RESUMO
Glioblastoma (GBM) is known as the most aggressive type of malignant brain tumour, with an extremely poor prognosis of approximately 12 months following standard-of-care treatment with surgical resection, radiotherapy (RT), and temozolomide treatment. Novel RT-drug combinations are urgently needed to improve patient outcomes. Gold nanoparticles (GNPs) have demonstrated significant preclinical potential as radiosensitizers due to their unique physicochemical properties and their ability to pass the blood-brain barrier. The modification of GNP surface coatings with poly(ethylene) glycol (PEG) confers several therapeutic advantages including immune avoidance and improved cellular localisation. This study aimed to characterise both the radiosensitizing and immunomodulatory properties of differentially PEGylated GNPs in GBM cells in vitro. Two GBM cell lines were used, U-87 MG and U-251 MG. The radiobiological response was evaluated by clonogenic assay, immunofluorescent staining of 53BP1 foci, and flow cytometry. Changes in the cytokine expression levels were quantified by cytokine arrays. PEGylation improved the radiobiological efficacy, with double-strand break induction being identified as an underlying mechanism. PEGylated GNPs also caused the greatest boost in RT immunogenicity, with radiosensitization correlating with a greater upregulation of inflammatory cytokines. These findings demonstrate the radiosensitizing and immunostimulatory potential of ID11 and ID12 as candidates for RT-drug combination in future GBM preclinical investigations.
Assuntos
Glioblastoma , Nanopartículas Metálicas , Humanos , Glioblastoma/metabolismo , Citocinas/uso terapêutico , Ouro/química , Nanopartículas Metálicas/química , Polietilenoglicóis/farmacologia , Polietilenoglicóis/uso terapêuticoRESUMO
Adult brain tumors (glioma) represent a cancer of unmet need where standard-of-care is non-curative; thus, new therapies are urgently needed. It is unclear whether isocitrate dehydrogenases (IDH1/2) when not mutated have any role in gliomagenesis or tumor growth. Nevertheless, IDH1 is overexpressed in glioblastoma (GBM), which could impact upon cellular metabolism and epigenetic reprogramming. This study characterizes IDH1 expression and associated genes and pathways. A novel biomarker discovery pipeline using artificial intelligence (evolutionary algorithms) was employed to analyze IDH-wildtype adult gliomas from the TCGA LGG-GBM cohort. Ninety genes whose expression correlated with IDH1 expression were identified from: (1) All gliomas, (2) primary GBM, and (3) recurrent GBM tumors. Genes were overrepresented in ubiquitin-mediated proteolysis, focal adhesion, mTOR signaling, and pyruvate metabolism pathways. Other non-enriched pathways included O-glycan biosynthesis, notch signaling, and signaling regulating stem cell pluripotency (PCGF3). Potential prognostic (TSPYL2, JAKMIP1, CIT, TMTC1) and two diagnostic (MINK1, PLEKHM3) biomarkers were downregulated in GBM. Their gene expression and methylation were negatively and positively correlated with IDH1 expression, respectively. Two diagnostic biomarkers (BZW1, RCF2) showed the opposite trend. Prognostic genes were not impacted by high frequencies of molecular alterations and only one (TMTC1) could be validated in another cohort. Genes with mechanistic links to IDH1 were involved in brain neuronal development, cell proliferation, cytokinesis, and O-mannosylation as well as tumor suppression and anaplerosis. Results highlight metabolic vulnerabilities and therapeutic targets for use in future clinical trials.
