An indirect ELISA for detecting anti-SARS-CoV-2 antibodies in human sera using a baculovirus-expressed recombinant nucleocapsid antigen.

This study focuses on the development and initial assessment of an indirect IgG enzyme-linked immunosorbent assay (ELISA) specifically designed to detect of anti-SARS-CoV-2 antibodies. The unique aspect of this ELISA method lies in its utilization of a recombinant nucleocapsid (N) antigen, produced through baculovirus expression in insect cells. Our analysis involved 292 RT-qPCR confirmed positive serum samples and 54 pre-pandemic healthy controls. The process encompassed cloning, expression, and purification of the SARS-CoV-2 N gene in insect cells, with the resulted purified protein employed in our ELISA tests. Statistical analysis yielded an Area Under the Curve of 0.979, and the optimized cut-off exhibited 92 % sensitivity and 94 % specificity. These results highlight the ELISA's potential for robust and reliable serological detection of SARS-CoV-2 antibodies. Further assessments, including a larger panel size, reproducibility tests, and application in diverse populations, could enhance its utility as a valuable biotechnological solution for diseases surveillance.

Complete genome sequence of mimosa mosaic virus, a new sobemovirus infecting Mimosa sensitiva L.

A new sobemovirus, which we have named "mimosa mosaic virus" (MimMV), was found by high-throughput sequencing and isolated from a mimosa (Mimosa sensitiva L.) plant. The genome sequence was confirmed by Sanger sequencing and comprises 4595 nucleotides. Phylogenetic analysis based on the predicted amino acid (aa) sequences of the P2b protein (encoded by ORF2b) and the coat protein showed 52.7% and 31.8% aa sequence identity, respectively, to those of blueberry shoestring virus. The complete genome sequence of MimMV was less than 47% identical to those of other sobemoviruses. These data suggest that MimMV is a member of a new species in the genus Sobemovirus, for which the binomial name "Sobemovirus mimosae" is proposed.

Biological and molecular characterization of a new potexvirus isolated from Adenium obesum.

Adenium obesum plants showing virus-like symptoms were collected in several regions of Brazil. Mottling symptoms like those observed in symptomatic plants in the field were reproduced in mechanically inoculated A. obesum plants. This potexvirus was named "desert rose mottle virus" (DRMoV), and its genome sequence was first determined by high-throughput sequencing and then confirmed by Sanger sequencing. The complete genome of DRMoV is 6,781 nt in length, excluding the poly(A) tail, and five ORFs were predicted in order from 5' to 3': Rep-TGB1-TGB2-TGB3-CP. Phylogenetic analysis based on Rep amino acid sequences showed different clustering among potexviruses. These data suggest that RDMoV is a new member of the genus Potexvirus, and the binomial name "Potexvirus adenii" is proposed for its species.

Construction of an infectious full-length cDNA clone of a recombinant isolate of cucurbit aphid-borne yellows virus from Brazil.

In Brazil, the main viral disease of melon plant is severe yellowing disease called "Amarelão do Meloeiro," and a polerovirus, cucurbit aphid-borne yellows virus (CABYV) was considered one of the etiological agents. This virus is a recombinant strain originated from CABYV and unknown polerovirus. Due to unsuccessful mechanical inoculations of CABYV to host plants, the study of its biological characterization is hampered. Therefore, an infectious clone of the recombinant strain of CABYV was constructed using the Gibson Assembly technology. The full-length cDNA clones produced in this study showed to be infectious in three cucurbit species; melon (Cucumis melo), squash (a hybrid of Cucurbita maxima × C. moschata), and West Indian gherkin (Cucumis anguria) plants, but not in watermelon, cucumber, and zucchini plants. This insusceptibility of watermelon plants to the infectious clone corroborates the observation that this virus was never found in watermelon plants often located next to the infected melon plants. This infectious clone provides important tools for future study in developing resistant melon variety to CABYV infection.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

Complete genome sequence of patchouli chlorosis-associated cytorhabdovirus, a new cytorhabdovirus infecting patchouli plants in Brazil.

