Predictors for Small Bowel Stenosis in Balloon-Assisted Enteroscopy.

BACKGROUND: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known. AIMS: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy. METHODS: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis. RESULTS: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9). CONCLUSIONS: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight.

Primary experience of small bowel polypectomy with balloon-assisted enteroscopy in young pediatric Peutz-Jeghers syndrome patients.

For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:• Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.• BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:• BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old.

Early screening the small bowel is key to protect Peutz-Jeghers syndrome patients from surgery: a novel mutation c.243delG in STK11 gene.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.

Gender, Age, and Concomitant Diseases of Colorectal Diverticulum in China: A Study of 7,964 Cases.

AIM: To analyze the epidemiological features of colorectal diverticulum (CRD) in China. METHODS: We retrospectively analyzed CRD patients in 8 tertiary hospitals located in 5 regions of China from 2000 to 2016. The detection rates, number and distribution, demographic information, concomitant disorders, and their associations were investigated. RESULTS: Of 3,446,118 cases, 7,964 (2.3%) were CRD with a mean age of 56 years (11-92 years). The detection rate increased yearly and with increasing age. Males had a higher detection rate than females (3.0 vs. 1.47%, p < 0.01) and 1.8-times higher increase rate. The detection rate increased with age; however, females of > 60 years had a 2.8-times increasing rate than males. CRD occurred most frequently in the right-side colon, followed by rectum. Multiple diverticula were common in males and increased with age, with a 3-times higher increase rate than single lesion. Single-segment CRD occurred more frequently in males than in females (80.1 vs. 76.4%, p < 0.01). Concurred colon polyps were seen in 51.05% cases. CONCLUSION: CRD detection rates increased annually and with age, particularly in senior females in China. Multiple diverticula were common in males and increased with age. CRD was predominant in the right-side colon. Polyps are the most common comorbidity associated with CRD.

The altered activity of P53 signaling pathway by STK11 gene mutations and its cancer phenotype in Peutz-Jeghers syndrome.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.

Close and regular surveillance is key to prevent severe complications for Peutz-Jeghers syndrome patients without gastrointestinal polyps: case report of a novel STK11 mutation (c.471_472delCT) in a Chinese girl.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.

Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.

Cancer risk in patients with Peutz-Jeghers syndrome: A retrospective cohort study of 336 cases.

Peutz-Jeghers syndrome is a rare autosomal dominant inherited disorder characterized by mucocutaneous pigmentation and hamartomatous gastrointestinal polyposis. A growing body of evidence has shown that Peutz-Jeghers syndrome could cause an increased risk of various cancers, yet the range of cancer risk estimates was wide among different studies. In this retrospective cohort study, 336 patients with Peutz-Jeghers syndrome in China were enrolled. The clinical characteristics, cancer spectrum, relative cancer risks, and cumulative cancer risks were analyzed. In total, 52 patients were diagnosed of cancer in the follow-up period, at a median age of 41 years (range: 21-67). The relative risk for cancer in Peutz-Jeghers syndrome patients was 63.858 (confidence interval: 47.514-85.823), and the cumulative cancer risk at the age of 60 years was 55%. Colorectal cancer was the most common cancer for Peutz-Jeghers syndrome patients (relative risk: 237.918, confidence interval: 154.417-366.572) and the cumulative cancer risk at the age of 60 years was 28%. There was a statistically significant difference in the cumulative cancer risk between patients with family history and those without family history, as well as between patients living in rural area and those living in urban areas ( p < 0.05), while no significant effects of gender and intussusception history on the cumulative cancer risk was found ( p > 0.05). Hopefully, our study may contribute to the management of this rare disorder and establishment of related surveillance projects, especially in China.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Extracorporeal shock wave lithotripsy is a safe and effective treatment for pancreatic stones coexisting with pancreatic pseudocysts.