RESUMO
The outcome of the exposure of living organisms to ionizing radiation is determined by the distribution of the associated energy deposition at different spatial scales. Radiation proceeds through ionizations and excitations of hit molecules with an ~ nm spacing. Approaches such as nanodosimetry/microdosimetry and Monte Carlo track-structure simulations have been successfully adopted to investigate radiation quality effects: they allow to explore correlations between the spatial clustering of such energy depositions at the scales of DNA or chromosome domains and their biological consequences at the cellular level. Physical features alone, however, are not enough to assess the entity and complexity of radiation-induced DNA damage: this latter is the result of an interplay between radiation track structure and the spatial architecture of chromatin, and further depends on the chromatin dynamic response, affecting the activation and efficiency of the repair machinery. The heterogeneity of radiation energy depositions at the single-cell level affects the trade-off between cell inactivation and induction of viable mutations and hence influences radiation-induced carcinogenesis. In radiation therapy, where the goal is cancer cell inactivation, the delivery of a homogenous dose to the tumour has been the traditional approach in clinical practice. However, evidence is accumulating that introducing heterogeneity with spatially fractionated beams (mini- and microbeam therapy) can lead to significant advantages, particularly in sparing normal tissues. Such findings cannot be explained in merely physical terms, and their interpretation requires considering the scales at play in the underlying biological mechanisms, suggesting a systemic response to radiation.
Assuntos
Exposição à Radiação , Radiação Ionizante , Método de Monte Carlo , Dano ao DNA , CromatinaRESUMO
BACKGROUND: Liver cancer (Hepatocellular carcinoma; HCC) prevalence is increasing and with poor clinical outcome expected it means greater understanding of HCC aetiology is urgently required. This study explored a deep learning solution to detect biologically important features that distinguish prognostic subgroups. A novel architecture of an Artificial Neural Network (ANN) trained with a customised objective function (LRSC) was developed. The ANN should discover new data representations, to detect patient subgroups that are biologically homogenous (clustering loss) and similar in survival (survival loss) while removing noise from the data (reconstruction loss). The model was applied to TCGA-HCC multi-omics data and benchmarked against baseline models that only use a reconstruction objective function (BCE, MSE) for learning. With the baseline models, the new features are then filtered based on survival information and used for clustering patients. Different variants of the customised objective function, incorporating only reconstruction and clustering losses (LRC); and reconstruction and survival losses (LRS) were also evaluated. Robust features consistently detected were compared between models and validated in TCGA and LIRI-JP HCC cohorts. RESULTS: The combined loss (LRSC) discovered highly significant prognostic subgroups (P-value = 1.55E-77) with more accurate sample assignment (Silhouette scores: 0.59-0.7) compared to baseline models (0.18-0.3). All LRSC bottleneck features (N = 100) were significant for survival, compared to only 11-21 for baseline models. Prognostic subgroups were not explained by disease grade or risk factors. Instead LRSC identified robust features including 377 mRNAs, many of which were novel (61.27%) compared to those identified by the other losses. Some 75 mRNAs were prognostic in TCGA, while 29 were prognostic in LIRI-JP also. LRSC also identified 15 robust miRNAs including two novel (hsa-let-7g; hsa-mir-550a-1) and 328 methylation features with 71% being prognostic. Gene-enrichment and Functional Annotation Analysis identified seven pathways differentiating prognostic clusters. CONCLUSIONS: Combining cluster and survival metrics with the reconstruction objective function facilitated superior prognostic subgroup identification. The hybrid model identified more homogeneous clusters that consequently were more biologically meaningful. The novel and prognostic robust features extracted provide additional information to improve our understanding of a complex disease to help reveal its aetiology. Moreover, the gene features identified may have clinical applications as therapeutic targets.