A cytorhabdovirus, tentatively named "patchouli chlorosis-associated cytorhabdovirus" (PCaCV), was identified in a patchouli plant, using high-throughput sequencing, and its genome sequence was confirmed by Sanger sequencing. The PCaCV genome consists of 12,913 nucleotides and contains six open reading frames in the order 3'-N-P'-P-P3-M-(G)-L-5'. The glycoprotein gene was found to contain stop codons in the coding frame; hence, this gene is considered defective. PCaCV is most closely related to tomato yellow mottle-associated virus, sharing 61.1% nucleotide sequence identity in the complete genome and 73.9% amino acid sequence identity in the L protein. These data suggest that PCaCV should be considered a new member of the genus Cytorhabdovirus, and the binomial species name "Cytorhabdovirus patchoulii" is proposed.

Characterization of yam mosaic viruses from Brazil reveals a new phylogenetic group and possible incursion from the African continent.

Yam (Dioscorea spp.) is an important crop for smallholder farmers in the Northeast region of Brazil. Wherever yam is grown, diseases caused by yam mosaic virus (YMV) are prevalent. In the present study, the diversity of YMV infecting Dioscorea cayennensis-rotundata was analyzed. In addition, five species of Dioscorea (D. alata, D. altissima, D. bulbifera, D. subhastata, and D. trifida) commonly found in Brazil were analyzed using ELISA and high-throughput sequencing (HTS). YMV was detected only in D. cayennensis-rotundata, of which 66.7% of the samples tested positive in ELISA. Three YMV genome sequences were assembled from HTS and one by Sanger sequencing to group the sequences in a clade phylogenetically distinct from YMV from other origins. Temporal phylogenetic analyses estimated the mean evolutionary rate for the CP gene of YMV as 1.76 × 10-3 substitutions per site per year, and the time to the most recent common ancestor as 168.68 years (95% Highest Posterior Density, HPD: 48.56-363.28 years), with a most likely geographic origin in the African continent. The data presented in this study contribute to reveal key aspects of the probable epidemiological history of YMV in Brazil.

First report of Cotton leafroll dwarf virus infecting cacao (Theobroma cacao L.) trees in Brazil.

Cotton leafroll dwarf virus (genus Polerovirus, family Solemoviridae) has been commonly reported affecting cotton plants (Gossypium spp., family Malvaceae) and several weed species (Ramos-Sobrinho et al., 2021; Sedhain et al., 2021). During a recent survey, cacao (Theobroma cacao L.) trees exhibiting virus-like symptoms such as leaf mosaic, vein clearing, and yellow spot were observed in the south part of the state of Bahia, northeastern Brazil, in 2022. Leaf samples were randomly collected from symptomatic cacao plants (n=30) growing in an affected area of approximately 30 ha. Total RNA obtained from pooled cacao samples were subjected to Illumina HiSeq 2500 sequencing as previously described (Keith et al., 2021), and partial sequences of cotton leafroll dwarf virus (CLRDV), and other virus-specific sequence contigs, were de novo assembled according to Ramos-Sobrinho et al. (2021). To further investigate the presence of CLRDV in cacao leaves, total RNA was individually extracted using a modified silica protocol (Rott and Jelkmann, 2001) and used as template for cDNA synthesis with random hexamers using the SuperScript™ IV First-Strand Synthesis System (Invitrogen, CA, USA) following the manufacturer´s protocol. Detection of CLRDV was carried out by reverse transcription-polymerase chain reaction (RT-PCR) with the primers PL4F and o3-R, which amplify the open reading frame 3 (ORF3) encoding the capsid protein (Corrêa et al., 2005). Expected size amplicons (~0.6 kb) were observed from 16 out of 30 symptomatic plants, indicating ~53% of the cacao trees were infected by CLRDV. Considering 14 symptomatic plants tested negative for CLRDV, the symptoms observed here could also be caused by other viral groups or abiotic stress. To confirm the detection of CLRDV, the first half (~3.5kb) of the viral genome was amplified from two representative cacao samples using the primers P20F and P22R (Avelar et al., 2020). The RT-PCR products were gel-purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, WI, USA) and Sanger sequenced. The RNA Illumina sequencing from pooled cacao samples (n=30) yielded 34,610,572 million trimmed reads. Two contigs of 868 and 839 nucleotides (nt) in length, and sharing high nt identity with CLRDV isolates, were assembled from 6,903 and 10,271 reads, at a coverage depth of 795 and 1,224x, respectively. Together, these contigs represent ~29% of the complete viral genome and included part of the 5´-untraslated region, ORF0 and the second half of ORF1-ORF2. Additional CLRDV-like contigs were observed across the viral genome, but they were not considered for further analyses due to the poor sequence quality. The Illumina- and Sanger-derived ORF0 and partial ORF1-ORF2 sequences shared >97% nt identity, suggesting they were congruent. Pairwise sequence comparisons for ORF0, encoding the gene silencing suppressor P0, indicated the cacao-associated isolates shared 99.7 and 99.2% nt and amino acid (aa) identity one with another, respectively. The ORF0 nt sequences showed 91.9-93.8 and 90.7-93.6% identity, while the aa sequences shared 85.8-88.5 and 86.2-90.0% similarity, with CLRDV isolates previously reported in South America and the USA, respectively. Finally, the ~3.5kb nt sequences of cacao-infecting CLRDV isolates shared 92.9-95.8% identity with CLRDV genomes deposited in NCBI-GenBank. The Bayesian phylogenetic tree reconstructed based on ORF0 nt sequences showed the new sequences were more closely related to CLRDV-atypical isolates (GenBank accession nos. KF359946, KF359947, KF906260, and KF906261). Together, these results suggest the new ORF0 sequences belong to CLRDV and were deposited in GenBank under accession nos. ON954058-ON954059. To our knowledge, this is the first report of CLRDV infecting cacao plants, expanding the range of malvaceous hosts of this polerovirus. CLRDV is largely known for causing yield losses in cotton crops, but additional studies are needed to determine if CLRDV infection is detrimental to cacao production.

