Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 23
Filtrar
1.
J Chem Phys ; 148(4): 045102, 2018 Jan 28.
Artigo em Inglês | MEDLINE | ID: mdl-29390798

RESUMO

The first hydration shell of a protein exhibits heterogeneous behavior owing to several attributes, majorly local polarity and structural flexibility as revealed by solvation dynamics of secondary structural elements. We attempt to recognize the change in complex water counteraction generated due to substantial alteration in flexibility during protein complex formation. The investigation is carried out with the signaling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, and interacting with SLAM-associated protein (SAP), composed of one SH2 domain. All atom molecular dynamics simulations are employed to the aqueous solutions of free SAP and SLAM-peptide bound SAP. We observed that water dynamics around different secondary structural elements became highly affected as well as nicely correlated with the SLAM-peptide induced change in structural rigidity obtained by thermodynamic quantification. A few instances of contradictory dynamic features of water to the change in structural flexibility are explained by means of occluded polar residues by the peptide. For ßD, EFloop, and BGloop, both structural flexibility and solvent accessibility of the residues confirm the obvious contribution. Most importantly, we have quantified enhanced restriction in water dynamics around the second Fyn-binding site of the SAP due to SAP-SLAM complexation, even prior to the presence of Fyn. This observation leads to a novel argument that SLAM induced more restricted water molecules could offer more water entropic contribution during the subsequent Fyn binding and provide enhanced stability to the SAP-Fyn complex in the signaling cascade. Finally, SLAM induced water counteraction around the second binding site of the SAP sheds light on the allosteric property of the SAP, which becomes an integral part of the underlying signal transduction mechanism.


Assuntos
Simulação de Dinâmica Molecular , Transdução de Sinais , Família de Moléculas de Sinalização da Ativação Linfocitária/química , Água/química , Estrutura Secundária de Proteína
2.
J Comput Aided Mol Des ; 31(10): 891-903, 2017 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-28871352

RESUMO

The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (ß1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.


Assuntos
Proteínas Proto-Oncogênicas c-mdm2/química , Proteína Supressora de Tumor p53/química , Sítios de Ligação , Humanos , Interações Hidrofóbicas e Hidrofílicas , Ligantes , Simulação de Dinâmica Molecular , Mutação , Peptídeos/química , Ligação Proteica , Conformação Proteica , Proteínas Proto-Oncogênicas c-mdm2/genética , Termodinâmica
3.
J Chem Phys ; 146(16): 165103, 2017 Apr 28.
Artigo em Inglês | MEDLINE | ID: mdl-28456200

RESUMO

The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.


Assuntos
Modelos Químicos , Proteína Associada à Molécula de Sinalização da Ativação Linfocitária/química , Membro 1 da Família de Moléculas de Sinalização da Ativação Linfocitária/química , Cristalografia por Raios X , Simulação de Dinâmica Molecular , Estrutura Secundária de Proteína , Estrutura Terciária de Proteína , Transdução de Sinais , Proteína Associada à Molécula de Sinalização da Ativação Linfocitária/metabolismo , Membro 1 da Família de Moléculas de Sinalização da Ativação Linfocitária/metabolismo , Relação Estrutura-Atividade , Termodinâmica , Domínios de Homologia de src
4.
Biopolymers ; 103(6): 328-38, 2015 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-25652776

RESUMO

Emergence of thousands of crystal structures of noncoding RNA molecules indicates its structural and functional diversity. RNA function is based upon a large variety of structural elements which are specifically assembled in the folded molecules. Along with the canonical Watson-Crick base pairs, different orientations of the bases to form hydrogen-bonded non-canonical base pairs have also been observed in the available RNA structures. Frequencies of occurrences of different non-canonical base pairs in RNA indicate their important role to maintain overall structure and functions of RNA. There are several reports on geometry and energetic stabilities of these non-canonical base pairs. However, their stacking geometry and stacking stability with the neighboring base pairs are not well studied. Among the different non-canonical base pairs, the G:U wobble base pair (G:U W:WC) is most frequently observed in the RNA double helices. Using quantum chemical method and available experimental data set we have studied the stacking geometry of G:U W:WC base pair containing dinucleotide sequences in roll-slide parameters hyperspace for different values of twist. This study indicates that the G:U W:WC base pair can stack well with the canonical base pairs giving rise to large interaction energy. The overall preferred stacking geometry in terms of roll, twist and slide for the eleven possible dinucleotide sequences is seen to be quite dependent on their sequences.