Assuntos
Carcinoma Hepatocelular , Aprendizado Profundo , Neoplasias Hepáticas , Carcinoma Hepatocelular/genética , Humanos , Neoplasias Hepáticas/genética , Prognóstico , RNA MensageiroRESUMO
The non-targeted effects of radiation have been known to induce significant alternations in cell survival. Although the effects might govern the progression of tumor sites following advanced radiotherapy, the impacts on the intercellular control of the cell cycle following radiation exposure with a modified field, remain to be determined. Recently, a fluorescent ubiquitination-based cell-cycle indicator (FUCCI), which can visualize the cell-cycle phases with fluorescence microscopy in real time, was developed for biological cell research. In this study, we investigated the non-targeted effects on the regulation of the cell cycle of human cervical carcinoma (HeLa) cells with imperfect p53 function that express the FUCCI (HeLa-FUCCI cells). The possible effects on the cell-cycle phases via soluble factors were analyzed following exposure to different field configurations, which were delivered using a 150 kVp X-ray irradiator. In addition, using synchrotron-generated, 5.35 keV monochromatic X-ray microbeams, high-precision 200 µm-slit microbeam irradiation was performed to investigate the possible impacts on the cell-cycle phases via cell-cell contacts. Collectively, we could not detect the intercellular regulation of the cell cycle in HeLa-FUCCI cells, which suggested that the unregulated cell growth was a malignant tumor. Our findings indicated that there was no significant intercellular control system of the cell cycle in malignant tumors during or after radiotherapy, highlighting the differences between normal tissue and tumor characteristics.
Assuntos
Ciclo Celular , Corantes Fluorescentes/química , Síncrotrons/instrumentação , Ubiquitinação , Neoplasias do Colo do Útero/patologia , Sobrevivência Celular , Feminino , Células HeLa , Humanos , Microscopia de Fluorescência , Raios XRESUMO
Longitudinal next-generation sequencing of cancer patient samples has enhanced our understanding of the evolution and progression of various cancers. As a result, and due to our increasing knowledge of heterogeneity, such sampling is becoming increasingly common in research and clinical trial sample collections. Traditionally, the evolutionary analysis of these cohorts involves the use of an aligner followed by subsequent stringent downstream analyses. However, this can lead to large levels of information loss due to the vast mutational landscape that characterizes tumor samples. Here, we propose an alignment-free approach for sequence comparison-a well-established approach in a range of biological applications including typical phylogenetic classification. Such methods could be used to compare information collated in raw sequence files to allow an unsupervised assessment of the evolutionary trajectory of patient genomic profiles. In order to highlight this utility in cancer research we have applied our alignment-free approach using a previously established metric, Jensen-Shannon divergence, and a metric novel to this area, Hellinger distance, to two longitudinal cancer patient cohorts in glioma and clear cell renal cell carcinoma using our software, NUQA. We hypothesize that this approach has the potential to reveal novel information about the heterogeneity and evolutionary trajectory of spatiotemporal tumor samples, potentially revealing early events in tumorigenesis and the origins of metastases and recurrences. Key words: alignment-free, Hellinger distance, exome-seq, evolution, phylogenetics, longitudinal.
Assuntos
Evolução Biológica , Heterogeneidade Genética , Técnicas Genéticas , Neoplasias/genética , Software , HumanosRESUMO
BACKGROUND: Ataxia-telangiectasia (AT) is a rare autosomal recessive disorder that causes deficiency or dysfunction of the ataxia-telangiectasia mutated (ATM) protein. Not only AT patients, but also certain ATM heterozygous mutation carriers show a significantly reduced life expectancy due to cancer and ischemic heart disease; in particular, female carriers having particular alleles have an increased risk of breast cancer. The frequency of such risk heterozygotes at a population level remains to be fully determined, and evidence-based preventive medical guidelines have not yet been established. METHODS: Using the 3.5KJPNv2 allele frequency panel of Japanese Multi Omics Reference Panel v201902, which shows single-nucleotide variant (SNV) and insertion/deletion (INDEL) allele frequencies from 3552 Japanese healthy individuals, we investigated the diversity of ATM gene variants. RESULTS: We detected 2845 (2370 SNV and 475 INDEL) variants in the ATM gene, including 1338 (1160 SNV and 178 INDEL) novel variants. Also, we found a stop-gained SNV (NC_000008.11:g.108115650G > A (p.Trp266*)) and a disruptive-inframe-deletion (NC_000008.11:g. 108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal) and two frameshift INDELs (NC_000008.11:g.108119714CAA/C (p.Glu376fs) and NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)), which would be novel variants predicted to lead to loss of ATM functionality. CONCLUSION: The combination of population-based biobanking and human genomics provided a novel insight of diversity of ATM gene variants at a population level. For the advancement of precision medicine, such approach will be useful to predict novel pathogenic/likely pathogenic variants in the ATM gene and to establish preventive medical guidelines for certain ATM heterozygotes pertaining to their risk of particular diseases.