Tobamoviruses of two new species trigger resistance in pepper plants harbouring functional L alleles.

Tobamoviruses are often referred to as the most notorious viral pathogens of pepper crops. These viruses are not transmitted by invertebrate vectors, but rather by physical contact and seeds. In this study, pepper plants displaying mild mottle and mosaic symptoms were sampled in four different regions of Peru. Upon double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) tests, seven samples cross-reacted weakly with antibodies against pepper mild mottle virus (PMMoV), suggesting the presence of tobamoviruses. When employing RT-PCR, conserved primers amplified cDNA fragments of viruses from two putative new tobamovirus species in the samples. The complete genome of two representative isolates were, therefore, sequenced and analysed in silico. These viruses, which were tentatively named yellow pepper mild mottle virus (YPMMoV) and chilli pepper mild mottle virus (CPMMoV), shared highest nucleotide genome sequence identities of 83 and 85 % with bell pepper mottle virus (BpeMV), respectively. Mechanical inoculation of indicator plants with YPMMoV and CPMMoV isolates did not show any obvious differences in host ranges. These viruses were also inoculated mechanically on pepper plants harbouring different resistance L alleles to determine their pathotypes. Pepper plants carrying unfunctional L alleles (L0) to tobamoviruses were infected by all isolates and presented differential symptomatology for YPMMoV and CPMMoV. On the other hand, pepper plants carrying L1, L2, L3 and L4 alleles were resistant to all isolates, indicating that these viruses belong to pathotype P0.

Nanopore sequencing of tomato mottle leaf distortion virus, a new bipartite begomovirus infecting tomato in Brazil.

During a survey in a tomato field in Luziânia (Goiás State, Brazil), a single plant with mottling, chlorotic spots, and leaf distortion was found. A new bipartite begomovirus sequence was identified using nanopore sequence technology and confirmed by Sanger sequencing. The highest nucleotide sequence identity match of the DNA-A component (2596 bases) was 81.64% with tomato golden leaf deformation virus (HM357456). Due to the current species demarcation criterion of 91% nucleotide sequence identity for DNA-A, we propose this virus to be a new member of the genus Begomovirus, named "tomato mottle leaf distortion virus".

Complete genome sequences of three newly discovered cacao mild mosaic virus isolates from Theobroma cacao L. in Brazil and Puerto Rico and evidence for recombination.

