RESUMO
Under global cerebral ischemia, the effect of different brain temperature on cerebral ischemic injury was studied. Male Sprague-Dawley rats were divided into normothermic (37-38°C) ischemia, mild hypothermic (31-32°C) ischemia, hyperthermic (41-42°C) ischemia and sham-operated groups. Global cerebral ischemia was established using the Pulsinelli four-vessel occlusion model and brain temperature was maintained at defined level for 60 min after 20-min ischemia. The expression of c-fos protein and the levels of malondialdehyde (MDA) and lactate in brain regions were detected by immunochemistry and spectrophotometrical methods, respectively. C-fos positive neurons were found in the hippocampus and cerebral cortex after cerebral ischemia reperfusion. Mild hypothermia increased the expression of c-fos protein in both areas, whereas hyperthermia decreased the expression of c-fos protein in the hippocampus at 24 h reperfusion, and the cerebral cortex at 48 h reperfusion when compared to normothermic conditions. In normothermic, mild hypothermic and hyperthermic ischemia groups, the levels of MDA and lactate in brain tissue were increased at 24, 48 and 72 h reperfusion following 20-min ischemia as compared with the sham-operated group (P<0.01). The levels of MDA and lactate in mild hypothermic group were significantly lower than those in normothermic group (P<0.01). It is suggested that brain temperature influences the translation of the immunoreactive protein product of c-fos after global cerebral ischemia, and MDA and lactate are also affected by hypothermia and hyperthermia.
Assuntos
Isquemia Encefálica/metabolismo , Encéfalo/metabolismo , Ácido Láctico/metabolismo , Malondialdeído/metabolismo , Proteínas Proto-Oncogênicas c-fos/metabolismo , Animais , Temperatura Corporal , Encéfalo/irrigação sanguínea , Encéfalo/fisiopatologia , Isquemia Encefálica/fisiopatologia , Córtex Cerebral/irrigação sanguínea , Córtex Cerebral/metabolismo , Córtex Cerebral/fisiopatologia , Hipocampo/irrigação sanguínea , Hipocampo/metabolismo , Hipocampo/fisiopatologia , Imunoquímica , Masculino , Proteínas Proto-Oncogênicas c-bcl-2/metabolismo , Ratos , Ratos Sprague-Dawley , Traumatismo por Reperfusão/metabolismo , Traumatismo por Reperfusão/fisiopatologia , Espectrofotometria , Temperatura , Fatores de Tempo , Proteína Supressora de Tumor p53/metabolismoRESUMO
BACKGROUND: Machado-Joseph disease (MJD), caused by a CAG repeat expansion located in exon10 of the ATXN3 gene, is now regarded as one of the most common spinocerebellar ataxia (SCA) in the world. The relative frequency of MJD among SCA has previously been estimated at about 50% in the Chinese population and has been reported to be related to the frequency of large normal alleles in some populations. Taq polymerase has been used for PCR in nearly all studies reported previously. METHODS: Normal and expanded alleles of ATXN3 were detected via PCR using LA Taq DNA polymerase (better for GC-rich sequences) and denaturing polyacrylamide gel electrophoresis in 150 normal individuals and 138 unrelated probands from autosomal dominant SCA families. To compare reaction efficiency, 12 MJD patients' expanded alleles were amplified with La Taq and Taq polymerase respectively in the same amplifying systems and reaction conditions. RESULTS: Normal alleles ranged from 12 to 42 CAG repeats. The most common allele contained 14 repeats with a frequency of 23.3%, which corroborates previous reports. The frequency of large normal alleles (>27 repeats) was 0.28, which was very high relative to previous reports. The frequency of MJD in SCA patients was 72.5%, which was significantly higher than those in previous reports about the Chinese and other Asian populations. This frequency was one of the highest reported worldwide, with only Portuguese and Brazilian populations exhibiting higher proportions. All 12 expanded alleles were amplified in PCR with La Taq polymerase, whereas only 2 expanded alleles were amplified with Taq polymerase. CONCLUSION: We have first reported the highest relative frequency of MJD in Asia, and we attribute this high frequency to a more efficient PCR using LA Taq polymerase and hypothesized that large ANs may act as a reservoir for expanded alleles in the Southeastern Chinese population.