BACKGROUND AND AIMS: We aimed to investigate outcomes of pancreatic extracorporeal shock wave lithotripsy (P-ESWL) for the removal of large pancreatic stones coexisting with pancreatic pseudocysts (PPCs) in chronic pancreatitis (CP). METHODS: This is a prospective study performed in CP patients with at least 1 stone (≥5 mm). Patients were divided into the PPC group (stones coexisting with PPCs) or the control group (stones alone). Patients were initially subjected to successive P-ESWL treatments, followed by ERCP. Primary outcomes were P-ESWL adverse events, and secondary outcomes were stone clearance, long-term pain relief, improved quality-of-life scores, and PPC regression. RESULTS: A total of 849 patients (59 in the PPC group and 790 in the control group) was subjected to P-ESWL between March 2011 and October 2013. Occurrences of P-ESWL adverse events were similar between the PPC group and the control group (11.86% vs 12.41%, P = .940). After the treatment of initial P-ESWL combined with ERCP, the complete, partial, and nonclearance of stones occurred in 67.24%, 20.69%, and 12.07%, respectively, of patients in PPC group, with no significant difference from the control group (complete, partial, and nonclearance: 83.17%, 10.40%, and 11.39%, respectively; P = .106). Fifty-five of 59 patients (93.22%) with PPCs were followed for a median period of 21.9 months (range, 12.0-45.1). PPCs disappeared in 56.36% (31/55) and 76.36% (42/55) of patients after 3 months and 1 year of follow-up visits, respectively. Moreover, complete and partial pain relief were achieved in 63.64% (35/55) and 25.45% (14/55) of patients, respectively. The scores for quality of life (P < .001), physical health (P < .001), and weight loss (P < .001) improved. CONCLUSIONS: In our multispecialty tertiary center, initial P-ESWL followed by ERCP was safe in patients with coexisting pancreatic stones and PPCs and effective for stone clearance, main pancreatic duct drainage, and pain relief.

Balloon-assisted enteroscopy-based endoscopic stricturotomy for deep small bowel strictures from Crohn's disease: First cohort study of a novel approach.

BACKGROUND: There is little data on the role of endoscopic stricturotomy (ES) in treating deep small bowel strictures. We aimed to investigate the efficacy and safety of balloon-assisted enteroscopy-based ES (BAE-based ES) for deep small bowel strictures associated with Crohn's disease (CD). METHODS: This multicentre retrospective cohort study included consecutive patients with CD-associated deep small bowel strictures treated with BAE-based ES between 2017 and 2023. The outcomes included technical success, clinical improvement, surgery-free rate, reintervention-free rate, and adverse events. RESULTS: Twenty-eight patients with CD underwent 58 BAE-based ES procedures for non-passable deep small bowel strictures, with a median follow-up time of 519.5 days (interquartile range, 306-728 days). Fifty-six (96.0%) procedures were technically successful in 26 (92.9%) patients. Twenty patients (71.4%) showed clinical improvement at week 8. The cumulative surgery-free rate at 1 year was 74.8% (95% confidence interval [CI], 60.3-92.9%). A higher body mass index was associated with a decreased need for surgery (hazard ratio = 0.084, 95% CI, 0.016-0.45, P = 0.0036). Postprocedural adverse events (bleeding and perforation) requiring reintervention occurred in 3.4% of the procedures. CONCLUSIONS: The novel BAE-based ES provides high technical success, favorable efficacy, and safety in CD-associated deep small bowel strictures, which may provide an alternative for endoscopic balloon dilation and surgery.

Development and validation of the linked color imaging classification for endoscopic prediction of colorectal polyp histology.

OBJECTIVE: Linked color imaging (LCI) is a recently developed technique that emphasizes differences in mucosal color. In this study we aimed to develop a LCI classification based on the Narrow-band Imaging International Colorectal Endoscopic Classification for predicting colorectal polyp histology and evaluate the validity and performance of the endoscopists in differentiating hyperplastic polyps from adenomas using the LCI classification. METHODS: A workshop involving six international experts from China and Japan with substantial experience with LCI developed the classification. Three experienced and seven less-experienced endoscopists used the LCI images to predict the histology of polyps independently, recording their degrees of confidence in these predictions before and after completing the training test for the LCI classification. RESULTS: Of the 50 polyps included, 30 (60.0%) were adenomas. Overall diagnostic accuracy before training was 75.4% (95% confidence interval [CI] 71.4%-79.1%), which increased to 85.2% (95% CI 81.8%-88.2%) after training. After training, the experienced and less-experienced endoscopists achieved an overall accuracy of 87.3% and 84.3% for the prediction of polyp histology. Polyp prediction using the color criterion alone had the highest specificity and positive predictive value, whereas the vessel criterion achieved the highest accuracy and negative predictive value among all three individual LCI criteria. After training, both the experienced and less-experienced endoscopists had high degrees of interobserver agreement. CONCLUSIONS: We developed and validated the first LCI classification for endoscopic differentiation of adenomas and hyperplastic polyps. The LCI classification significantly improved the diagnostic accuracy of colorectal polyps.

