10 transcription levels were analyzed. In addition, we assessed reverse cholesterol transport by measuring liver apolipoprotein (Apo)E, ApoA-I, and lecithin-cholesterol acyltransferase (LCAT) by RT-PCR. Furthermore, serum alanine aminotransferase (ALT) was measured to assess liver function. RBD markedly impaired body weight gain compared with the control group (P<0.05). Higher hepatic TNF-α (P<0.0001) and IL-10 (P=0.001) mRNA levels were found in RBD-challenged mice, although without detectable non-alcoholic fatty liver disease. Marked IBA-1 immunolabeling and increased number of positive-IBA-1 cells were found in the undernourished group. No statistical difference in serum ALT was found. There was also a significant increase in ApoA mRNA expression in the undernourished group, but not ApoE and LCAT, compared with the control. Altogether our findings suggested that chronic RBD-induced malnutrition leads to liver inflammation with increased ApoA-I activity.

Depression and diagnosis of neurocognitive impairment in HIV-positive patients.

Neurocognitive impairment (NCI) is frequently observed in patients infected with human immunodeficiency virus (HIV) and results from the compromise of subcortical brain structures by the virus. The manifestations of NCI range from asymptomatic impairment to dementia. In addition to cognitive impairment resulting from HIV infection, other factors such as depression are associated with the loss of cognitive functions. The aim of this study was to estimate the prevalence of NCI in HIV-positive patients in a city in southern Brazil and to establish possible associations for the prevalence of NCI with HIV-related and other risk factors. This cross-sectional study of HIV-positive outpatients was conducted in a specialized care service in the city of Pelotas in Southern Brazil. Sociodemographic data and HIV-related information were collected, and all patients underwent psychiatric and neurocognitive evaluations. The prevalence of NCI among the 392 patients was 54.1% when tracked using the IHDS (International HIV Dementia Scale) and 36.2% when the IHDS was associated with a battery of complementary tests. A bivariate analysis suggested an association of NCI with gender, age, educational level, depression, current CD4 count and lowest CD4 count. The association of NCI with depression remained in the Poisson regression (PR=1.96, 95%CI=1.12-3.42). The prevalence of cognitive impairment in HIV-positive patients estimated in this study is in accordance with international and Brazilian data. Of the factors analyzed, depression showed the greatest evidence of association with neurocognitive loss. Based on our findings, the inclusion of instruments to evaluate depression in our services for patients with HIV and acquired immunodeficiency syndrome (AIDS) is recommended.

A Brazilian regional basic diet-induced chronic malnutrition drives liver inflammation with higher ApoA-I activity in C57BL6J mice

Malnutrition is still considered endemic in many developing countries. Malnutrition-enteric infections may cause lasting deleterious effects on lipid metabolism, especially in children living in poor settings. The regional basic diet (RBD), produced to mimic the Brazilian northeastern dietary characteristics (rich in carbohydrate and low in protein) has been used in experimental malnutrition models, but few studies have explored the effect of chronic RBD on liver function, a central organ involved in cholesterol metabolism. This study aimed to investigate whether RBD leads to liver inflammatory changes and altered reverse cholesterol metabolism in C57BL6/J mice compared to the control group, receiving a standard chow diet. To evaluate liver inflammation, ionized calcium-binding adapter protein-1 (IBA-1) positive cell counting, interleukin (IL)-1β immunohistochemistry, and tumor necrosis factor (TNF)-α and IL-10 transcription levels were analyzed. In addition, we assessed reverse cholesterol transport by measuring liver apolipoprotein (Apo)E, ApoA-I, and lecithin-cholesterol acyltransferase (LCAT) by RT-PCR. Furthermore, serum alanine aminotransferase (ALT) was measured to assess liver function. RBD markedly impaired body weight gain compared with the control group (P<0.05). Higher hepatic TNF-α (P<0.0001) and IL-10 (P=0.001) mRNA levels were found in RBD-challenged mice, although without detectable non-alcoholic fatty liver disease. Marked IBA-1 immunolabeling and increased number of positive-IBA-1 cells were found in the undernourished group. No statistical difference in serum ALT was found. There was also a significant increase in ApoA mRNA expression in the undernourished group, but not ApoE and LCAT, compared with the control. Altogether our findings suggested that chronic RBD-induced malnutrition leads to liver inflammation with increased ApoA-I activity.