Assuntos
Povo Asiático/genética , Doença de Machado-Joseph/genética , Proteínas do Tecido Nervoso/genética , Proteínas Nucleares/genética , Proteínas Repressoras/genética , Alelos , Ataxina-3 , China , Éxons , Frequência do Gene , Humanos , Repetições de TrinucleotídeosRESUMO
BACKGROUND: Spinal muscular atrophy (SMA) is an autosomal recessive hereditary disorder caused by mutations of the survival motor neuron 1 (SMN1) gene. Recently, high-resolution DNA melting analysis (HRMA) with saturation LC Green dyes has become a powerful post-PCR technique for genotyping or mutation scanning. So far, no studies have applied HRMA to the molecular analysis of SMA. METHODS: The exon 7 and the flanking area of the SMN1 and SMN2 genes of 55 SMA patients and 46 unrelated normal individuals were amplified with asymmetric PCR with unlabeled probe and symmetric PCR without probe, respectively. The saturation LC Green dyes were added to the PCR system. The PCR products were loaded onto the LightScanner system and were melted from 60 degrees C to 95 degrees C slowly. The melting curves were acquired and analyzed by the LightScanner software. RESULTS: Three types of melting curves that correlated with the presumed genotype of SMA patients and controls were clearly separated on the HRMA chromatogram with the unlabeled probe. The 55 SMA patients and 46 non-SMA controls were identified with HRMA with a 100% clinical sensitivity. CONCLUSION: The HRMA with saturation LC Green dyes and unlabeled probe appears to be a suitable, alternative method for the diagnosis of SMA, with high sensitivity and specificity.
Assuntos
Análise Mutacional de DNA/métodos , Atrofia Muscular Espinal/diagnóstico , Proteínas do Complexo SMN/genética , Proteína 1 de Sobrevivência do Neurônio Motor/genética , Sondas de DNA , Éxons , Humanos , Atrofia Muscular Espinal/genética , Reação em Cadeia da Polimerase , Proteína 2 de Sobrevivência do Neurônio MotorRESUMO
Our objective was to investigate the association between senataxin mutations and sporadic amyotrophic lateral sclerosis (ALS) in Chinese patients. DNA from 45 sporadic ALS patients was screened for mutations in senataxin using polymerase chain reaction (PCR) and direct sequencing. A novel variation, Thr1118Ile, was identified in a 42-year-old individual with sporadic ALS. This variation was not detected in 200 unrelated control individuals. In conclusion, the presence of this variation in a patient with sporadic ALS, and its absence in 200 controls, supports an association between senataxin and sporadic ALS. This study has broadened the mutation spectrum of senataxin and expanded the clinical phenotypes of senataxin mutations.
Assuntos
Esclerose Lateral Amiotrófica/etnologia , Esclerose Lateral Amiotrófica/genética , Povo Asiático/genética , Testes Genéticos , RNA Helicases/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , China/epidemiologia , DNA Helicases , Primers do DNA , Éxons/genética , Feminino , Predisposição Genética para Doença/etnologia , Humanos , Masculino , Pessoa de Meia-Idade , Enzimas Multifuncionais , Linhagem , Mutação PuntualRESUMO
OBJECTIVE: To investigate the characteristics of gene structure in facioscapulohumeral muscular dystrophy (FSHD)-related 4q35 subtelomere, to analyze the distribution of 2 alleles (4qA and 4qB) distal to D4Z4 of this locus, and to further elucidate the genotype-phenotype correlation in Chinese Han FSHD patients. METHODS: Peripheral blood samples were collected from 52 unrelated families including 62 FSHD-affected and 57 unaffected members. Genomic DNA was extracted from the lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoRI or HindIII, or double digested with EcoRI and BlnI. The cleaved DNA was separated by pulsed field electrophoresis (PFGE) and Southern blotting with the probes p13E-11, 4qA, and 4qB. The size of FSHD-causing 4qA allele and its distribution was analyzed by "curve fitting". Then the characteristics of translocation and mosaicism, the frequencies of two allelic variants of chromosome 4q and their genotypes were calculated to analyze the genotype-phenotype correlation. RESULTS: It was found that 69 patients carried a short chromosome 4-type allele of 4qA origin with the length 10-38 kb. The mean length of these pathogenic EcoRI/4qA arrays was 20 kb+/-7 kb, without significant difference between the sporadic cases and familial cases (t=1.413, P>0.05). Three different translocation types were observed with a translocation rate of 14.49%. The rate of 4q-->10q translocation was 13.04%, significantly higher than that of 10q-->4q translocation (1.45%, chi2=6.900, P<0.05). Somatic mosaicism was detected in a male sporadic case and a female asymptomatic familial case. In 57 cases with standard configuration distribution, the frequency of 4qA/4qB heterozygote was 61.40%, significantly higher than that of 4qA/4qA homozygote (38.60%, (chi2=5.930, P<0.05). There were not significant differences in the repeat size distributions and assessment of clinical severity between the sporadic and familial cases (t=-0.039, P>0.05; H=0.693, P>0.05). CONCLUSION: About 95% of Chinese FSHD patients carry a pathogenic 4-type allele of 4qA origin less than 30 kb long. The frequent translocations between chromosome 4q and 10q may play an essential role for FSHD mechanism. The frequency of 4qA/4qB heterozygote is significantly higher than that of 4qA/4qA homozygote, while the allelic variant genotypes do not contribute to modify FSHD manifestations.