Assuntos
Pareamento de Bases/fisiologia , RNA/química , Ligação de Hidrogênio , Conformação de Ácido Nucleico
5.
Biopolymers ; 103(3): 134-47, 2015 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-25257334

RESUMO

Understanding dinucleotide sequence directed structures of nuleic acids and their variability from experimental observation remained ineffective due to unavailability of statistically meaningful data. We have attempted to understand this from energy scan along twist, roll, and slide degrees of freedom which are mostly dependent on dinucleotide sequence using ab initio density functional theory. We have carried out stacking energy analysis in these dinucleotide parameter phase space for all ten unique dinucleotide steps in DNA and RNA using DFT-D by ωB97X-D/6-31G(2d,2p), which appears to satisfactorily explain conformational preferences for AU/AU step in our recent study. We show that values of roll, slide, and twist of most of the dinucleotide sequences in crystal structures fall in the low energy region. The minimum energy regions with large twist values are associated with the roll and slide values of B-DNA, whereas, smaller twist values correspond to higher stability to RNA and A-DNA like conformations. Incorporation of solvent effect by CPCM method could explain the preference shown by some sequences to occur in B-DNA or A-DNA conformations. Conformational preference of BII sub-state in B-DNA is preferentially displayed mainly by pyrimidine-purine steps and partly by purine-purine steps. The purine-pyrimidine steps show largest effect of 5-methyl group of thymine in stacking energy and the introduction of solvent reduces this effect significantly. These predicted structures and variabilities can explain the effect of sequence on DNA and RNA functionality.


Assuntos
DNA/química , Nucleotídeos/química , RNA/química , Pareamento de Bases , Conformação de Ácido Nucleico , Termodinâmica
6.
J Biol Chem ; 288(2): 1135-49, 2013 Jan 11.
Artigo em Inglês | MEDLINE | ID: mdl-23188822

RESUMO

Rab7 belongs to the Ras superfamily of small GTPases and is a master regulator of early to late endocytic membrane transport. Four missense mutations in the late endosomal Rab7 GTPase (L129F, K157N, N161T, and V162M) cause the autosomal dominant peripheral neuropathy Charcot-Marie-Tooth type 2B (CMT2B) disease. As yet, the pathological mechanisms connecting mutant Rab7 protein expression to altered neuronal function are undefined. Here, we analyze the effects of Rab7 CMT2B mutants on epidermal growth factor (EGF)-dependent intracellular signaling and trafficking. Three different cell lines expressing Rab7 CMT2B mutants and stimulated with EGF exhibited delayed trafficking of EGF to LAMP1-positive late endosomes and lysosomes and slowed EGF receptor (EGFR) degradation. Expression of all Rab7 CMT2B mutants altered the Rab7 activation cycle, leading to enhanced and prolonged EGFR signaling as well as variable increases in p38 and ERK1/2 activation. However, due to reduced nuclear translocation of p38 and ERK1/2, the downstream nuclear activation of Elk-1 was decreased along with the expression of immediate early genes like c-fos and Egr-1 by the disease mutants. In conclusion, our results demonstrate that Rab7 CMT2B mutants impair growth factor receptor trafficking and, in turn, alter p38 and ERK1/2 signaling from perinuclear, clustered signaling endosomes. The resulting down-regulation of EGFR-dependent nuclear transcription that is crucial for normal axon outgrowth and peripheral innervation offers a crucial new mechanistic insight into disease pathogenesis that is relevant to other neurodegenerative diseases.