Assuntos
Proteínas Mutadas de Ataxia Telangiectasia/genética , Predisposição Genética para Doença , Variação Genética/genética , Genoma Humano/genética , Análise de Dados , Feminino , Frequência do Gene , Genética Populacional , Heterozigoto , Humanos , Perda de Heterozigosidade/genética , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único/genética , Medicina de PrecisãoRESUMO
Precision medicine is a rapidly developing area that aims to deliver targeted therapies based on individual patient characteristics. However, current radiation treatment is not yet personalized; consequently, there is a critical need for specific patient characteristics of both tumor and normal tissues to be fully incorporated into dose prescription. Furthermore, current risk assessment following environmental, occupational, or accidental exposures to radiation is based on population effects, and does not account for individual diversity underpinning radiosensitivity. The lack of personalized approaches in both radiotherapy and radiation risk assessment resulted in the current situation where a population-based model, effective dose, is being used. In this review article, to stimulate scientific discussion for precision medicine in both radiotherapy and radiation risk assessment, we propose a novel radiological concept and metric - the personalized dose and the personalized risk index - that incorporate individual physiological, lifestyle-related and genomic variations and radiosensitivity, outlining the potential clinical application for precision medicine. We also review on recent progress in both genomics and biobanking research, which is promising for providing novel insights into individual radiosensitivity, and for creating a novel conceptual framework of precision radiotherapy and radiation risk assessment.
Assuntos
Genômica , Medicina de Precisão , Radioterapia/efeitos adversos , Medição de Risco , Relação Dose-Resposta à Radiação , Humanos , Bancos de TecidosRESUMO
BACKGROUND: The conventional concept of radiation protection is based on epidemiological studies of radiation that support a positive correlation between dose and response. However, there is a remarkable difference in biological responses at the tissue level, depending on whether radiation is delivered as a uniform or non-uniform spatiotemporal distribution due to tissue sparing effects (TSE). From the point of view of radiation micro-dosimetry, environmental radiation is delivered as a non-uniform distribution, and radiation-induced biological responses at the tissue level, such as TSE, would be implicated in individual risk following exposure to environmental radiation. HYPOTHESIS: We hypothesize that the health risks of non-uniform radiation exposure are lower than the same dose at a uniform exposure, due to TSE following irradiation. Testing the hypothesis requires both radiobiological studies using high-precision microbeams and the epidemiological data of environmental radiation-induced effects. The implications of the hypothesis will lead to more personalized approaches in the field of environmental radiation protection. CONCLUSION: The detection of spatiotemporal dose distribution could be of scientific importance for more accurate individual risk assessment of exposure to environmental radiation. Further radiobiological studies on non-uniform radiation-induced biological responses at the tissue level are expected.
Assuntos
Relação Dose-Resposta à Radiação , Exposição à Radiação/efeitos adversos , Humanos , Lesões por Radiação , Medição de RiscoRESUMO
On March 11, 2011, a devastating earthquake and subsequent tsunami caused serious damage to areas of the Pacific coast in Fukushima prefecture and prompted fears among the residents about a possible meltdown of the Fukushima Daiichi Nuclear Power Plant reactors. As of 2017, over six years have passed since the Fukushima nuclear crisis and yet the full ramifications of the biological exposures to this accidental release of radioactive substances remain unclear. Furthermore, although several genetic studies have determined that the variation in radiation sensitivity among different individuals is wider than expected, personalized medical approaches for Fukushima victims have seemed to be insufficient. In this commentary, we discuss radiobiological issues arising from low-dose radiation exposure, from the cell-based to the population level. We also introduce the scientific utility of the Integrative Japanese Genome Variation Database (iJGVD), an online database released by the Tohoku Medical Megabank Organization, Tohoku University that covered the whole genome sequences of 2,049 healthy individuals in the northeastern part of Japan in 2016. Here we propose a personalized radiation risk assessment and medical approach, which considers the genetic variation of radiation sensitivity among individuals, for next-step developments in radiological protection.