Assuntos
Distrofia Muscular Facioescapuloumeral/genética , Distrofia Muscular Facioescapuloumeral/patologia , Telômero/genética , Adolescente , Adulto , Idoso , Alelos , Povo Asiático/genética , Criança , Pré-Escolar , Cromossomos Humanos Par 4/genética , Feminino , Genótipo , Humanos , Masculino , Pessoa de Meia-Idade , Fenótipo , Adulto JovemRESUMO
BACKGROUND: Neuroglobin (Ngb), one of novel members of the globin superfamily, is expressed predominantly in brain neurons, and appears to modulate hypoxic-ischemic insults. The mechanisms underlying Ngb-mediated neuronal protection are still unclear. For it is one of the candidate protective factors for ischemic stroke, we conducted a case-control study to clarify the association of Ngb polymorphisms with ischemic stroke in the Southern Chinese Han population. METHODS: 355 cases and 158 controls were recruited. With brain imaging, cases were subdivided into large-artery atherosclerosis (LVD) and small-vessel occlusion (SVD) stroke. PCR amplified all the four exons of Ngb and flanking intron sequence for each exon. Genotyping for Ngb was achieved by direct sequencing and mismatched PCR-RFLP. Polymorphisms were studied both individually and as haplotypes in each group and subgroup which subdivided according to gender or age. RESULTS: Two intronic polymorphisms 89+104 c>t and 322-110 (6a)>5a were identified. The allele frequency of 89+104 t was decreased in stroke cases. The protective effect seems to be more pronounced in subgroups of female patients and age > 60 years. Also, we have confirmed decreased LDL-C level and reduced hypertension and hypercholesterolemia in 89+104 t allele carriers. In contrast, the 322-110 (6a)>5a genotype distribution was similar between cases and controls. However, the haplotype 89+104 c>t/322-110 (6a)>5a was related with LVD and SVD stroke. The haplotype c-5a was more frequent in both LVD and SVD groups while t-6a was more frequent in controls. CONCLUSION: Ngb polymorphism 89+104 t had protective effects on LVD and SVD in the Southern Chinese Han population. A "hitchhiking" effect was observed for the 89+104 t/322-110 (6a) genotype combination especially for LVD.
Assuntos
Isquemia Encefálica/genética , Globinas/genética , Proteínas do Tecido Nervoso/genética , Acidente Vascular Cerebral/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Alelos , Estudos de Casos e Controles , China , Feminino , Genótipo , Humanos , Modelos Logísticos , Masculino , Pessoa de Meia-Idade , Neuroglobina , Razão de Chances , Reação em Cadeia da Polimerase , Polimorfismo de Fragmento de Restrição , Polimorfismo de Nucleotídeo ÚnicoRESUMO
OBJECTIVE: To characterize the deficiency of the mRNA expression of specific protein (SP3) gene in peripheral blood mononuclear cells (PBMCs) from Chinese patients with multiple sclerosis (MS) and study its correlation with the disease phenotypes. METHODS: Fifty-six patients with definite MS were collected and total RNA was extracted from their PBMCs. Specific primers corresponding to SP3 gene were designed and the mRNA expression of SP3 gene was detected by reverse transcriptase-PCR (RT-PCR) method. The deficiency of SP3 expression was compared among MS patients, irrelevant disease group and normal controls. RESULTS: Of the 56 MS cases, 23 (41.1%) were SP3-deficient. In contrast, the frequency of SP3-deficiency in normal subjects and irrelevant disease controls was 8.6% (5/35) and 14.3% (4/27), respectively. The frequency of the SP3-expression deficiency in MS patients was significantly higher than that in both control groups (P< 0.01). Within the MS cases, the scores of expanded disability status scale (EDSS) in the SP3-expressing subjects were significantly different from that in the SP3-deficient ones in the stable, but not in the active, phase of MS (P< 0.05). CONCLUSION: Author's observation suggested that deficient expression of SP3 gene occurs in Chinese MS patients, and that the SP3 expression may correlate with the clinical manifestations of MS and play roles in its immunological pathogenesis.
Assuntos
Leucócitos Mononucleares/metabolismo , Esclerose Múltipla/genética , RNA Mensageiro/genética , Fator de Transcrição Sp3/genética , Adolescente , Adulto , Idoso , Criança , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Adulto JovemRESUMO
BACKGROUND: The difficulties and incurability of spinal muscular atrophy (SMA) highlight the importance of prenatal diagnosis in families with SMA. However, the system applied in prenatal screening is far from perfect. OBJECTIVES: To optimize the molecular assays and establish a relatively perfect system for prenatal screening. Design, Setting, and Patients A total of 87 patients and 132 parents from 77 families with SMA were screened for SMN1 mutations. Prenatal prediction was performed for 11 fetuses from 10 families with SMA. All of the samples to be tested were from the Department of Neurology, First Affiliated Hospital, Fujian Medical University, Fuzhou, China. MAIN OUTCOME MEASURES: All of the 87 patients and their parents were screened for SMN1 deletion by restriction fragment length polymorphism analysis and denaturing high-performance liquid chromatography (DHPLC). For those patients without the SMN1 deletion, the SMN1 copy numbers were detected by real-time fluorescence quantitative polymerase chain reaction and the subtle mutations of SMN were screened by direct sequencing. Prenatal prediction was performed by restriction fragment length polymorphism analysis, DHPLC, and linkage analysis for 11 fetuses. Furthermore, the SMN1 copy numbers and detected carriers of SMA were found by DHPLC and real-time fluorescence quantitative polymerase chain reaction in 14 parents and the fetuses without the SMN1 deletion. Results in aborted fetuses and born babies were reconfirmed by restriction fragment length polymorphism analysis and DHPLC. The born babies were followed up and physically examined twice a year. RESULTS: The frequency of the SMN1 deletion we detected was 93.5% (72 of 77 patients). No subtle mutations were detected in the other 5 families. Four fetuses had the SMN1 deletion and were aborted. The other 7 fetuses, 4 carriers and 3 normal individuals, were born under suggestion by the physician. Fourteen parents were carriers. The reconfirmation of results in the aborted fetuses and born babies was completely consistent with prenatal prediction. The 7 born babies were followed up until recently and all were normal. CONCLUSIONS: The molecular diagnosis system based on restriction fragment length polymorphism analysis, DHPLC, and linkage analysis is an efficient and accurate method that is well suited for routine use in clinical laboratories.
Assuntos
Cromatografia Líquida de Alta Pressão , Proteína de Ligação ao Elemento de Resposta ao AMP Cíclico/genética , Atrofia Muscular Espinal/diagnóstico , Atrofia Muscular Espinal/genética , Proteínas do Tecido Nervoso/genética , Polimorfismo de Fragmento de Restrição , Diagnóstico Pré-Natal , Proteínas de Ligação a RNA/genética , Criança , Pré-Escolar , China , Éxons , Feminino , Seguimentos , Ligação Genética , Humanos , Lactente , Masculino , Linhagem , Gravidez , Proteínas do Complexo SMN , Proteína 1 de Sobrevivência do Neurônio MotorRESUMO
Wilson disease (WD) is the most common disorder resulting in hepatic copper overload. A similar form of copper-associated cirrhosis caused by mutations of the canine copper toxicosis MURR1 gene is also observed in Bedlington terriers. Recent studies indicate that MURR1 might influence human copper metabolism and the clinical presentations of WD. However, the correlation between the MURR1 gene and the Chinese patients with WD has not been reported. In the present study, all three exons of the MURR1 gene including the intron-exon boundaries were directly sequenced in 120 unrelated healthy Chinese and 218 unrelated Chinese patients with WD. No mutations were detected in coding and splice site sequence in the human MURR1 gene. A novel polymorphism 3'+119T-->A in the 3' untranslated region (UTR) was identified in three healthy individuals and four patients with two disease-causing mutations in the ATP7B gene and a great diversity of clinical presentations. Of the ATP7B mutations reported here, Gly1268Arg is a novel one. Also, the previously described nucleotide change IVS2+63C-->G was detected in 31.66% of normal chromosomes and 26.15% of WD chromosomes. The results have indicated that there is no correlation between MURR1 and WD in the Chinese population.
Assuntos
Povo Asiático/genética , Degeneração Hepatolenticular/genética , Proteínas/genética , Regiões 3' não Traduzidas , Proteínas Adaptadoras de Transdução de Sinal , Adenosina Trifosfatases/genética , Proteínas de Transporte , Estudos de Casos e Controles , Proteínas de Transporte de Cátions/genética , China/etnologia , ATPases Transportadoras de Cobre , Análise Mutacional de DNA , Éxons , Frequência do Gene , Predisposição Genética para Doença , Humanos , Mutação , Polimorfismo GenéticoRESUMO
OBJECTIVE: To analyze two alleles (4qA and 4qB) distal to D4Z4 of the 4q subtelomere in Chinese population, and to elucidate the interrelationship between these variants of 4qter and facioscapulohumeral muscular dystrophy (FSHD). METHODS: Eighty unrelated healthy individuals from a random Chinese Han population were investigated. The genomic DNA was extracted from peripheral blood lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoRI, HindIII or double digested with EcoRI and BlnI. The cleaved DNA was separated by pulsed field gel electrophoresis (PFGE) and Southern blotting with the probes p13E-11, 4qA and 4qB. The sizes of 4q35 EcoRI/4qA and EcoRI/4qB arrays were obtained by "curve fitting", and the frequencies of alleles and genotypes were calculated. Data were analyzed using a commercially available statistical package (Version 13.0 SPSS). RESULTS: In normal individuals, frequencies of 4qA and 4qB alleles (46.9% and 53.1%) were observed of no significant difference (chi(2) = 1.250, P>0.05). The frequency of 4qA/4qB heterozygote was much higher than that of homozygote (P<0.05). The means of EcoRI/4qA and EcoRI/ 4qB arrays (115.8+/-11.9 kb and 98.3+/-8.6 kb) were of significant difference (t=23.04, P<0.001). 8.8% (7/80) of the individuals displayed a translocation repeat array configuration. 4qB-type EcoRI arrays smaller than 35 kb were found in two individuals. CONCLUSION: The structural polymorphism of 4qA/4qB alleles within 4q35 and 10q26 is confirmed using PFGE in normal Chinese Han population. Although both alleles are almost equally common, shorten 4qB-type EcoRI fragment is not pathogenic. The frequency of 4qA/4qB heterozygote is significantly higher than that of homozygote.
Assuntos
Alelos , Povo Asiático/genética , Cromossomos Humanos Par 4/genética , Etnicidade/genética , Telômero/genética , Adulto , China/etnologia , DNA/genética , DNA/metabolismo , Enzimas de Restrição do DNA/metabolismo , Escherichia coli/enzimologia , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Distrofia Muscular Facioescapuloumeral/genética , Distribuição por SexoRESUMO
BACKGROUND: Facioscapulohumeral muscular dystrophy (FSHD), a common autosomal dominant muscular disorder, is caused by contraction of the D4Z4 repeats on 4q35. The complicated genotype-phenotype correlation among different ethnic population remains a controversial subject. We aimed to refine this correlation in order to provide new information for genetic counseling. METHODS: Here, a cohort of 136 Chinese families including 178 affected individuals and 137 unaffected members were investigated. Genetic analyses were performed using the p13E-11, 4qA and 4qB probes after pulsed field gel electrophoresis separation and southern blotting. A 10-grade FSHD clinical severity scale was adopted for clinical assessment. The genotype-phenotype correlation was established by linear regression analyses. RESULTS: We observed a roughly inversed correlation between the short EcoRI fragment size and age-corrected clinical severity score in 154 symptomatic patients (P < 0.05). Compared to male patients, a significant higher proportion of females in both asymptomatic carriers and severe patients showed larger variation in the size of short EcoRI fragment. A high incidence (19/42, 45.2%) of asymptomatic (or minimally affected) carriers was found in familial members. CONCLUSIONS: Although the number of D4Z4 repeats is known as one of the critical influences on genotype-phenotype correlation, a majority of phenotypic spectrum was still incompatible with their heterozygous contraction of the D4Z4 repeat, especial in female cases. Our results suggest that there are multi-factors synergistically modulating the phenotypic expression.
Assuntos
Distrofia Muscular Facioescapuloumeral/genética , Adolescente , Adulto , Povo Asiático/genética , Criança , Pré-Escolar , Feminino , Estudos de Associação Genética , Humanos , Masculino , Pessoa de Meia-Idade , Distrofia Muscular Facioescapuloumeral/patologia , Fenótipo , Estudos Retrospectivos , Adulto JovemRESUMO
BACKGROUND: The potential for therapy for Wilson disease (WD) emphasizes the importance of presymptomatic diagnosis in families with WD (WD families). OBJECTIVES: To investigate the feasibility of presymptomatic DNA diagnosis and evaluate the efficacy of zinc sulfate therapy in WD families. METHODS: Seventy-eight clinically unaffected siblings were studied from 51 unrelated WD families that were ascertained by affected individuals. The diagnosis in presymptomatic patients was established by a combination of direct mutational analysis and haplotype analysis with 3 short tandem repeat markers. The presymptomatic patients were treated with 50 mg of elemental zinc sulfate twice a day from the time of molecular diagnosis and followed up for 3 to 5 years. RESULTS: Of the 78 siblings, 17 were diagnosed as presymptomatic patients. Kayser-Fleischer rings were absent in 7 and faint in 4 of the 17 presymptomatic patients. The serum ceruloplasmin values gradually increased and 24-hour urinary copper values gradually diminished during zinc therapy, which indicate effective control of copper metabolism. None of the siblings developed clinical symptoms of WD or adverse effects from zinc therapy. CONCLUSION: We conclude that presymptomatic DNA diagnosis and zinc therapy are effective treatment of patients with WD.
Assuntos
Degeneração Hepatolenticular/diagnóstico , Degeneração Hepatolenticular/tratamento farmacológico , Sulfato de Zinco/uso terapêutico , Adolescente , Adulto , Povo Asiático , Ceruloplasmina/metabolismo , Criança , Cobre/urina , Feminino , Seguimentos , Haplótipos , Degeneração Hepatolenticular/genética , Degeneração Hepatolenticular/prevenção & controle , Humanos , Masculino , Polimorfismo Conformacional de Fita SimplesRESUMO
OBJECTIVE: To elucidate the structural polymorphism of EcoR I fragment within chromosomes 4q35 and 10q26 in the Chinese population and investigate the relationship of plasticity, translocation and somatic mosaicism in these domains with deletion of D4Z4 repeated units. METHODS: One hundred and ten unrelated healthy individuals from a random Chinese population were investigated. The genomic DNA was extracted from peripheral blood lymphocytes according to the specific procedure designed to minimize DNA shearing, then digested with EcoR I or double digested with EcoR I and Bln I. The cleaved DNA was separated by pulsed field gel electrophoresis (PFGE) and Southern blotted with the probe p13E-11. The sizes of EcoR I fragments were calculated by "curve fitting" according to the MidRange PFG marker and the alleles were assigned to their respective chromosomes based on their Bln I sensitivity. Data were analyzed using a commercially available statistical package (Version 11.0 SPSS). RESULTS: Seventy-seven point three per cent (85/110) of the unrelated healthy individuals displayed a standard configuration distribution. The mean and median of 4q35 repeat arrays are (87.9+/-3.3) kb and 78.5 kb respectively, whereas the mean and median of 10q26 homologous arrays are (90.1+/-4.1) kb and 73.0 kb. Repeat size distributions between both of them were of no significance according to the t test (P>0.05). 19.1% (21/110) of the individuals displayed a translocation repeat array configuration on chromosomes 4 and 10. No significant difference was detected between 4q-->10q translocation and 10q-->4q translocation according to Chisquare test (Chi2 test=0.053, P>0.05). Somatic mosaicism was observed in 3.6% (4/110) of the subjects and less than 35 kb 10-type array was found in 14.5% (16/110) of the individuals. CONCLUSION: The structural polymorphism and dynamic behaviors of EcoR I fragments within 4q35 and 10q26 were demonstrated in this study using PFGE. The occurrence of frequent translocations and somatic mosaicism between 4q35 and 10q26 subtelomeric domains in the Chinese population further confirmed that mitotic interchromosomal gene conversion or translocation might be a major mechanism relating to the deletion of D4Z4 units.
Assuntos
Povo Asiático/genética , Cromossomos Humanos Par 10 , Cromossomos Humanos Par 4 , Desoxirribonuclease EcoRI/metabolismo , Mosaicismo , Adulto , Eletroforese em Gel de Campo Pulsado , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Distrofia Muscular Facioescapuloumeral/genética , Polimorfismo Genético , Translocação GenéticaRESUMO
OBJECTIVE: To study the changes of the intramembrane protein particles of erythrocyte from Duchenne muscular dystrophy (DMD) patients and the gene carriers and to explore the pathogenesis of DMD and the diagnostic value of erythrocyte freeze-fracture technology. METHODS: The fixed erythrocyte mass was treated to form replica membrane by means of the freeze-fracture technology. Then the replica membrane was observed and a picture was taken under electron microscope. The protein particles of extracellular face(EF) and protoplasmic face(PF) per square were counted. The statistical comparative analysis was performed. RESULTS: The protein particle counts of EF face and PF face of erythrocyte membrane from DMD patients and DMD carriers decreased obviously in comparison with the normal control group (P<0.001). CONCLUSION: The erythrocyte freeze-fracture electron microscopic technology may serve as a method for accessory examination of diagnosing DMD patients and a method for detecting DMD carriers. This investigation material supplies reliable evidence for the theory of the systemic membrane defect of DMD.
Assuntos
Membrana Eritrocítica/metabolismo , Heterozigoto , Proteínas de Membrana/metabolismo , Distrofia Muscular de Duchenne/metabolismo , Membrana Eritrocítica/ultraestrutura , Feminino , Humanos , Masculino , Microscopia Eletrônica , Distrofia Muscular de Duchenne/diagnóstico , Distrofia Muscular de Duchenne/genéticaRESUMO
OBJECTIVE: To investigate the correlation between genotype and phenotype of patients with Wilson disease (WD) in the Chinese population. METHODS: Using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and subsequent direct sequencing to identify the mutations of ATP7B. Statistical analysis was performed using t test or chi(2) test. RESULTS: The common mutation Arg778Leu was homozygous in 18 patients. It was also found to be heterozygous in 29 patients. 11 of 29 patients who carried another missense mutation in the other chromosome were regarded as Arg778Leu compound heterozygotes. We observed that the average age at onset in Arg778Leu homozygotes was significantly younger than that in Arg778Leu compound heterozygotes (P < 0.05). The average ceruloplasmin level of Arg778Leu homozygotes was significantly lower than that of Arg778Leu compound heterozygotes (P < 0.001). CONCLUSION: The result shows that Arg778Leu homozygotes are associated with the early onset of WD with hepatic presentation. The Arg778Leu mutation is not a mild mutation. It has severe effects on the function of ATP7B.
Assuntos
Degeneração Hepatolenticular/genética , Mutação , Adolescente , Adulto , Criança , Pré-Escolar , Feminino , Genótipo , Humanos , Masculino , Fenótipo , Reação em Cadeia da Polimerase , Polimorfismo Conformacional de Fita SimplesRESUMO
OBJECTIVE: To investigate the translocation between chromosomes 4q and 10q and its putative correlation with facioscapulohumeral muscular dystrophy (FSHD). METHODS: Double digestion of the genomic DNA of 50 controls and 45 FSHD cases, 16 cases of sporadic FSHD and 19 cases of familial FSHD from 7 families, with restriction enzymes BglII and BlnI was followed by separation and Southern blotting with the probe p13E-11. By Scion Image program, the density of hybridized fragments was analyzed and the 4q:10q density ratio was then calculated to infer the types of 4q-10q translocation. The frequencies of translocation among the controls, sporadic FSHD cases, and familial cases were compared. RESULTS: In the 95 subjects 4 different translocation types were detected with a translocation rate of 17.89%. Both the rate of 4q-->10q translocation and the rate of 10q-->4q translocation were 8.0% among the healthy controls. Only 4q-->10q translocation was found in sporadic FSHD cases with a frequency of 43.75%, while only 10q-->4q translocation was found in familial FSHD patients with a frequency of 6.89%. The frequency of 4q-->10q translocation in the sporadic FSHD cases was significantly higher than that in the control group (chi(2) = 11.154, P < 0.001), while the frequency of 10q-->4q translocation in the familial FSHD cases was not significantly different from that in the controls (chi(2) = 0.012, P > 0.5). CONCLUSION: Frequent translocations between chromosomes 4q and 10q occur in normal population and FSHD cases, while the 4q-->10q translocation is only related to sporadic FSHD. Excessive loss or conversion (to 10q26) of 4q35 D4Z4 repeats, caused by 4q-10q interactions, may be essential for the mechanism of this disorder.
Assuntos
Cromossomos Humanos Par 10 , Cromossomos Humanos Par 4 , Distrofia Muscular Facioescapuloumeral/genética , Translocação Genética , Adolescente , Adulto , Idoso , Feminino , Humanos , Masculino , Pessoa de Meia-IdadeRESUMO
Spinal muscular atrophy with respiratory distress type 1 (SMARD1), a notably common form of non-5q-spinal muscular atrophy, can be confused with infantile spinal muscular atrophy and is characterized by the early onset of diaphragmatic palsy and predominantly distal muscle weakness. The defective gene, immunoglobulin mu-binding protein 2 (IGHMBP2), is located on chromosome 11q13-q21. In this study, we screened the IGHMBP2 gene in 53 unrelated Han Chinese non-5q-spinal muscular atrophy patients and 100 healthy controls. Two novel mutations (c.711+1G>C and c.1817G>A) and 5 nucleotide polymorphisms (c.57T>C, c.1554C>T, c.1914G>A, c.2080C>T, and c.2270G>C) were identified. However, only 1 patient harbored the compound heterozygous mutations (c.711+1G>C, c.1817G>A). Furthermore, the homozygous c.2636C>A (p.T879 K) variation, which has been included as a mutation in the Human Gene Mutation Database, was found both in patients and healthy individuals. In conclusion, the IGHMBP2 gene was not found to be a major causative gene linked to Han Chinese non-5q-spinal muscular atrophy patients.
Assuntos
Proteínas de Ligação a DNA/genética , Atrofia Muscular Espinal/genética , Mutação/genética , Fatores de Transcrição/genética , Adolescente , Povo Asiático/etnologia , Povo Asiático/genética , Criança , Pré-Escolar , Análise Mutacional de DNA , Feminino , Frequência do Gene , Genótipo , Humanos , Lactente , Recém-Nascido , Masculino , Atrofia Muscular Espinal/etnologiaRESUMO
Many major inherited neurological disorders are characterized by early childhood onset, high lethality rate, and the absence of effective treatments. A poor understanding of the underlying mechanisms of such disorders is partly because of the scarcity of patient-specific samples. In this study, we cultured the urine sediments of such patients, aiming to explore the capacity of urine cell cultures to obtain specimens from patients suffering from rare inherited neurological diseases. We collected fresh urine from a variety of neurogenetic patients; cultured the specimens; generated different urine cell lines; and classified these cell lines through morphology, reverse transcription-PCR, and immunofluorescence. We then used these cell lines to detect the affected genes in spinal muscular atrophy and Duchenne muscular dystrophy. We successfully established cell lines from patients with spinal muscular atrophy, Duchenne muscular dystrophy, paroxysmal kinesigenic dyskinesia, and Wilson's disease. All established cell lines consisted of urinary tract epithelial cells and podocytes, and had the same gene defects as the blood specimens. Urine cell culture is thus a new, simple, and noninvasive avenue for getting patient-specific samples not only for genetic diagnosis, but also for storing the samples from patients with rare neurological inherited diseases.
Assuntos
Técnicas de Cultura de Células/métodos , Linhagem Celular/citologia , Doenças do Sistema Nervoso/urina , Urina/citologia , Imunofluorescência , Humanos , Doenças do Sistema Nervoso/genética , Reação em Cadeia da Polimerase Via Transcriptase ReversaRESUMO
Spinal muscular atrophy (SMA) is a common and lethal autosomal recessive neurodegenerative disorder, which is caused by mutations of the survival motor neuron 1 (SMN1) gene. Additionally, the phenotype is modified by several genes nearby SMN1 in the 5q13 region. In this study, we analyzed mutations in SMN1 and quantified the modifying genes, including SMN2, NAIP, GTF2H2, and H4F5 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), multiplex ligation-dependent probe amplification (MLPA), TA cloning, allele-specific long-range PCR, and Sanger sequencing in 157 SMA patients. Most SMA patients (94.90%) possessed a homozygous SMN1 deletion, while 10 patients demonstrated only the absence of exon 7, but the presence of exon 8. Two missense mutations (c.689 C>T and c.844 C>T) were identified in 2 patients who both carried a single copy of SMN1. We found inverse correlations between SMN2, the NAIP copy number, and the clinical severity of the disease. Furthermore, 7 severe type I patients possessed large-scale deletions, including SMN1, NAIP, and GTF2H2. We conclude that SMN1 gene conversion, SMN1 subtle mutations, SMN2 copy number, and the extent of deletion in the 5q13 region should all be considered in the genotype-phenotype analysis of SMA.
Assuntos
Predisposição Genética para Doença , Atrofia Muscular Espinal/genética , Adolescente , Adulto , Criança , Pré-Escolar , Variações do Número de Cópias de DNA , Feminino , Genótipo , Humanos , Lactente , Recém-Nascido , Masculino , Mutação de Sentido Incorreto , Proteínas do Tecido Nervoso/genética , Proteína Inibidora de Apoptose Neuronal/genética , Fenótipo , Deleção de Sequência , Proteína 1 de Sobrevivência do Neurônio Motor/genética , Proteína 2 de Sobrevivência do Neurônio Motor/genética , Fator de Transcrição TFIIH/genética , Fatores de Transcrição/genética , Adulto JovemRESUMO
BACKGROUND: Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. METHODS: Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. RESULTS: Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. CONCLUSION: The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.