Assuntos
Núcleo Celular/metabolismo , Endossomos/metabolismo , Receptores ErbB/metabolismo , Mutação de Sentido Incorreto , Transdução de Sinais , Proteínas rab de Ligação ao GTP/fisiologia , Animais , Linhagem Celular , Doença de Charcot-Marie-Tooth , Genes fos , Humanos , Laminopatias , Sistema de Sinalização das MAP Quinases , Microscopia de Fluorescência , Mutagênese , Transporte Proteico , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Proteínas rab de Ligação ao GTP/genética , proteínas de unión al GTP Rab7
7.
Biopolymers ; 101(1): 107-20, 2014 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-23722519

RESUMO

Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014.


Assuntos
Pareamento de Bases , Conformação de Ácido Nucleico , Sequência de Bases , Carboidratos , DNA/química , RNA/química
8.
J Comput Aided Mol Des ; 28(7): 735-49, 2014 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-24865848

RESUMO

Understanding unwinding and melting of double helical DNA is very important to characterize role of DNA in replication, transcription, translation etc. Sequence dependent melting thermodynamics is used extensively for detecting promoter regions but melting studies are generally done for short oligonucleotides. This study reports several molecular dynamics (MD) simulations of homopolymeric poly(dA).poly(dT) as regular oligonucleotide fragments as well as its corresponding polymeric constructs with water and charge-neutralizing counterions at different temperatures ranging from 300 to 400 K. We have eliminated the end-effect or terminal peeling propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The dynamic properties such as basepairing and stacking geometry, groove width, backbone conformational parameters, bending, distribution of counter ions and number of hydrogen bonds of oligomeric and polymeric constructs of poly(dA).poly(dT) have been analyzed. The oligomer shows terminal fraying or peeling effect at temperatures above 340 K. The polymer shows partial melting at elevated temperatures although complete denaturations of basepairs do not take place. The analysis of cross strand hydrogen bonds shows that the number of N-H···O hydrogen bonds increases with increase in temperature while C-H···O hydrogen bond frequencies decrease with temperature. Restructuring of counterions in the minor groove with temperature appear as initiation of melting in duplex structures.


Assuntos
DNA/química , Poli dA-dT/química , Polímeros/química , Termodinâmica , Pareamento de Bases , Ligação de Hidrogênio , Simulação de Dinâmica Molecular , Oligonucleotídeos/química , Temperatura , Água/química
9.
Biomater Sci ; 12(14): 3582-3599, 2024 Jul 09.
Artigo em Inglês | MEDLINE | ID: mdl-38904161

RESUMO

Nanostructured 7-9-residue cyclic and unstructured lipopeptide-based facial detergents have been engineered to stabilize the model integral membrane protein, bacteriorhodopsin. Formation of a cylindrical-type micelle assembly induced by facial amphipathic lipopeptides resembles a biological membrane more effectively than conventional micelles. The hydrophobic face of this cylindrical-type micelle provides extended stability to the membrane protein and the hydrophilic surface interacts with an aqueous environment. In our present study, we have demonstrated experimentally and computationally that lipopeptide-based facial detergents having an unstructured or ß-turn conformation can stabilize membrane proteins. However, constrained peptide detergents can provide enhanced stability to bacteriorhodopsin. In this study, we have computationally examined the structural stability of bacteriorhodopsin in the presence of helical, beta-strand, and cyclic unstructured peptide detergents, and conventional detergent-like peptides. Our study demonstrates that optimal membranomimetics (detergents) for stabilizing a specific membrane protein can be screened based on the following criteria: (i) hydrodynamic radii of the self-assembled peptide detergents, (ii) stability assay of detergent-encased membrane proteins, (iii) percentage covered area of detergent-encased membrane proteins obtained computationally and (iv) protein-detergent interaction energy.