Balloon-assisted endoscopic submucosal dissection for treating small intestinal lipomas: Report of two cases.

BACKGROUND: Most small intestinal lipomas are treated surgically, and some require repeated surgeries for multiple lipomas. However, application of endoscopic submucosal dissection (ESD) technology in the deep small intestine is rarely reported owing to the special anatomical structure of the small intestine, medical equipment limitations, and the lack of relevant experience among endoscopists. CASE SUMMARY: Two patients with small intestinal lipomas treated at the Air Force Medical Center from November 2015 to September 2019 were selected to undergo balloon-assisted ESD to treat the lipomas and explore the technical feasibility and safety of ESD for treating small intestinal lipomas. The two patients successfully underwent balloon-assisted ESD to treat four small intestinal lipomas, with a complete resection rate of 100% (4/4), without intraoperative or postoperative bleeding, perforation, or other complications. After 3-6 mo of postoperative follow-up, the clinical symptoms caused by the lipomas were significantly relieved or disappeared after treatment. CONCLUSION: Balloon-assisted ESD is a safe and reliable new method for treating deep intestinal lipomas and shows good clinical feasibility.

Small intestinal hemolymphangioma treated with enteroscopic injection sclerotherapy: A case report and review of literature.

BACKGROUND: Hemolymphangiomas are rare malformations composed of both lymphatic and vascular vessels and are located in the pancreas, spleen, mediastinum, etc. Small intestinal hemolymphangioma is extremely rare and often presents as obscure gastrointestinal bleeding. It is rarely diagnosed correctly before the operation. Endoscopic injection sclerotherapy is usually used as a management of bleeding in esophageal varices and was occasionally reported as a treatment of vascular malformation. The treatment of small intestinal hemolymphangioma with enteroscopic injection sclerotherapy has not been reported. CASE SUMMARY: A 42-year-old male complained of recurrent episodes of melena and dizziness, fatigue and reduced exercise capacity for more than 2 mo. Gastroduodenoscopy and blood test revealed a gastric ulcer and anemia. Treatment with oral proton-pump inhibitors and iron did not improve symptoms. We then performed a capsule endoscopy and anterograde balloon-assisted enteroscopy and revealed a hemolymphangioma. Considering it is a benign tumor without malignant potential, we performed enteroscopic injection sclerotherapy. He was discharged 4 days later. At follow-up 3 mo later, the melena disappeared. Balloon-assisted enteroscopy revealed an atrophied tumor atrophied and no bleeding. Argon plasma coagulation was applied to the surface of the hemolymphangioma to accelerated healing. When he returned for follow-up 1 year later, anemia was resolved and the tumor had been cured. CONCLUSION: Balloon-assisted enteroscopy and capsule endoscopy are effective methods for diagnosis of hemolymphangioma. Enteroscopic injection sclerotherapy is an effective treatment.

STK11 gene analysis reveals a significant number of splice mutations in Chinese PJS patients.

BACKGROUND: The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. AIMS: To test the efficacy of the combination in Chinese patients with PJS. METHODS: PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. RESULTS: We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. CONCLUSION: The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance.

Intercellular adhesion molecule-1 enhances the therapeutic effects of MSCs in a dextran sulfate sodium-induced colitis models by promoting MSCs homing to murine colons and spleens.