To analyze the DNA virome associated with cacao (Theobroma cacao L.) trees showing virus-like symptoms in Brazil (BR) and Puerto Rico (PR) during 2018-2019, total DNA was isolated from symptomatic leaves and subjected to high-throughput Illumina sequencing. The assembled complete badnaviral genome sequences were verified by PCR amplification, cloning, and DNA sequencing. Based on pairwise distances and phylogenetic analysis, three badnaviral genomes were identified, and these viruses were found to be isolates of the previously described cacao mild mosaic virus (CaMMV). The three genomes were 7,520, 7,524, and 7,514 bp in size for the isolates CaMMV-BR321, CaMMV-BR322, and CaMMV-PR3, respectively. Each genome contained four predicted open reading frames: ORFs 1-3 and ORFY. The CaMMV-PR3 isolate was identified as a probable recombinant, with a CaMMV-BR-like virus as the major parent.

Characterization of an infectious clone of pepper ringspot virus and its use as a viral vector.

The genus Tobravirus comprises three species: Tobacco rattle virus, Pea early-browning virus and Pepper ringspot virus. The genomes of tobraviruses consist of two positive-sense single-stranded RNA segments (RNA1 and RNA2). Infectious clones of TRV are extensively used as virus-induced gene-silencing (VIGS) vectors for studies of virus-host interactions and functions of plant genes. Complete infectious clones of pepper ringspot virus (PepRSV), the only tobravirus present in Brazil, however, have not yet been reported. Infectious clones will help to identify unique features of PepRSV RNA2 and provide another option for development of VIGS vectors. We constructed infectious clones based on two PepRSV isolates, CAM (RNA1 and RNA2) and LAV (RNA2). The cDNA constructs for both homologous (RNA1 and RNA2 of the CAM isolate) and heterologous (RNA1/CAM and RNA2/LAV) combinations were infectious in Nicotiana benthamiana plants. VIGS vector constructs with green fluorescent protein or phytoene desaturase genes inserted in RNA2 silenced the target genes. The systemic translocation of the PepRSV RNA1 construct alone (nonmultiple infection) was also confirmed in an N. benthamiana plant. These results are similar to those reported for tobacco rattle virus.

Near-complete genome sequence and biological properties of an allexivirus found in Senna rizzinii in Brazil.

Senna rizzinii is a flowering shrub found mainly in the northeast region of Brazil. Here, we report the coding-complete genome sequence, particle morphology, mode of transmission, and the indicator host responses of an isolate of the putative allexivirus cassia mild mosaic virus (CaMMV) found in S. rizzinii. The virus was transmitted mechanically to Chenopodium amaranticolor, C. quinoa, Gomphrena globosa, which showed local lesions, and S. rizzinii, and S. occidentalis, which were infected systemically. It was also efficiently transmitted to S. rizzinii by grafting. Seed transmission was not observed. The near-complete genome sequence of the virus is 7829 nucleotides in length, containing six open reading frames (ORF), like other allexiviruses.

Date palm virus A: first plant virus found in date palm trees.

In this work, a novel ssRNA (+) viral genomic sequence with gene organization typical of members of the subfamily Quinvirinae (family Betaflexiviridae) was identified using high- throughput sequencing data of date palm obtained from the Sequence Read Archive database. The viral genome sequence consists of 7860 nucleotides and contains five ORFs encoding for the replication protein (Rep), triple gene block proteins 1, 2, 3 (TGB 1, 2, and 3), and coat protein (CP). Phylogenetic analysis based on the Rep and the CP amino acid sequences showed the closest relationship to garlic yellow mosaic-associated virus (GYMaV). Based on the demarcation criteria of the family Betaflexiviridae, this new virus, provisionally named date palm virus A (DPVA), could constitute a member of a novel genus. However, considering that DPVA and GYMaV share the same genomic organization and that they cluster together on the Rep phylogenetic analysis, they could also constitute a novel genus together, highlighting the necessity of a revision of the taxonomic criteria of the family Betaflexiviridae.

Dengue and Zika virus multi-epitope antigen expression in insect cells.