Bloodstream infection surveillance in a cancer centre: a prospective look at clinical microbiology aspects.

A prospective clinical and microbiological surveillance study was conducted during a 26-month period to evaluate consecutive malignancy or post-bone marrow transplant patients with positive blood cultures. The study included 859 episodes of bloodstream infection (BSI) in 719 patients. There were 6.9 BSI episodes/1000 patient-days. Overall mortality was 25%. The median age of patients was 43 years, with 71% of episodes occurring in patients aged > 18 years. Patients with underlying haematology malignancies accounted for 38.2% of the episodes. An indwelling central vein catheter was present in 61% of episodes. BSI origin was unknown in 27% of episodes, associated with other sites in 49.6%, and catheter-related in 23.4%. There were 638 concomitant infection sites, of which the most common were pulmonary (28.4%), urinary tract (14.8%), and non-surgical skin or soft tissue (9.7%). In total, 1039 microorganisms were isolated within 48 h of the first blood culture, of which Gram-negative bacilli accounted for 56%. Among Klebsiella pneumoniae and Escherichia coli isolates, 37.8% and 8.9%, respectively, produced extended-spectrum beta-lactamases. High rates of ceftazidime resistance were detected among Acinetobacter spp. (40%) and Enterobacter spp. (51.2%). E. coli and K. pneumoniae were isolated frequently from haematology patients, and Enterobacter spp. from solid tumour patients. E. coli, K. pneumoniae and Pseudomonas aeruginosa were isolated more often from neutropenic than from non-neutropenic patients. Oxacillin resistance was detected in 18.7% of Staphylococcus aureus isolates. It was concluded that continuous multidisciplinary surveillance of BSI is warranted in this high-risk group of patients in order to develop strategies for antimicrobial resistance control and treatment of infectious complications.

Frequency of the cystic fibrosis delta F 508 mutation in a population from São Paulo State, Brazil.

Cystic fibrosis (CF) nonrelated patients (N = 24) from São Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33% (15/48 chromosomes). The genotype distribution among the patients showed 12.5% (N = 3) of delta F 508 homozygotes, 37.5% (N = 9) of delta F heterozygotes and 50% (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75% to 80%) and is similar to that described in Southern Europe (25% to 50%) which is consistent with the origins of this population.

[Management of a case of maple syrup urine disease--the use of gluco-insulinotherapy]. / Uma experiência terapêutica no manejo da doença da urina do xarope do bordo.

We report here the treatment and poor outcome of a case of Maple Syrup Urine Disease with late diagnosis and retrieval (2 and 5 months, respectively). As the proband had quite high levels of plasmatic leucine (1956 micromol/L for a normal upper limit of 77), we started immediately with a gluco-insulin therapy to produce anabolism in the infant. When leucine has fallen to 275.3 micromol/L, we instituted feeding with branched chain amino acid-free protein and high energy from carbohydrates. After reviewing briefly the clinical, biochemical and therapeutic aspects of this disorder, we comment on the great difficulties of making early diagnosis and of obtaining the specific dietetic formulas to Maple Syrup Urine Disease, in Brazil.

Depression and diagnosis of neurocognitive impairment in HIV-positive patients

Neurocognitive impairment (NCI) is frequently observed in patients infected with human immunodeficiency virus (HIV) and results from the compromise of subcortical brain structures by the virus. The manifestations of NCI range from asymptomatic impairment to dementia. In addition to cognitive impairment resulting from HIV infection, other factors such as depression are associated with the loss of cognitive functions. The aim of this study was to estimate the prevalence of NCI in HIV-positive patients in a city in southern Brazil and to establish possible associations for the prevalence of NCI with HIV-related and other risk factors. This cross-sectional study of HIV-positive outpatients was conducted in a specialized care service in the city of Pelotas in Southern Brazil. Sociodemographic data and HIV-related information were collected, and all patients underwent psychiatric and neurocognitive evaluations. The prevalence of NCI among the 392 patients was 54.1% when tracked using the IHDS (International HIV Dementia Scale) and 36.2% when the IHDS was associated with a battery of complementary tests. A bivariate analysis suggested an association of NCI with gender, age, educational level, depression, current CD4 count and lowest CD4 count. The association of NCI with depression remained in the Poisson regression (PR=1.96, 95%CI=1.12-3.42). The prevalence of cognitive impairment in HIV-positive patients estimated in this study is in accordance with international and Brazilian data. Of the factors analyzed, depression showed the greatest evidence of association with neurocognitive loss. Based on our findings, the inclusion of instruments to evaluate depression in our services for patients with HIV and acquired immunodeficiency syndrome (AIDS) is recommended.