Assuntos
Acidente Nuclear de Fukushima , Medicina de Precisão , Radiobiologia , Efeito Espectador/efeitos da radiação , Dano ao DNA , Relação Dose-Resposta à Radiação , Humanos , Radiação , Medição de RiscoRESUMO
OBJECTIVE: This study sought to determine if DNA integrity was compromised by ionising radiation from paediatric cardiac catheterisations and if dose optimisation techniques allowed DNA integrity to be maintained. MATERIALS AND METHODS: Children were imaged using either: (i) an anti-scatter grid (current departmental protocol), (ii) no anti-scatter grid or, (iii) no anti-scatter grid and a 15 cm air-gap between the child and the x-ray detector. Dose area product and image quality were assessed, lifetime attributable cancer risk estimates were calculated and DNA double-strand breakages quantified using the γH2AX assay. RESULTS: Consent was obtained from 70 parents/guardians/children. Image quality was sufficient for each procedure performed. Removal of the anti-scatter grid resulted in dose reductions of 20% (no anti-scatter grid) and 30% (15 cm air-gap), DNA double-strand break reductions of 30% (no anti-scatter grid) and 20% (15 cm air-gap) and a reduction of radiation-induced cancer mortality risk of up to 45%. CONCLUSION: Radiation doses received during paediatric cardiac catheterisation procedures resulted in a significant increase in DNA damage while maintaining acceptable image quality and diagnostic efficacy. It is feasible to remove the anti-scatter grid resulting in a reduction in DNA damage to the patient. The γH2AX assay may be used for assessment of dose optimisation strategies in children.
Assuntos
Cateterismo Cardíaco , Dano ao DNA/efeitos da radiação , Doses de Radiação , Proteção Radiológica/métodos , Espalhamento de Radiação , Adolescente , Criança , Pré-Escolar , Inglaterra , Feminino , Humanos , Lactente , Recém-Nascido , MasculinoRESUMO
INTRODUCTION: Radioprotective agents are of interest for application in radiotherapy for cancer and in public health medicine in the context of accidental radiation exposure. Methylproamine is the lead compound of a class of radioprotectors which act as DNA binding anti-oxidants, enabling the repair of transient radiation-induced oxidative DNA lesions. This study tested methylproamine for the radioprotection of both directly targeted and bystander cells. METHODS: T98G glioma cells were treated with 15 µM methylproamine and exposed to (137)Cs γ-ray/X-ray irradiation and He(2+) microbeam irradiation. Radioprotection of directly targeted cells and bystander cells was measured by clonogenic survival or γH2AX assay. RESULTS: Radioprotection of directly targeted T98G cells by methylproamine was observed for (137)Cs γ-rays and X-rays but not for He(2+) charged particle irradiation. The effect of methylproamine on the bystander cell population was tested for both X-ray irradiation and He(2+) ion microbeam irradiation. The X-ray bystander experiments were carried out by medium transfer from irradiated to non-irradiated cultures and three experimental designs were tested. Radioprotection was only observed when recipient cells were pretreated with the drug prior to exposure to the conditioned medium. In microbeam bystander experiments targeted and nontargeted cells were co-cultured with continuous methylproamine treatment during irradiation and postradiation incubation; radioprotection of bystander cells was observed. DISCUSSION AND CONCLUSION: Methylproamine protected targeted cells from DNA damage caused by γ-ray or X-ray radiation but not He(2+) ion radiation. Protection of bystander cells was independent of the type of radiation which the donor population received.