Dengue virus and Zika virus are arthropod-borne flaviviruses that cause millions of infections worldwide. The co-circulation of both viruses makes serological diagnosis difficult as they share high amino acid similarities in viral proteins. Antigens are one of the key reagents in the differential diagnosis of these viruses through the detection of IgG antibodies in serological assays during the convalescent-phase of infections. Here, we report the expression of Dengue virus (DENV) and Zika virus (ZIKV) antigens containing non-conserved and immunodominant amino acid sequences using the baculovirus expression vector system in insect cells. We designed DENV and ZIKV antigens based on the domain III of the E protein (EDIII) after analyzing previously reported epitopes and by multiple alignment of the most important flaviviruses. The ZIKV and DENV multi-epitope genes were designed as tandem repeats or impaired repeats separated by tetra- or hexa-glycine linkers. The biochemical analyses revealed adequate expression of the antigens. Then, the obtained multi-epitope antigens were semi-purified in a sucrose gradient and tested using patients' sera collected during the convalescent-phase that were previously diagnosed positive for anti-DENV and -ZIKV IgG antibodies. The optimal serum dilution was 1:200, and the mean absorbance values in the preliminary tests show that multi-epitope antigens have been recognized by human sera. The production of both antigens using the multi-epitope strategy in the eukaryotic system and based on the EDIII regions provide a proof of concept for the use of antigens in the differentiation between DENV and ZIKV.

First report of grapevine associated jivivirus 1 infecting grapevines in Brazil.

Grapevines can host up to 86 virus species, some of which affect plant vigor, production and fruit quality (Fuchs, 2020). In 2014, a Vitis vinifera cv. Semillon vine showing yellow speckles and mild leafroll symptoms in Bento Gonçalves, RS, Brazil, was investigated for viruses (Silva et al., 2017), resulting in the detection of grapevine enamovirus 1, grapevine yellow speckle viroid 1 and hop stunt viroid. Total nucleic acids (TNA) extracts from this sample were enriched for dsRNA (Valverde et al., 1990), prepped with TruSeq Stranded mRNA kit (Illumina, USA), then subjected to high throughput sequencing (HTS) on the Illumina HiSeq 2000 platform. The HTS yielded 13,214 Mbp raw reads, which were trimmed and the host derived sequences subtracted with Trimmomatic and Burrows-Wheeler Aligner softwares, respectively. The remaining reads were subjected to taxonomic assignment with the Kaiju webserver, preliminarily indicating 26 reads related to citrus virga-like virus (Matsumura et al., 2017). De novo assembled contigs built by SPAdes generated five contigs that were subjected to tBLASTx searches against the NCBI viral RefSeq. Four sets of primers were designed to sequence the gaps between these contigs and the PCR amplicons were sequenced by Sanger method resulting in two long contigs. A third long contig related to citrus jingmen-like virus (Matsumura et al., 2017) was also retained for further analysis. BLASTn analyses of the assembled virus contigs showed that they are closely related to grapevine associated jivivirus 1 (GaJV-1) (Chiapello et al, 2020). The derived partial tripartite genomic sequences of GaJV-1 isolate SEM-BR from Brazil (GenBank acc. nos. MT657278-MT657280) covered 84.4% (3424 nt), 40.3% (1289 nt) and 73% (1555 nt) of RNAs 1, 2 and 3 of isolate DMG 109 from Italy (MN520745-MN520747), respectively. The pairwise nt sequence identities between both isolates were 99.3% (RNA1), 97.1% (RNA2) and 100% (RNA3), indicating that they are highly identical to each other. To confirm the HTS results, fresh TNA extracts from SEM-BR and four newly sampled vines were screened by RT-PCR using specific primers F (5'GGACGAAGTCACAACCAACACAGTTT3') and R (5'CGCGAGTAGGTCTGACAACTTTCATTAT3'), designed based on GaJV-1 RNA1. The resulting 478 bp amplicons were sequenced (MT657281-MT657285) and found to share 99.4%-99.8% nt identities with the corresponding sequences of GaJV-1 SEM-BR (MT657278). To assess graft-transmissibility of GaJV-1, Semillon scions of SEM-BR source vine were grafted onto 14 GaJV-1-free 1103P rootstocks. Six of 14 recipient plants (all asymptomatic) tested positive for GaJV-1 by RT-PCR 106 days after grafting. Additionally, RT-PCR screening of a Brazilian grapevine collection block resulted in the detection of GaJV-1 in nine of 33 tested vines of different accessions (27.3%). The GaJV-1 positive vines included eight commercial cultivars (Ancelotta, Aragonez, Merlot, Semillon, Michele Palieri, Malvasia, Viognier, and Pinot Nero). This is the first report of GaJV-1 in Brazil, a virus that was recently described in Italy and Spain (Chiapello et al, 2020). Our results also demonstrated the graft-transmissible nature of the virus but it is unclear if GaJV-1 is associated to grapevine plant cells or strictly to a possible grapevine fungal endophyte. Additional studies on the GaJV-1 prevalence in commercial vineyards in Brazil and possible effects of the virus on grapevines are necessary. References: Chiapello, M., et al. 2020. Annals of Applied Biology 176:180. https://doi.org/10.1111/aab.12563 Fuchs, M. 2020. J. Plant Pathol. https://doi.org/10.1007/s42161-020-00579-2 Matsumura, E.E., et al. 2017. Viruses 9:92. https://doi.org/10.3390/v9040092 Silva, J.M.F., et al. 2017. Virus Genes 53:667. https://doi.org/10.1007/s11262-017-1470-y Valverde, R.A., et al. 1990. Plant Dis. 74:255. https://www.apsnet.org/publications/plantdisease/backissues/Documents/1990Articles/PlantDisease74n03_255.PDF.