Assuntos
Bacteriorodopsinas , Lipopeptídeos , Nanoestruturas , Estabilidade Proteica , Bacteriorodopsinas/química , Nanoestruturas/química , Lipopeptídeos/química , Detergentes/química , Micelas , Interações Hidrofóbicas e Hidrofílicas
10.
J Biomol Struct Dyn ; 40(24): 13682-13692, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-34726123

RESUMO

RNA interference, particularly siRNA induced gene silencing is becoming an important avenue of modern therapeutics. The siRNA is delivered to the cells as short double helical RNA which becomes single stranded for forming the RISC complex. Significant experimental evidence is available for most of the steps except the process of the separation of the two strands. We have attempted to understand the pathway for double stranded siRNA (dsRNA) to single stranded (ssRNA) molecules using steered molecular dynamics simulations. As the process is completely unexplored we have applied force from all possible directions restraining all possible residues to convert dsRNA to ssRNA. We found pulling one strand along the helical axis direction restraining the far end of the other strand demands excessive force for ssRNA formation. Pulling a central residue of one strand, in a direction perpendicular to the helix axis, while keeping the base paired residue fixed requires intermediate force for strand separation. Moreover, we found that in this process the force requirement is quite high for the first bubble formation (nucleation energy) and the bubble propagation energies are quite small. We believe the success rate of the design of siRNA sequences for gene silencing may increase if this mechanistic knowledge is utilized for such a design process.Communicated by Ramaswamy H. Sarma.


Assuntos
Simulação de Dinâmica Molecular , RNA de Cadeia Dupla , RNA Interferente Pequeno/química , RNA de Cadeia Dupla/genética , Interferência de RNA
11.
ACS Appl Mater Interfaces ; 11(5): 4719-4736, 2019 Feb 06.
Artigo em Inglês | MEDLINE | ID: mdl-30628773

RESUMO

Cytosolic delivery of functional siRNA remains the major challenge to develop siRNA-based therapeutics. Designing clinically safe and effective siRNA transporter to deliver functional siRNA across the plasma and endosomal membrane remains a key hurdle. With the aim of improving endosomal release, we have designed cyclic and linear peptide-based transporters having an Arg-DHis-Arg template. Computational studies show that the Arg-DHis-Arg template is also stabilized by the Arg-His side-chain hydrogen bonding interaction at physiological pH, which dissociates at lower pH. The overall atomistic interactions were examined by molecular dynamics simulations, which indicate that the extent of peptide_siRNA assembly formation depends greatly on physicochemical properties of the peptides. Our designed peptides having the Arg-DHis-Arg template and two lipidic moieties facilitate high yield of intracellular delivery of siRNA. Additionally, unsaturated lipid, linoleic acid moieties were introduced to promote fusogenicity and facilitate endosomal release and cytosolic delivery. Interestingly, such protease-resistant peptides provide serum stability to siRNA and exhibit high efficacy of erk1 and erk2 gene silencing in the triple negative breast cancer (TNBC) cell line. The peptide having two linoleyl moieties demonstrated comparable efficacy with commercial transfection reagent HiPerFect, as evidenced by the erk1 and erk2 gene knockdown experiment. Additionally, our study shows that ERK1/2 silencing siRNA and doxorubicin-loaded gramicidin-mediated combination therapy is more effective than siRNA-mediated gene silencing-based monotherapy for TNBC treatment.


Assuntos
Antineoplásicos/farmacocinética , Peptídeos Penetradores de Células/farmacocinética , Sistemas de Liberação de Medicamentos/métodos , Lipopeptídeos/farmacocinética , RNA Interferente Pequeno/farmacocinética , Neoplasias de Mama Triplo Negativas/metabolismo , Antineoplásicos/síntese química , Antineoplásicos/química , Antineoplásicos/farmacologia , Linhagem Celular Tumoral , Sobrevivência Celular/efeitos dos fármacos , Peptídeos Penetradores de Células/síntese química , Peptídeos Penetradores de Células/química , Peptídeos Penetradores de Células/farmacologia , Humanos , Lipopeptídeos/síntese química , Lipopeptídeos/química , Lipopeptídeos/farmacologia , RNA Interferente Pequeno/química , RNA Interferente Pequeno/genética , RNA Interferente Pequeno/farmacologia , Transdução de Sinais/efeitos dos fármacos
12.
Circ Res ; 98(6): 743-56, 2006 Mar 31.
Artigo em Inglês | MEDLINE | ID: mdl-16574915