Assuntos
Benzimidazóis/farmacologia , Efeito Espectador , Sobrevivência Celular/efeitos da radiação , Protetores contra Radiação/farmacologia , Linhagem Celular Tumoral , HumanosRESUMO
The cell cycle dependence of radiosensitivity has yet to be fully determined, as it is technically difficult to achieve a high degree of cell cycle synchronization in cultured cell systems and accurately detect the cell cycle phase of individual cells simultaneously. We used human cervical carcinoma HeLa cells expressing fluorescent ubiquitination-based cell cycle indicators (FUCCI), and employed the mitotic harvesting method that is one of the cell cycle synchronization methods. The imaging analysis confirmed that the cell cycle is highly synchronized after mitotic cell harvesting until 18-20 h of the doubling time has elapsed. Also, flow cytometry analysis revealed that the S and G2 phases peak at approximately 12 and 14-16 h, respectively, after mitotic harvesting. In addition, the clonogenic assay showed the changes in surviving fractions following exposure to X-rays according to the progress through the cell cycle. These results indicate that HeLa-FUCCI cells become radioresistant in the G1 phase, become radiosensitive in the early S phase, rapidly become radioresistant in the late S phase, and become radiosensitive again in the G2 phase. Our findings may contribute to the further development of combinations of radiation and cell cycle-specific anticancer agents.
Assuntos
Células HeLa , Humanos , Raios X , Sobrevivência Celular , Microscopia de Fluorescência , Ciclo Celular , UbiquitinaçãoRESUMO
PURPOSE: This study aimed to demonstrate for the first time the possibility of irradiating biological cells with gray (Gy)-scale doses delivered over single bursts of picosecond-scale electron beams, resulting in unprecedented dose rates of 1010 to 1011 Gy/s. METHODS AND MATERIALS: Cancer stem cells and human skin fibroblasts were irradiated with MeV-scale electron beams from a laser-driven source. Doses up to 3 Gy per pulse with a high spatial uniformity (coefficient of variance, 3%-6%) and within a timescale range of 10 to 20 picoseconds were delivered. Doses were characterized during irradiation and were found to be in agreement with Monte Carlo simulations. Cell survival and DNA double-strand break repair dynamics were studied for both cell lines using clonogenic assay and 53BP1 foci formation. The results were compared with reference x-rays at a dose rate of 0.49 Gy/min. RESULTS: Results from clonogenic assays of both cell lines up to 3 Gy were well fitted by a linear quadratic model with α = (0.68 ± 0.08) Gy-1 and ß = (0.01 ± 0.01) Gy-2 for human skin fibroblasts and α = (0.51 ± 0.14) Gy-1 and ß = (0.01 ± 0.01) Gy-2 for cancer stem cells. Compared with irradiation at 0.49 Gy/min, our experimental results indicate no statistically significant difference in cell survival rate for doses up to 3 Gy despite a significant increase in the α parameter, which may reflect more complex damage. Foci measurements showed no significant difference between irradiation at 1011 Gy/s and at 0.49 Gy/min. CONCLUSIONS: This study demonstrates the possibility of performing radiobiological studies with picosecond-scale laser-generated electron beams at ultrahigh dose rates of 1010 to1011 Gy/s. Preliminary results indicate, within statistical uncertainties, a significant increase of the α parameter, a possible indication of more complex damage induced by a higher density of ionizing tracks.
Assuntos
Elétrons , Neoplasias , Humanos , Relação Dose-Resposta à Radiação , Reparo do DNA , Fibroblastos/efeitos da radiação , Células-Tronco Neoplásicas , Neoplasias/metabolismoRESUMO
Purpose: To evaluate the quality of the interspace between the prostate and rectum and assess the effect on the dose to the rectum by measuring the spacer quality score (SQS) before and after implanting a hydrogel rectal spacer. Methods and Materials: Thirty patients with prostate cancer were treated with stereotactic ablative body radiation therapy as part of the SPORT clinical trial. Each patient had a 10 mL polyethylene glycol hydrogel spacer inserted transperineally. Computed tomography scans were acquired before and after spacer insertion, 10MV flattening filter free (FFF) stereotactic ablative body radiation therapy (SABR) treatment plans were generated using each image set. To calculate the SQS, the prostate-rectal interspace (PRI) was measured in the anterior-posterior orientation, parallel to the anatomic midline at the prostate base, apex, and midgland on the prespacer and postspacer computed tomography. Measurements were taken in 3 transverse positions between the prostate and the rectum, and PRI scores of 0, 1, and 2 were assigned if the interspace between prostate and rectum was <0.3, 0.3 to 0.9, or ≥1 cm, respectively. The overall SQS was the lowest of the PRI scores. Differences between prespacer and postspacer PRIs and SQS were investigated by performing Fisher's exact test and differences between doses to the rectum were investigated by performing the paired samples Wilcoxon rank-sum test and Student t test. Results: Statistically significant differences between prespacer versus postspacer patients were found when grouping patients according to their overall SQS. The PRI summary score did not reach statistical significance between prespacer and postspacer at the base but was significantly higher for the prostate midline and apex. Statistically significant differences in some rectum dose-volume metrics were found when grouping patients according to their PRIs and SQS. Conclusions: SQS before and after the spacer insertion was evaluated and was found to be correlated with pre- and postspacer rectal dosimetry. Sources of improvement of the SQS scoring metric and limitations are discussed.
RESUMO
Radium-223 (223Ra) and Lutetium-177-labelled-PSMA-617 (177Lu-PSMA) are currently the only radiopharmaceutical treatments to prolong survival for patients with metastatic-castration-resistant prostate cancer (mCRPC); however, mCRPC remains an aggressive disease. Recent clinical evidence suggests patients with mutations in DNA repair genes associated with homologous recombination have a greater clinical benefit from 223Ra. In this study, we aimed to determine the utility of combining DNA damage response (DDR) inhibitors to increase the therapeutic efficacy of X-rays, or 223Ra. Radiobiological responses were characterised by in vitro assessment of clonogenic survival, repair of double strand breaks, cell cycle distribution, and apoptosis via PARP-1 cleavage. Here, we show that DDR inhibitors increase the therapeutic efficacy of both radiation qualities examined, which is associated with greater levels of residual DNA damage. Co-treatment of ATM or PARP inhibition with 223Ra increased cell cycle arrest in the G2/M phase. In comparison, combined ATR inhibition and radiation qualities caused G2/M checkpoint abrogation. Additionally, greater levels of apoptosis were observed after the combination of DDR inhibitors with 223Ra. This study identified the ATR inhibitor as the most synergistic inhibitor for both radiation qualities, supporting further pre-clinical evaluation of DDR inhibitors in combination with 223Ra for the treatment of prostate cancer.
RESUMO
OBJECTIVES: The aim of this study was to generate an objective method to describe MRI data to assess response in the vertebrae of patients with metastatic hormone sensitive prostate cancer (mHSPC), treated with external beam radiation therapy and systemic therapy with Radium-223 and to correlate changes with clinical outcomes. METHODS: Three sets of whole-body MRI (WBMRI) images were utilized from 25 patients from the neo-adjuvant Androgen Deprivation Therapy pelvic Radiotherapy and RADium-223 (ADRRAD) clinical trial: MRI1 (up to 28 days before Radium-223), MRI2, and MRI3 (2 and 6 months post completion of Radium-223). Radiological response was assessed based on post baseline MRI images. Vertebrae were semi-automatically contoured in the sagittal T1-weighted (T1w) acquisitions, MRI intensity was measured, and spinal cord was used to normalize the measurements. The relationship between MRI intensity vs time to biochemical progression and radiology response was investigated. Survival curves were generated and splitting measures for survival and biochemical progression investigated. RESULTS: Using a splitting measure of 1.8, MRI1 was found to be a reliable quantitative indicator correlating with overall survival (P = 0.023) and biochemical progression (P = 0.014). MRI (3-1) and MRI (3-2) were found to be significant indicators for patients characterized by progressive/non-progressive disease (P = 0.021, P = 0.004) and biochemical progression within/after 12 months (P = 0.007, P = 0.001). CONCLUSIONS: We have identified a potentially useful objective measure of response on WBMRI of vertebrae containing bone metastases in mHSPC which correlates with survival/progression (prognostic) and radiology response (predictive). ADVANCES IN KNOWLEDGE: Measurements of T1w WBMRI normalized intensity may allow identifying potentially useful response biomarkers correlating with survival, radiological response and biochemical progression.
Assuntos
Neoplasias da Próstata , Rádio (Elemento) , Masculino , Humanos , Neoplasias da Próstata/diagnóstico por imagem , Neoplasias da Próstata/tratamento farmacológico , Neoplasias da Próstata/radioterapia , Antagonistas de Androgênios/uso terapêutico , Androgênios/uso terapêutico , Antígeno Prostático Específico , Rádio (Elemento)/uso terapêuticoRESUMO
Although, ionizing radiation (IR) has been implicated to cause stress in endoplasmic reticulum (ER), how ER stress signaling and major ER stress sensors modulate cellular response to IR is unclear. Protein kinase RNA-like endoplasmic reticulum kinase (PERK) is an ER transmembrane protein which initiates unfolded protein response (UPR) or ER stress signaling when ER homeostasis is disturbed. Here, we report that down-regulation of PERK resulted in increased clonogenic survival, enhanced DNA repair and reduced apoptosis in irradiated cancer cells. Our study demonstrated that PERK has a role in sensitizing cancer cells to IR.
Assuntos
Regulação para Baixo/efeitos da radiação , Radiação Ionizante , eIF-2 Quinase/metabolismo , Apoptose/efeitos da radiação , Linhagem Celular Tumoral , Sobrevivência Celular/efeitos da radiação , Dano ao DNA , Reparo do DNA/efeitos da radiação , Inativação Gênica/efeitos da radiação , Humanos , Fosforilação/efeitos da radiação , Fator de Transcrição CHOP/metabolismoRESUMO
hSSB1 is a newly discovered single-stranded DNA (ssDNA)-binding protein that is essential for efficient DNA double-strand break signalling through ATM. However, the mechanism by which hSSB1 functions to allow efficient signalling is unknown. Here, we show that hSSB1 is recruited rapidly to sites of double-strand DNA breaks (DSBs) in all interphase cells (G1, S and G2) independently of, CtIP, MDC1 and the MRN complex (Rad50, Mre11, NBS1). However expansion of hSSB1 from the DSB site requires the function of MRN. Strikingly, silencing of hSSB1 prevents foci formation as well as recruitment of MRN to sites of DSBs and leads to a subsequent defect in resection of DSBs as evident by defective RPA and ssDNA generation. Our data suggests that hSSB1 functions upstream of MRN to promote its recruitment at DSBs and is required for efficient resection of DSBs. These findings, together with previous work establish essential roles of hSSB1 in controlling ATM activation and activity, and subsequent DSB resection and homologous recombination (HR).
Assuntos
Quebras de DNA de Cadeia Dupla , Reparo do DNA , Proteínas de Ligação a DNA/fisiologia , Hidrolases Anidrido Ácido , Proteínas de Ciclo Celular/análise , Linhagem Celular , Enzimas Reparadoras do DNA/análise , Proteínas de Ligação a DNA/análise , Humanos , Proteína Homóloga a MRE11 , Proteínas Mitocondriais , Proteínas Nucleares/análise , Radiação IonizanteRESUMO
The fourth workshop of the Multidisciplinary European Low Dose Initiative (MELODI) was organised by STUK-Radiation and Nuclear Safety Authority of Finland. It took place from 12 to 14 September 2012 in Helsinki, Finland. The meeting was attended by 179 scientists and professionals engaged in radiation research and radiation protection. We summarise the major scientific findings of the workshop and the recommendations for updating the MELODI Strategic Research Agenda and Road Map for future low dose research activities.