Complete genome sequence of a new bipartite begomovirus infecting tomato in Brazil.

A novel bipartite begomovirus infecting begomovirus-resistant tomato plants was detected via Illumina sequencing analysis, and its genome sequence was confirmed by Sanger sequencing. The DNA-A (2627 nt) and DNA-B (2587 nt) have a genome organization that is typical of New World bipartite begomoviruses, sharing 82.5% identity with tomato golden leaf distortion virus and 75.1% identity with sida chlorotic vein virus. Based on the current classification criteria for begomoviruses, this isolate should be considered a member of a new species, and the name "tomato interveinal chlorosis virus-2" (ToICV2) is proposed for this virus.

Cucurbit aphid-borne yellows virus from melon plants in Brazil is an interspecific recombinant.

Melon plants with severe yellowing symptoms from in Brazil were analyzed by high-throughput sequencing. Sequences homologous to the genome of the polerovirus cucurbit aphid-borne yellows virus (CABYV) were frequently retrieved. Two draft CABYV genomes were assembled from two pooled melon samples that contained an identical putative recombinant fragment in the 3' region with an unknown polerovirus. The complete genomes of these isolates revealed by Sanger sequencing share 96.8% nucleotide identity, while both sequences share 73.7% nucleotide identity with a CABYV-N isolate from France. A molecular-clock analysis suggested that CABYV was introduced into Brazil ~ 68 years ago.

Assembly of tomato blistering mosaic virus-like particles using a baculovirus expression vector system.

The expression of several structural proteins from a wide variety of viruses in heterologous cell culture systems results in the formation of virus-like particles (VLPs). These VLPs structurally resemble the wild-type virus particles and have been used to study viral assembly process and as antigens for diagnosis and/or vaccine development. Tomato blistering mosaic virus (ToBMV) is a tymovirus that has a 6.3-kb positive-sense ssRNA genome. We have employed the baculovirus expression vector system (BEVS) for the production of tymovirus-like particles (tVLPs) in insect cells. Two recombinant baculoviruses containing the ToBMV wild-type coat protein (CP) gene or a modified short amino-terminal deletion (Δ2-24CP) variant were constructed and used to infect insect cells. Both recombinant viruses were able to express ToBMV CP and Δ2-24CP from infected insect cells that self-assembled into tVLPs. Therefore, the N-terminal residues (2-24) of the native ToBMV CP were shown not to be essential for self-assembly of tVLPs. We also constructed a third recombinant baculovirus containing a small sequence coding for the major epitope of the chikungunya virus (CHIKV) envelope protein 2 (E2) replacing the native CP N-terminal 2-24 amino acids. This recombinant virus also produced tVLPs. In summary, ToBMV VLPs can be produced in a baculovirus/insect cell heterologous expression system, and the N-terminal residues 2-24 of the CP are not essential for this assembly, allowing its potential use as a protein carrier that facilitates antigen purification and might be used for diagnosis.