BACKGROUND: To investigate the therapeutic effect of intercellular adhesion molecule (ICAM)-1-modified mesenchymal stem cells (MSCs) in a mouse model of inflammatory bowel disease (IBD) induced by dextran sulfate sodium. METHODS: Primary MSCs and ICAM-1-overexpressing MSCs (C3 cells) were generated in vitro. The IBD mouse model was induced with drinking water containing dextran sulfate sodium for 7 days. For stem cell therapy, mice were randomly assigned to six experimental groups: the control group, IBD group, primary MSC group, C3 group, C3-vector group, and C3-ICAM-1 group. Mice were given a single injection of 1 × 106 primary MSCs or gene-modified MSCs via the tail vein on day 3 of DDS administration. The general conditions of the mice in each group were observed. Additionally, the pathological changes in the colon were observed and scored. Primary MSCs and gene-modified MSCs were stained with the fluorescent dye CM-DIL before injection into the tail vein of mice. The distribution of infused cells in IBD mice was observed in frozen sections. Mechanistically, the polarization of Th1, Th2, Th17, and regulatory T cells (Tregs) in the spleen was determined by flow cytometry. Moreover, the mRNA expression levels of IBD-related immune factors in splenocytes were measured by quantitative PCR. RESULTS: A single injection of MSCs promoted general recovery and reduced pathological damage in IBD mice. Additionally, ICAM-1-overexpressing MSCs had stronger therapeutic effects than ICAM-1low MSCs. Furthermore, the in vivo distribution analysis results indicated that a higher number of ICAM-1-overexpressing MSCs homed to the colon and spleen of IBD mice. Moreover, the delivery of ICAM-1 overexpressing MSCs decreased the numbers of Th1 and Th17 cells but increased the number of Tregs in the spleen of IBD mice. The quantitative PCR analysis results revealed that an infusion of ICAM-1-overexpressing MSCs influenced the expression of spleen-derived immune factors by remarkably reducing the mRNA levels of IFN-γ and IL-17A and increasing the mRNA level of Foxp3. CONCLUSIONS: Our results demonstrate that ICAM-1-modified mesenchymal stem cells (MSCs) remarkably alleviate inflammatory damage in IBD mice by promoting MSC homing to the target and immune organs. The findings suggest that ICAM-1 is required to maintain the therapeutic effects of MSCs in IBD treatment and identified a novel role of ICAM-1 in inflammatory diseases.

A novel germline mutation (c.A527G) in STK11 gene causes Peutz-Jeghers syndrome in a Chinese girl: A case report.

RATIONALE: Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. PATIENT CONCERNS: A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. DIAGNOSES: She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. INTERVENTIONS: Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. OUTCOMES: A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. LESSONS: PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.

Combined use of single-balloon enteroscope and colonoscope for self-expandable metal stent placement in patients with malignant small intestinal obstruction: a single-center comparative clinical observation.

Small intestinal obstruction is a common complication of primary gastrointestinal cancer or metastatic cancers. Patients with this condition are often poor candidates for surgical bypasses, and placement of self-expanding metal stent (SEMS) can be technically challenging. In this study, we examined the feasibility of combined application of single-balloon enteroscope (SBE) and colonoscope for SEMS placement in patients with malignant small intestinal obstruction. Thirty-four patients were enrolled in this study, among which 22 patients received SEMS placement by using SBE and colonoscope, while the other 12 patients received conservative medical treatment. The patients were followed up for one year. Stent placement was technically feasible in 95.5% (21/22). Clinical improvement was achieved in 86.4% (19/22). For the 19 clinical success cases, the average time of benefits from a gastric outlet obstruction scoring system (GOOSS) increase ≥1 was 111.9±89.5 days. For the 12 patients receiving conservative medical treatment, no significant improvement in GOOSS score was observed. Moreover, a significant increase of Short-Form-36 health survey score was observed in the 19 patients at time of 30 days after stent placement. By Kaplan-Meier analysis, a significant survival improvement was observed in patients with successful SEMS placement, compared with patients receiving conservative medical treatment. Taken together, combined use of SBE and colonoscope makes endoscopic stent placement feasible in patients with malignant small intestinal obstruction, and patients can benefit from it in terms of prolonged survival and improved quality of life.