RESUMO

Receptor tyrosine kinases (RTKs) play a pivotal role in the development and function of the cardiovascular system. Ligand-activated RTKs promote numerous downstream signal transduction pathways that lead to vascular permeability, as well as proliferation, migration, and differentiation of vascular endothelia and smooth muscle cells. Ligand binding also promotes internalization of the activated receptors either to downregulate the signaling via degradation of the ligand/receptor complex or to signal from endosomes. However, the outcomes of receptor internalization via clathrin-dependent or caveolar pathways and trafficking mechanisms are incompletely clarified in vascular systems. Activity modulation through endocytosis and vesicular trafficking significantly impacts downstream targets of RTKs such as endothelial nitric oxide synthase (eNOS) and VE-cadherin. RTKs and their associated targets are also transported to the nucleus, where they may directly impact nuclear signaling. Although the nuclear transport pathways are just beginning to be unraveled, it appears that endocytosis and vesicular trafficking are involved. In this review, we discuss the mechanisms by which activated RTKs and the downstream targets eNOS and VE-cadherin may be internalized and transported to various intracellular compartments. How localization and interacting proteins impact protein function and influence signaling is an important theme, as is the potential for modulating signaling through therapeutic targeting of activated receptors and components of the endocytic machinery.


Assuntos
Vasos Sanguíneos/fisiologia , Membrana Celular/metabolismo , Receptores Proteína Tirosina Quinases/metabolismo , Transdução de Sinais/fisiologia , Animais , Antígenos CD , Caderinas/fisiologia , Cavéolas/metabolismo , Clatrina/fisiologia , Endocitose , Receptores ErbB/fisiologia , Humanos , Óxido Nítrico/biossíntese , Óxido Nítrico Sintase Tipo III/metabolismo , Proteína Quinase C/fisiologia , Transporte Proteico , Ubiquitina/metabolismo , Receptor 1 de Fatores de Crescimento do Endotélio Vascular/fisiologia , Receptor 2 de Fatores de Crescimento do Endotélio Vascular/fisiologia
13.
Mol Biol Cell ; 16(3): 1396-405, 2005 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-15635088

RESUMO

The relationship between endosomal pH and function is well documented in viral entry, endosomal maturation, receptor recycling, and vesicle targeting within the endocytic pathway. However, specific molecular mechanisms that either sense or regulate luminal pH to mediate these processes have not been identified. Herein we describe the use of novel, compartment-specific pH indicators to demonstrate that yeast Nhx1, an endosomal member of the ubiquitous NHE family of Na+/H+ exchangers, regulates luminal and cytoplasmic pH to control vesicle trafficking out of the endosome. Loss of Nhx1 confers growth sensitivity to low pH stress, and concomitant acidification and trafficking defects, which can be alleviated by weak bases. Conversely, weak acids cause wild-type yeast to present nhx1Delta trafficking phenotypes. Finally, we report that Nhx1 transports K+ in addition to Na+, suggesting that a single mechanism may responsible for both pH and K+-dependent endosomal processes. This presents the newly defined family of eukaryotic endosomal NHE as novel targets for pharmacological inhibition to alleviate pathological states associated with organellar alkalinization.