Prognostic value of cardiac troponin I in patients with COPD acute exacerbation.

BACKGROUND: Chronic obstructive pulmonary disease (COPD) is frequently associated with right ventricular loading and pulmonary hypertension. We aimed to evaluate a possible association between cardiac troponin I (cTnI) levels and adverse events in hospitalised patients with acute exacerbation of COPD . METHODS: Retrospective cohort study, with analysis of admissions for acute exacerbation of COPD , with cTnI obtained in the first 48 hours of admission. A positive cTnI test was defined as 0.012 ng/ml or higher (99th percentile). Baseline and peak troponin I levels were taken as independent variables, and outcome variables included length of hospital stay, complications during hospitalisation, and in-hospital and extra-hospital mortality (evaluated 18 months post-discharge). RESULTS: Data concerned 173 patients (105 male, 68 female), with a median age of 77 years (interquartile range of 11 years). The median baseline cTnI was 0.030 ng/ml (n=173), and the median peak cTnI was 0.040 ng/ml (n=173; absolute peak value of 1.260 ng/ml). Nearly 70% of cases had a positive cTnI at admission. Both baseline and peak cTnI correlated significantly with the need for noninvasive ventilatory support. We were not able to find significant differences in in-hospital survival associated with the two troponin groups, but overall 18-month survival was significantly higher among patients with lower values of baseline and peak cTnI. CONCLUSIONS: In patients hospitalised for acute COPD exacerbations, elevated baseline and peak cTnI were associated with a greater need for noninvasive ventilatory support and were significant predictors of 18-month overall survival.

Determination of neutral polymorphisms (frameworks) of the human beta globin gene in beta thalassaemias by PCR/DGGE.

PURPOSE: Considering the importance of type beta thalassaemias as hereditary syndromes of high significance in different populations of Mediterranean origin and, by extension, in the Brazilian population, the objective of the present study was to determine by PCR/DGGE the gene structures responsible for neutral polymorphisms (frameworks) observed in the human beta globin gene associated with the mutations responsible for type beta thalassaemias in a sample of the Brazilian population and, more specifically, of the population of the State of São Paulo. PATIENTS AND METHODS: Thirty individuals with beta thalassaemic mutations were analyzed: 22 mutations were in codon 39 (C-->T), 5 in IVS1-110 (G-->A), 2 in IVS1-6 (T-->C) and 1 in IVS1-1 (G-->A). DNA was extracted and selective amplification was performed by PCR extending from position IVS1 nt 46 to IVS2 nt 126 (474 pb). The product was then analyzed by polyacrylamide gel electrophoresis on a denaturing 10-60% urea/formamide gradient. RESULTS: The results demonstrated that, as expected, the mutations responsible for type beta thalassaemia observed in this population are of Mediterranean origin, with 73% distribution represented by codon 39, 17% by IVS1-110, 7% by IVS1-6 and 3% by IVS1-1. In turn, framework distribution seems to indicate a higher frequency of Fr 1-1 in codon 39 and IVS1-110, of Fr 1-3 in IVS1-6 and of Fr 1-2 in IVS1-1. CONCLUSIONS: These results permit us to conclude that gene amplification by PCR followed by DGGE is an appropriate method for the separation of DNA molecules that differ even by a single base change and therefore can be utilized to detect the alterations observed in the human beta globin gene. This methodology shows that, using only a pair of primers, it is possible to define the frameworks that are observed in the beta globin gene.

Frequency of the cystic fibrosis delta F 508 mutation in a population from S ao Paulo State, Brazil

Cystic fibrosis (CF) nonrelated patients (N = 24) from S ao Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33 per cent (15/48 chromosomes). The genotype distribution among the patients showed 12.5 per cent (N = 3) of delta F 508 homozygotes, 37.5 per cent (N = 9) of delta F heterozygotes and 50 per cent (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75 per cent to 80 per cent ) and is similar to that described in Southern Europe (25 per cent to 50 per cent ) which is consistent with the origins of this population