Proton exchange and local stability in a DNA triple helix containing a G.TA triad.

Recognition of a thymine-adenine base pair in DNA by triplex-forming oligonucleotides can be achieved by a guanine through the formation of a G.TA triad within the parallel triple helix motif. In the present work, we provide the first characterization of the stability of individual base pairs and base triads in a DNA triple helix containing a G.TA triad. The DNA investigated is the intramolecular triple helix formed by the 32mer d(AGATAGAACCCCTTCTATCTTATATCTGTCTT). The exchange rates of imino protons in this triple helix have been measured by nuclear magnetic resonance spectroscopy using magnetization transfer from water and real-time exchange. The exchange rates are compared with those in a homologous DNA triple helix in which the G.TA triad is replaced by a canonical C(+).GC triad. The results indicate that, in the G.TA triad, the stability of the Watson-Crick TA base pair is comparable with that of AT base pairs in canonical T.AT triads. However, the presence of the G.TA triad destabilizes neighboring triads by 0.6-1.8 kcal/mol at 1 degrees C. These effects extend to triads that are two positions removed from the site of the G.TA triad. Therefore, the lower stability of DNA triple helices containing G.TA triads originates, in large part, from the energetic effects of the G.TA triad upon the stability of canonical triads located in its vicinity.

A proton nuclear Overhauser effect investigation of the subunit interfaces in human normal adult hemoglobin.

High-resolution proton nuclear magnetic resonance spectroscopy and nuclear Overhauser effects for the low-field exchangeable proton resonances of human normal adult hemoglobin in aqueous solvents are being used to confirm and extend the assignments of these resonances to specific protons at the intersubunit interfaces of the molecule. Most of these exchangeable proton resonances of human normal adult hemoglobin have been found to be absent in the spectra of isolated alpha or beta subunits. This finding indicates that they are specific spectral markers for the quaternary structure of the hemoglobin tetramer. Based on the nuclear Overhauser effect results, we have assigned the exchangeable proton resonance at +7.4 ppm downfield from H2O to the hydrogen-bonded proton between alpha 103(G10)His and beta 108(G10)Asn at the alpha 1 beta 1 interface. The nuclear Overhauser effect results have also confirmed the assignments of the exchangeable proton resonances at +9.4 and +8.2 ppm downfield from H2O previously proposed by workers in this laboratory based on a comparison of human normal adult hemoglobin and appropriate mutant hemoglobins. This independent confirmation of previously proposed assignments is necessary in view of the possible long-range conformational effects of single amino-acid substitutions in mutant hemoglobin molecules.

A proton nuclear magnetic resonance investigation of human hemoglobin A2. Implications on the intermolecular contacts in sickle hemoglobin fibers and on the Bohr effect of human normal adult hemoglobin.

High-resolution proton nuclear magnetic resonance spectroscopy at 300 and 600 MHz has been used to investigate the conformation of a minor hemoglobin component of human blood, hemoglobin A2 (alpha 2 delta 2), in solution. We have found that (i) the replacement of the beta chains by the delta chains in hemoglobin A2 conserves the alpha 1 delta 2 interface but slightly perturbs the alpha 1 delta 1 interface, and (ii) one surface histidine residue in the deoxy form and one in the carbonmonoxy form of hemoglobin A2 have local conformations and/or electrostatic environments which are different from the corresponding ones in human normal adult hemoglobin. By comparing the proton nuclear magnetic resonance titration of individual histidine residues in hemoglobin A2 and in human normal adult hemoglobin, we can conclude that in human normal adult hemoglobin, both beta 116 and beta 117 histidine residues are titratable in both the deoxy and the carbonmonoxy forms. Thus, these two histidine residues can contribute to the Bohr effect of human normal adult hemoglobin. The present nuclear magnetic resonance data on hemoglobin A2 and those previously obtained in our laboratory on sickle hemoglobin suggest that the antisickling property of hemoglobin A2 does not originate from an alteration of the intermolecular contact site at the beta 6 position, but involves additional amino-acid residues which are different in the beta and delta chains. We have found that the replacement of the beta 116 and beta 117 histidine residues in the delta chains does not play a significant role in the antisickling effect of hemoglobin A2 and, thus, these amino-acid residues do not participate in the intermolecular interactions responsible for the polymerization of sickle hemoglobin.

Studying DNA-protein interactions using NMR.