Assuntos
Proteínas de Transporte de Cátions/fisiologia , Endossomos/metabolismo , Proteínas de Saccharomyces cerevisiae/fisiologia , Saccharomyces cerevisiae/metabolismo , Trocadores de Sódio-Hidrogênio/fisiologia , Transporte Biológico , Citoplasma/metabolismo , Citosol/metabolismo , Relação Dose-Resposta a Droga , Proteínas de Fluorescência Verde/química , Proteínas de Fluorescência Verde/metabolismo , Concentração de Íons de Hidrogênio , Microscopia Confocal , Modelos Biológicos , Mutação , Fenótipo , Plasmídeos/metabolismo , Potássio/química , Receptores Acoplados a Proteínas G/fisiologia , Receptores de Fator de Acasalamento , Receptores de Feromônios/fisiologia , Radioisótopos de Rubídio , Sódio/química , Temperatura , Fatores de Tempo
14.
Biochem J ; 398(1): 97-105, 2006 Aug 15.
Artigo em Inglês | MEDLINE | ID: mdl-16671892

RESUMO

Yeast Nhx1 [Na+(K+)/H+ exchanger 1] is an intracellular Na+(K+)/H+ exchanger, localizing to the late endosome where it is important for ion homoeostasis and vesicle trafficking. Phylogenetic analysis of NHE (Na+/H+ exchanger) sequences has identified orthologous proteins, including HsNHE6 (human NHE6), HsNHE7 and HsNHE9 of unknown physiological role. These appear distinct from well-studied mammalian plasma membrane isoforms (NHE1-NHE5). To explore the differences between plasma membrane and intracellular NHEs and understand the link between ion homoeostasis and vesicle trafficking, we examined the consequence of replacing residues in the intramembranous H10 loop of Nhx1 between transmembrane segments 9 and 10. The critical role for the carboxy group of Glu355 in ion transport is consistent with the invariance of this residue in all NHEs. Surprisingly, residues specifically conserved in the intracellular isoforms (such as Phe357 and Tyr361) could not be replaced with closely similar residues (leucine and phenylalanine) found in the plasma membrane isoforms without loss of function, revealing unexpected side chain specificity. The trafficking phenotypes of all Nhx1 mutants, including hygromycin-sensitivity and missorting of carboxypeptidase Y, were found to directly correlate with pH homoeostasis defects and could be proportionately corrected by titration with weak base. The present study demonstrates the importance of the H10 loop of the NHE family, highlights the differences between plasma membrane and intracellular isoforms and shows that trafficking defects are tightly coupled with pH homoeostasis.


Assuntos
Proteínas de Transporte de Cátions/genética , Proteínas de Transporte de Cátions/metabolismo , Membrana Celular/metabolismo , Homeostase , Proteínas de Saccharomyces cerevisiae/genética , Proteínas de Saccharomyces cerevisiae/metabolismo , Saccharomyces cerevisiae/genética , Saccharomyces cerevisiae/metabolismo , Trocadores de Sódio-Hidrogênio/genética , Trocadores de Sódio-Hidrogênio/metabolismo , Vesículas Transportadoras/metabolismo , Sequência de Aminoácidos , Substituição de Aminoácidos/genética , Aminoácidos Acídicos/metabolismo , Catepsina A/metabolismo , Proteínas de Transporte de Cátions/química , Análise Mutacional de DNA , Relação Dose-Resposta a Droga , Concentração de Íons de Hidrogênio , Higromicina B/farmacologia , Transporte de Íons , Testes de Sensibilidade Microbiana , Dados de Sequência Molecular , Mutação/genética , Fenótipo , Transporte Proteico , Saccharomyces cerevisiae/citologia , Saccharomyces cerevisiae/efeitos dos fármacos , Proteínas de Saccharomyces cerevisiae/química , Trocadores de Sódio-Hidrogênio/química , Vacúolos/metabolismo
15.
J Mol Model ; 23(8): 226, 2017 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-28717992

RESUMO

Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)2 at elevated temperatures, along with its equivalent oligomeric constructs for comparison. Initiation of temperature-induced DNA melting was observed with higher fluctuations of the central d(AATT) region only in the model polymer. The polymeric construct shows a definite melting start site at the weaker A/T stretch, which propagates slowly through the CG rich regions. The melting is reflected in the hydrogen bond breaking, i.e. basepair opening, and by disruption of stacking interaction between successive basepairs. Melting at higher temperature of the oligomer, however, was only through terminal fraying, as also reported earlier.


Assuntos
DNA de Forma B/química , Temperatura Alta , Simulação de Dinâmica Molecular , Ligação de Hidrogênio , Desnaturação de Ácido Nucleico
16.
Sci Rep ; 7(1): 6509, 2017 07 26.
Artigo em Inglês | MEDLINE | ID: mdl-28747673

RESUMO

Designing biologically inspired nanoscale molecular assembly with desired functionality is a challenging endeavour. Here we report the designing of fibrin-inspired nanostructured peptide based sealants which facilitate remarkably fast entrapping of blood corpuscles (~28 seconds) in contrast to fibrin (~56 seconds). Our engineered sealants are stabilized by lysine-aspartate ionic interactions and also by Nε(γ-glutamyl) lysine isopeptide bond mediated covalent interaction. Each sealant is formed by two peptides having complementary charges to promote lysine-aspartate ionic interactions and designed isopeptide bond mediated interactions. Computational analysis reveals the isopeptide bond mediated energetically favourable peptide assemblies in sealants 1-3. Our designed sealants 2 and 3 mimic fibrin-mediated clot formation mechanism in presence of transglutaminase enzyme and blood corpuscles. These fibrin-inspired peptides assemble to form sealants having superior hemostatic activities than fibrin. Designed sealants feature mechanical properties, biocompatibility, biodegradability and high adhesive strength. Such nature-inspired robust sealants might be potentially translated into clinics for facilitating efficient blood clotting to handle traumatic coagulopathy and impaired blood clotting.


Assuntos
Células Sanguíneas/metabolismo , Coagulação Sanguínea , Hemostáticos/química , Hemostáticos/farmacologia , Proteínas Recombinantes/química , Proteínas Recombinantes/farmacologia , Ligação Proteica , Estabilidade Proteica
17.
J Mol Graph Model ; 66: 9-19, 2016 05.
Artigo em Inglês | MEDLINE | ID: mdl-27017424

RESUMO

DNA within the living cells experiences a diverse range of temperature, ranging from freezing condition to hot spring water. How the structure, the mechanical properties of DNA, and the solvation dynamics around DNA changes with the temperature is important to understand the functionality of DNA under those acute temperature conditions. In that notion, we have carried out molecular dynamics simulations of a DNA oligomer, containing TATA-box sequence for three different temperatures (250K, 300K and 350K). We observed that the structure of the DNA, in terms of backbone torsion angles, sugar pucker, base pair parameters, and base pair step parameters, did not show any unusual properties within the studied range of temperatures, but significant structural alteration was noticed between BI and BII forms at higher temperature. As expected, the flexibility of the DNA, in terms of the torsional rigidity and the bending rigidity is highly temperature dependent, confirming that flexibility increases with increase in temperature. Additionally, the groove widths of the studied DNA showed temperature sensitivity, specifically, the major groove width decreases and the minor groove width increases, respectively, with the increase in temperature. We observed that at higher temperature, water around both the major and the minor groove of the DNA is less structured. However, the water dynamics around the minor groove of the DNA is more restricted as compared to the water around the major groove throughout the studied range of temperatures, without any anomalous behavior.


Assuntos
DNA/química , Conformação de Ácido Nucleico , Oligonucleotídeos/química , Ligação de Hidrogênio , Modelos Moleculares , Simulação de Dinâmica Molecular , Temperatura , Água/química
18.
Methods Enzymol ; 403: 650-63, 2005.
Artigo em Inglês | MEDLINE | ID: mdl-16473627

RESUMO

Proteasomes have long been known to mediate the degradation of polyubiquitinated proteins in the cytoplasm and the nucleus. Additionally, proteasomes have been identified as participating in cellular degradative pathways involving the endomembrane system. In conjunction with the endoplasmic reticulum, proteasomes serve as a quality control mechanism for disposing of malfolded newly synthesized proteins, while on the endocytic pathway they serve to facilitate the degradation of key signaling and nutrient receptors as well as the destruction of phagocytosed pathogens. Our laboratory has identified a direct interaction between the late endocytic Rab7 GTPase and the alpha-proteasome subunit, XAPC7, thus providing the first molecular link between the endocytic trafficking and cytosolic degradative machineries. In this chapter reagents and methods for studying the regulation and interactions between XAPC7, the 20S proteasome, and Rab7 are described.