NMR spectroscopy is emerging as a powerful tool in molecular biology and biotechnology; one aspect of which is the use of one- and two-dimensional NMR methodologies to investigate the interactions of proteins with DNA. The dynamic and structural information which NMR can provide, on the changes in conformation and molecular flexibility, complements X-ray crystallography data and enables mechanistic models of DNA-protein interactions to be formulated.

Determination of distances involving exchangeable protons from NOESY spectra of two DNA dodecamers.

Two-dimensional proton nuclear Overhauser effect (NOESY) spectra were obtained as a function of mixing time for two DNA dodecamers, 5'-CGCGAATTCGCG-3' and 5'-CGCAAATTTGCG-3', in aqueous solutions. The time evolution of cross-peak volumes was quantitatively analyzed based on the approximate solution of the relaxation/exchange equation over a range of mixing times from 30 to 150 ms. Inter-proton distances, involving exchangeable protons in key locations of the structures, were calculated and compared to the distances predicted by the crystal structures. These NMR-derived distances enhance the number of constraints, and their accuracy, for determination of solution structures of the two DNA dodecamers.

Base-catalysis of imino proton exchange in DNA: effects of catalyst upon DNA structure and dynamics.

Characterization of the kinetics and energetics of base-pair opening in nucleic acids relies upon measurements of the rates of exchange of imino protons with water protons at high concentrations of the exchange catalyst. Under these conditions, the exchange catalyst may affect structural or dynamic properties of the nucleic acid molecule and thus, limit the significance of the exchange data. To address this problem, we have used NMR spectroscopy to characterize the effects of a catalyst of imino proton exchange, namely, ammonia upon the structure and dynamics of the self-complementary DNA dodecamer [d(CGCAGATCTGCG)]2. The changes in structure were monitored in proton NOESY and DQF-COSY experiments and in phosphorus spectra at 15 degrees C and at ammonia concentrations ranging from 0.002 to 0.5 M. The results indicate that ammonia induces subtle changes in the solution conformation of the dodecamer, but the overall structure is maintained close to the B-type DNA structure. However, the relaxation rates (i.e., transverse, longitudinal, and cross-relaxation rates) of several non-exchangeable protons were found to increase by approximately 50% upon changing ammonia concentration from 0.002 to 0.5 M. The increases were comparable for all protons investigated suggesting that they originate from an ammonia-induced increase in the overall correlation time of the DNA dodecamer. Numerical analysis revealed that the catalyst-induced enhancements in proton relaxation can alter significantly the calculated values of the exchange rates of imino protons, especially those obtained from measurements of the line widths of these proton resonances.

Sequence dependence of base-pair opening in a DNA dodecamer containing the CACA/GTGT sequence motif.

Proton nuclear magnetic resonance spectroscopy is used to characterize the kinetics and energetics of base-pair opening in two self-complementary DNA dodecamer duplexes: [d(CGCACATGTGCG)]2 and [d(CGCAGATCTGCG)]2. The first dodecamer contains two symmetrical CACA/GTGT motifs; in the second dodecamer, each motif is interrupted by a change of the central C.G base pair to a G.C base pair. The opening rates and the equilibrium constants for formation of the open state of each base pair are obtained from the dependence of the imino proton exchange rates on the concentration of ammonia catalyst. The results indicate that the opening rates of the central three base pairs in the CACA/GTGT motif are 3-8-fold larger than the corresponding ones in the CAGA/GTCT sequence. The activation enthalpies and entropies, and the standard enthalpy and entropy changes for formation of the open state, are obtained from the temperature dependence of the opening rates and equilibrium constants, respectively. The results reveal that enthalpy/entropy compensation exists, for all base pairs in both dodecamers, in activation as well as in the equilibria between closed and open states. As a result, the opening rates and equilibrium constants for opening are maintained, in both dodecamers, within a relatively narrow range of values. Nevertheless, large sequence-induced variations are observed for the activation enthalpies and the standard enthalpy changes for opening. The A.T base pair located between the C.G base pairs in the CACA/GTGT motif has a negative enthalpy change for formation of the activated state during opening. This is the first case in which a negative activation enthalpy is observed for opening of a Watson-Crick base pair in DNA.(ABSTRACT TRUNCATED AT 250 WORDS)

Assessment of role of beta 146-histidyl and other histidyl residues in the Bohr effect of human normal adult hemoglobin.

The contribution of the carboxyl-terminal histidines of the beta chains, beta 146(HC3), to the alkaline Bohr effect of human normal adult hemoglobin has been shown by this laboratory to depend upon the solvent composition. Using high-resolution proton nuclear magnetic resonance spectroscopy, we have found that the pKa value of the beta 146-histidine is 8.0 in the deoxy form, while in the carbonmonoxy form it ranges from 7.1 to 7.85 depending upon the concentration of inorganic phosphate and chloride ions present. These conclusions have been questioned by Perutz and co-workers on the basis of biochemical, structural, and proton nuclear magnetic resonance studies of mutant and enzymatically or chemically modified hemoglobins [Perutz, M. F., Kilmartin, J. V., Nishikura, K., Fogg, J. H., Butler, P. J., & Rollema, H. S. (1980) J. Mol. Biol. 138, 649-670; Kilmartin, J. V., Fogg, J. H., & Perutz, M. F. (1980) Biochemistry 19, 3189-3193; Perutz, M. F., Gronenborn, A. M., Clore, G. M., Fogg, J. H., & Shih, D. T.-b. (1985) J. Mol. Biol. 183, 491-498]. In this work, we use proton nuclear magnetic resonance spectroscopy to assess the effects of structural modifications on the histidyl residues and on the overall conformation of the hemoglobin molecule in solution. The structural perturbations investigated all occur within the tertiary domains around the carboxyl-terminal region of the beta chain as follows: Hb Cowtown (beta 146His----Leu); Hb Wood (beta 97His----Leu); Hb Malmö (beta 97His----Gln); Hb Abruzzo (beta 143His----Arg). Our results demonstrate that the conformational effects of single-site structural modifications upon the conformation and dynamics of hemoglobin depend strongly on their location in the three-dimensional structure of the protein molecule and also on their chemical nature. Furthermore, in normal hemoglobin, the spectral properties of several surface histidyl residues are found to depend, in the ligated state, upon the nature of the ligand. Our present findings do not support the recent spectral assignments proposed by Perutz et al. (1985) for the proton resonances of the beta 146- and beta 97-histidines and their suggestion that the enzymatic removal of the carboxyl-terminal beta 146-histidyl residues induces a conformational equilibrium for the beta 97-histidines in the des-beta 146His hemoglobin molecule in the carbonmonoxy form.

Proton NMR studies of the molecular basis for the anti-sickling activity of non-covalent antisickling compounds.

Two new techniques of nuclear magnetic resonance spectroscopy are proposed to identify and characterize the binding sites of antisickling compounds to Hb S: measurements of the longitudinal relaxation rates (T1(-1)) of the C2 protons of individual surface histidyl residues of the C2 protons of individual surface histidyl residues of Hb S and intermolecular transferred nuclear Overhauser effects from protons in the heme pockets of the Hb S molecule. Using these methods, we have investigated the binding sites of L-phenylalanine, L-tryptophan, L-valine, and p-bromobenzylalcohol to sickle hemoglobin. With the exception of L-valine, all of these molecules are known to inhibit the polymerization of deoxy Hb S. We have found that for the compounds with antisickling activity, there are at least two binding sites to the Hb S molecule, one at or near the heme pockets of the alpha and beta chains and the other one in the vicinity of the beta 6 mutation site.

Sequence dependence of purine C8H exchange kinetics in the dodecamer 5'-d(CGCGAATTCGCG)-3'.

Proton nmr spectroscopy is used to measure the deuterium exchange rates of C8 protons in individual purines of the dodecamer 5'-d(CGCGAATTCGCG)-3' and their temperature dependence. In perfect agreement with results from tritium labeling and laser Raman spectroscopy, we find that the DNA secondary structure retards the rates of purine C8H exchange. The largest effects are observed for the C8 protons of adenines whose rates of exchange at 40 degrees C are 3- to 4-fold lower than that in 5'-adenosine monophosphate. Moreover, the retardation of exchange at the central adenine is greater than that at its 5'-neighbor. For the guanines, the exchange rates are up to 2-fold lower than that in 5'-guanosine monophosphate, and the largest retardation is observed for the bases at positions 10 and 12. A dependence on base sequence is also observed for the activation energy for exchange. The activation energy is largest for the adenines and its value is 4 kcal/mol higher than that in 5'-adenosine monophosphate. The lowest activation energy is observed for the guanine in position 4 and the value is the same as in 5'-guanosine monophosphate. These results demonstrate the sensitivity of the purine C8H exchange kinetics to sequence-dependent conformational features of B-DNA in solution state.

Kinetics and energetics of base-pair opening in 5'-d(CGCGAATTCGCG)-3' and a substituted dodecamer containing G.T mismatches.

Proton nuclear magnetic resonance (NMR) spectroscopy is used to characterize the kinetics and energetics of base-pair opening in the dodecamers 5'-d(CGCGAATTCGCG)-3' and 5'-d(CGCGAATTTGCG)-3'. The latter dodecamer contains two symmetrical G.T mismatched base pairs. The exchange kinetics of imino protons is measured from resonance line widths and selective longitudinal relaxation times. For the G.T pair, the two imino protons (G-N1H and T-N3H) provide probes for the opening of each base in the mismatched pair. The lifetimes of individual base pairs in the closed state and the equilibrium constants for formation of the open state are obtained from the dependence of the exchange rates on the concentration of ammonia catalyst. The activation energies and standard enthalpy changes for base-pair opening are obtained from the temperature dependence of the lifetimes and equilibrium constants, respectively. The results indicate that the G.T mismatched pairs are kinetically and energetically destabilized relative to normal, Watson-Crick base pairs. The lifetimes of the G.T pairs are of the order of 1 ms or less, over the temperature range from 0 to 20 degrees C. The equilibrium constants for base-pair opening, at 20 degrees C, are increased up to 4000-fold, relative to those of normal base pairs. The energetic destabilization of the G.T base pairs is, at least in part, enthalpic in origin. The presence of the G.T mismatched base pairs destabilizes also neighboring base pairs.(ABSTRACT TRUNCATED AT 250 WORDS)

Proton longitudinal relaxation investigation of histidyl residues of normal human adult and sickle deoxyhemoglobin: evidence for the existence of pregelation aggregates in sickle deoxyhemoglobin solutions.

Proton nuclear magnetic resonance longitudinal-relaxation-rate measurements have been used to investigate the molecular events that occur during the early stages of the polymerization process of sickle hemoglobin. The longitudinal relaxation rates (T1-1) of the C2 protons of 11 observable surface histidyl residues in normal human adult and sickle hemoglobin in the deoxy state were measured in 0.1 M bis[(2-hydroxyethyl)imino]tris(hydroxymethyl)methane (pH 6.8) in 2H2O. These proton resonances in hemoglobin occur at a position 1.5-5.0 ppm downfield from that of residual water in 2H2O. The T1-1 values for the C2 protons of several surface histidyl residues in sickle hemoglobin in the deoxy state were sensitive to the temperature and the concentration of hemoglobin, factors known to have a profound effect on the polymerization process of sickle hemoglobin. For hemoglobin concentrations of 13.5% or less and temperatures of 25 degrees C or less, the T1-1 values in sickle hemoglobin solutions were the same as the corresponding values in normal hemoglobin, except for the C2 proton of beta 2 histidine, which had a larger T1-1 value. When the temperature or the hemoglobin concentration was increased (i) several additional histidine resonances in sickle hemoglobin solutions had larger T1-1 values than the corresponding ones in normal hemoglobin and (ii) the differences between the T1-1 values (sickle versus normal hemoglobin) of these histidine resonances as well as that of the beta 2 histidine resonance gradually increased. It is proposed that these results reflect the formation of small aggregates in the deoxygenated sickle hemoglobin solutions before gelation. In this model, the histidyl residues for which the T1-1 values are greatly increased in sickle hemoglobin solutions as compared with those in normal hemoglobin are viewed as being located in or near the "contact" areas between sickle hemoglobin molecules within the pregelation aggregates. Thus, this magnetic resonance technique can also be used to identify the intermolecular contacts in the polymerization of sickle hemoglobin.

Proton longitudinal relaxation investigation of histidyl residues in human normal adult hemoglobin.

The longitudinal relaxation of the C2 protons of surface histidyl residues as well as other aromatic protons of human normal adult deoxyhemoglobin investigated at 360 MHz is discussed in terms of the theory proposed by Kalk and Berendsen for the proton longitudinal relaxation in proteins (Kalk, A., and H.J.C. Berendsen. 1976. J. Magn. Reson. 24:343-366). The role of the four paramagnetic iron atoms of deoxyhemoglobin as fast-relaxing sinks for the overall proton longitudinal relaxation is evaluated according to the model proposed by Bloembergen for the relaxation of nuclei in crystals containing paramagnetic centers (Bloembergen, N. 1949. Physica. 15:386-426). The results suggest that the effectiveness of the paramagnetic iron atoms of deoxyhemoglobin for the overall proton longitudinal relaxation is reduced as a result of slower spin diffusion and wide distribution of methyl groups within the hemoglobin molecule. Thus, deoxyhemoglobin provides a good model for investigating the influence of cross relaxation on proton longitudinal relaxation in proteins at the slow motion limit and in the presence of paramagnetic centers. For the C2 protons of surface histidyl residues, we show that the cross relaxation resulting from the interresidue dipolar interaction makes an important contribution to their longitudinal relaxation.

A proton nuclear magnetic resonance investigation of histidyl residues in sickle hemoglobin.

Using high-resolution proton nuclear magnetic resonance spectroscopy at 250 MHz, we have determined the individual pK values of 22 surface histidyl residues (11 per alpha beta dimer) of sickle hemoglobin in both deoxy and carbon monoxy forms. Seven histidyl residues in the deoxy form and three in the carbon monoxy form are found to have pK values and chemical shifts different from the corresponding ones in human normal adult hemoglobin. Two of these histidyl residues are the beta 2 histidine and the beta 146 histidine, indicating that the conformations of the amino- and carboxyl-terminal regions of the beta chain in sickle hemoglobin are altered compared to those in human normal adult hemoglobin. The differences in the pK values of the additional surface histidyl residues between sickle and normal hemoglobins suggest that the effect of the amino acid substitution at the sixth position of the beta chain in sickle hemoglobin, namely, glutamic acid replaced by valine, is not restricted to the region around the mutation site but can extend to other regions in the protein molecule. In the deoxy form, the histidyl residues of sickle hemoglobin that have altered pK values and chemical shifts compared to the corresponding ones in human normal adult hemoglobin have been found to be sensitive to the early stages of the polymerization process [Russu, I.M., & Ho, C. (1980) Proc. Natl. Acad. Sci. U.S.A. 77, 6577-6581].

Rotational dynamics of adenine amino groups in a DNA double helix.

Exocyclic amino groups of the bases undergo conformational fluctuations that affect the recognition and reactivity of nucleic acid molecules. Among these fluctuations, rotation of amino groups around C-N bonds is of special interest. In the present paper, we report the first determination of the rates and energetic parameters for rotation of the N6-amino group of adenine in a DNA double helix. The DNA molecule studied is the dodecamer [d(CGCGAGCTCGCG)]2. The adenine in each A. T basepair of the dodecamer was labeled with 15N at the N6 position, and the NMR resonances of the two protons in the adenine amino group were selectively observed by 15N-editing methods. The rates of rotation of the amino group were obtained from experiments of transfer of magnetization between the two protons in the same group and from lineshape analysis of 15N-edited amino proton NMR resonances. The results show that, over the temperature range from 0 to 70 degrees C, the rates of rotation of adenine amino groups range from 60 to 24,000 s-1. Formation of the activated state during rotation has a standard enthalpy change of 15.3 +/- 0.2 kcal/mol and a standard entropy change of 6.0 +/- 0.7 cal/(mol. K). Analysis of the results suggests that rotation of the amino group occurs in the paired, closed state of the adenine in the A. T basepair of the double-helical DNA structure.

A signature of the T ---> R transition in human hemoglobin.

Allosteric effects in hemoglobin arise from the equilibrium between at least two energetic states of the molecule: a tense state, T, and a relaxed state, R. The two states differ from each other in the number and energy of the interactions between hemoglobin subunits. In the T state, constraints between subunits oppose the structural changes resulting from ligand binding. In the R state, these constraints are released, thus enhancing ligand-binding affinity. In the present work, we report the presence of four sites in hemoglobin that are structurally stabilized in the R relative to the T state. These sites are His alpha 103(G10) and His alpha 122(H5) in each alpha subunit of hemoglobin. They are located at the alpha(1)beta(1) and alpha(2)beta(2) interfaces of the hemoglobin tetramer, where the histidine side chains form hydrogen bonds with specific residues from the beta chains. We have measured the solvent exchange rates of side chain protons of His alpha 103(G10) and His alpha 122(H5) in both deoxygenated and ligated hemoglobin by NMR spectroscopy. The exchange rates were found to be higher in the deoxygenated-T than in ligated-R state. Analysis of exchange rates in terms of the local unfolding model revealed that the structural stabilization free energy at each of these two histidines is larger by approximately 1.5 kcal/(mol tetramer) in the R relative to the T state. The location of these histidines at the intradimeric alpha(1)beta(1) and alpha(2)beta(2) interfaces also suggests a role for these interfaces in the allosteric equilibrium of hemoglobin.

Proton exchange and base-pair opening kinetics in 5'-d(CGCGAATTCGCG)-3' and related dodecamers.

We have used nuclear magnetic resonance (NMR) spectroscopy to measure the lifetimes of individual base-pairs in the palindromic DNA oligonucleotide 5'-d(CGCGAATTCGCG)-3' and in three other dodecamers with symmetrical base substitutions in the sites underlined. The resonances of the hydrogen-bonded imino protons in each of the substituted oligomers in the duplex form have been assigned using one dimensional nuclear Overhauser effect (1-D NOE) experiments. The lifetimes have been obtained from the dependence of selective longitudinal relaxation times and linewidths of the imino proton resonances on the concentration of base catalyst (Tris) at 25 degrees C and in the presence of 50 mM NaCl. The lifetimes of the central A.T base-pairs have been found to depend on base sequence. They are greatly increased in the dodecamer 5'-d(CGCAAATTTGCG)-3' which contains an A3T3 tract. The lifetimes of the central A.T base-pairs in 5'-d(CGCGAATTCGCG)-3', 5'-d(CGCTAATTAGCG)-3' and 5'-d(CGCCAATTGGCG)-3' are comparable. In all dodecamers, the lifetime of the A.T base-pair at the 5'-end of the AnTn tract is the shortest. The anomalous opening kinetics of the A.T base-pairs can be correlated to the bending properties of the corresponding sequences.

Energetics of base pair opening in a DNA dodecamer containing an A3T3 tract.

Nuclear magnetic resonance spectroscopy has been used to characterize the kinetics and energetics of opening of base pairs in the DNA dodecamer [d(CGCAAATTTGCG)]2. The dodecamer contains an A3T3 tract that induces intrinsic curvature of the helix axis. Previous studies from this and other laboratories have shown that the kinetics of base pair opening in AnTn tracts is unique: the opening rates of the A.T base pairs in the interior of the tract are much lower than that of the A.T base pair at the 5'-end of the tract. In the present work, we have investigated the energetics of the pathways for opening of the A.T base pairs in the A3T3 tract. The energetic parameters of the activated state(s) are obtained from the temperature dependence of the opening rate constants. The lower opening rates for the A.T base pairs situated in the interior of the tract are shown to originate from higher activation enthalpies which are compensated, in part, by increases in the activation entropies. We have also obtained an energetic characterization of the open state(s) of the A.T base pairs in the dodecamer by measuring the equilibrium constants for base pair opening and their temperature dependence. The results suggest that the transitions from closed to open state(s) in the A.T base pairs of the A3T3 tract are energetically similar.

A proton nuclear magnetic resonance investigation of histidyl residues in human normal adult hemoglobin.

High-resolution proton nuclear magnetic resonance (NMR) spectroscopy at 250 MHz has been used to titrate 22 individual surface histidyl residues (11 per alpha beta dimer) of human normal adult hemoglobin in both the deoxy and the carbon monoxy forms. The proton resonances of beta 2, beta 143, and beta 146 histidyl residues are assigned by a parallel 1H NMR titration of appropriate mutant and chemically modified hemoglobins. The pK values of the 22 histidyl residues investigated are found to range from 6.35 to 8.07 in the deoxy form and from 6.20 to 7.87 in the carbon monoxy form, in the presence of 0.1 M Bis-Tris or 0.1 M Tris buffer in D2O with chloride ion concentrations varying from 5 to 60 mM at 27 degrees C. Four histidyl residues in the deoxy form and one histidyl residue in the carbon monoxy form are found to have proton nuclear magnetic resonance titration curves that deviate greatly from that predicted by the simple proton dissociation equilibrium of a single ionizable group. The proton nuclear magnetic resonance data are used to ascertain the role of several surface histidyl residues in the Bohr effect of hemoglobin under the above-mentioned experimental conditions. Under these experimental conditions, we have found that (i) the beta 146 histidyl residues do not change their electrostatic environments significantly upon binding of ligand to deoxyhemoglobin and, thus, their contribution to the Bohr effect is negligible, (ii) the beta 2 histidyl residues have a negative contribution to the Bohr effect, and (iii) the total contribution of the 22 histidyl residues investigated here to the Bohr effect is, in magnitude, comparable to the Bohr effect observed experimentally. These results suggest that the molecular mechanism of the Bohr effect proposed by Perutz [Perutz, M.F. (1970) Nature (London) 228, 726-739] is not unique and that the detailed mechanism depends on experimental conditions, such as the solvent composition.