Assuntos
Complexo de Endopeptidases do Proteassoma/metabolismo , Proteínas rab de Ligação ao GTP/metabolismo , Animais , Western Blotting , Linhagem Celular , Cricetinae , Endocitose , Receptores ErbB/metabolismo , Humanos , Imunoprecipitação , Microscopia de Fluorescência , Microscopia Imunoeletrônica , Fagocitose , proteínas de unión al GTP Rab7
19.
J Mol Model ; 20(11): 2499, 2014 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-25352516

RESUMO

Deformation of DNA takes place quite often due to binding of small molecules or proteins with DNA. Such deformation is significant due to minor groove binding and, besides electrostatic interactions, other non-covalent interactions may also play an important role in generating such deformation. TATA-box binding protein (TBP) binds to the minor groove of DNA at the TATA box sequence, producing a large-scale deformation in DNA and initiating transcription. In order to observe the interactions of protein residues with DNA in the minor groove that produce the deformation in the DNA structure, we carried out molecular dynamics simulations of the TBP-DNA system. The results reveal consistent partial intercalation of two Phe residues, distorting stacking interactions at two dinucleotide step sites. We carried out calculations based on dispersion-corrected density functional theory to understand the source of such stabilization. We observed favorable interaction energies between the Phe residues and the base pairs with which they interact. We suggest that salt-bridge interactions between the phosphate groups and Lys or Arg residues, along with the intercalation of Phe residues between two base pair stacks, stabilize the kinked and opened-up DNA conformation.


Assuntos
DNA/metabolismo , Simulação de Dinâmica Molecular , Fenilalanina/metabolismo , Proteína de Ligação a TATA-Box/metabolismo , Sítios de Ligação , DNA/química , Elétrons , Transferência de Energia , Ligação de Hidrogênio , Conformação de Ácido Nucleico , Fenilalanina/química , Ligação Proteica , Conformação Proteica , Relação Estrutura-Atividade , Proteína de Ligação a TATA-Box/química
20.
J Biomol Struct Dyn ; 31(8): 896-912, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-22963740

RESUMO

A large amount of experimental evidence is available on the effect of magnesium ions on the structure and stability of DNA double helix. Less is known, however, on how these ions affect the stability and dynamics of the molecule. The static time average pictures from X-ray structures or the quantum chemical energy minimized structures lack understanding of the dynamic DNA-ion interaction. The present work addresses these questions by molecular dynamics simulation studies on two DNA duplexes and their interaction with magnesium ions. Results show typical B-DNA character with occasional excursions to deviated states. We detected expected stability of the duplexes in terms of backbone conformations and base pair parameter by the CHARMM-27 force field. Ion environment analysis shows that Mg²âº retains the coordination sphere throughout the simulation with a preference for major groove over minor. An extensive analysis of the influence of the Mg²âº ion shows no evidence of the popular predictions of groove width narrowing by dipositive metal ion. The major groove atoms show higher occupancy and residence time compared to minor groove for magnesium, where no such distinction is found for the charge neutralizing Na⁺ ions. The determining factor of Mg²âº ion's choice in DNA binding site evolves as the steric hindrance faced by the bulky hexahydrated cation where wider major groove gets the preference. We have shown that in case of binding of Mg²âº to DNA non electrostatic contributions play a major role. An animated Interactive 3D Complement (I3DC) is available in Proteopedia at http://proteopedia.org/w/Journal:JBSD:5.


Assuntos
DNA/química , Magnésio/química , Simulação de Dinâmica Molecular , Íons/química , Conformação de Ácido Nucleico , Eletricidade Estática
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA