Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 26
Filtrar
1.
J Endocrinol Invest ; 47(1): 47-58, 2024 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-37326909

RESUMO

PURPOSE: Lipocalin 2 (LCN2) is a newly recognized bone-derived factor that is important in regulation of energy metabolism. We investigated the correlation of serum LCN2 levels and glycolipid metabolism, and body composition in a large cohort of patients with osteogenesis imperfecta (OI). METHODS: A total of 204 children with OI and 66 age- and gender-matched healthy children were included. Circulating levels of LCN2 and osteocalcin were measured by enzyme-linked immunosorbent assay. Serum levels of fasting blood glucose (FBG), triglyceride (TG), total cholesterol (TC), and low- and high-density lipoprotein cholesterol (LDL-C, HDL-C) were measured by automated chemical analyzers. The body composition was measured by dual-energy X-ray absorptiometry. Grip strength and timed-up-and-go (TUG) were tested to evaluate the muscle function. RESULTS: Serum LCN2 levels were 37.65 ± 23.48 ng/ml in OI children, which was significantly lower than those in healthy control (69.18 ± 35.43 ng/ml, P < 0.001). Body mass index (BMI) and serum FBG level were significantly higher and HDL-C levels were lower in OI children than healthy control (all P < 0.01). Grip strength was significantly lower (P < 0.05), and the TUG was significantly longer in OI patients than healthy control (P < 0.05). Serum LCN2 level was negatively correlated to BMI, FBG, HOMA-IR, HOMA-ß, total body, and trunk fat mass percentage, and positively correlated to total body and appendicular lean mass percentage (all P < 0.05). CONCLUSIONS: Insulin resistance, hyperglycemia, obesity, and muscle dysfunction are common in OI patients. As a novel osteogenic cytokine, LCN2 deficiency may be relevant to disorders of glucose and lipid metabolism, and dysfunction of muscle in OI patients.


Assuntos
Resistência à Insulina , Osteogênese Imperfeita , Criança , Humanos , Lipocalina-2 , Composição Corporal , HDL-Colesterol , Metabolismo dos Lipídeos , Glicolipídeos
2.
Zhonghua Nei Ke Za Zhi ; 62(1): 117-121, 2023 Jan 01.
Artigo em Zh | MEDLINE | ID: mdl-36631049

RESUMO

A 36-year-old woman was admitted to the Peking Union Medical College Hospital with a history of fractures for 2 years, limb weakness for 1 year, and ostealgia for 2 months. The patient's examination identified iron deficiency anemia, significantly decreased serum calcium and 25-hydroxyvitamin D3 levels, and increased alkaline phosphatase and parathyroid hormone levels. Imaging showed several typical signs of osteomalacia. Considering the history of Roux-en-Y gastric bypass surgery, the diagnosis was considered to be osteomalacia caused by a postoperative nutritional absorption disorder. The patient was supplemented with calcitriol, calcium, and vitamin D and gradually returned to normal physical activity. The bone metabolism indicators and bone density were significantly improved.


Assuntos
Derivação Gástrica , Osteomalacia , Feminino , Humanos , Adulto , Derivação Gástrica/efeitos adversos , Derivação Gástrica/métodos , Cálcio , Osteomalacia/etiologia , Hormônio Paratireóideo , Vitamina D
3.
Zhonghua Nei Ke Za Zhi ; 61(1): 66-71, 2022 Jan 01.
Artigo em Zh | MEDLINE | ID: mdl-34979772

RESUMO

Objective: To analyze the clinical characteristics and molecular mechanisms of 5 cases of hypoparathyroidism caused by GATA3 gene mutation. Methods: A total of 5 childhood-onset hypoparathyroidism patients with GATA3 mutation were identified from 198 hypoparathyroidism (aged ≤18 years) from 1975 to 2021 in Peking Union Medical College Hospital. Clinical data and biochemical indices of the 5 patients were collected and analyzed retrospectively. Genetic screening was conducted by targeted next-generation sequencing (T-NGS), and bioinformatics analysis was performed to analyze the underline mechanisms. Results: The medium onset age of hypoparathyroidism of the 5 patients was 0.5 (0.1, 1.3) years old, and the time duration from onset to confirmed diagnosis of hypoparathyroidism and hypoparathyroidism- deafness-renal dysplasia syndrome was (7.0±5.2) years and (15.0±5.4) years, respectively. The clinical manifestations included carpopedal spasm accompanied by seizures (5 cases), basal ganglia calcification (5 cases), cataract (1 case), deafness (4 cases), and renal malformations or absence (2 cases). The blood calcium and blood parathormone(PTH) before treatment was (1.65±0.31) mmol/L and (4.64±2.63) ng/L, respectively. The 5 patients carried different heterozygous mutations in GATA3 gene, which caused nonsense mutations, frameshift mutations and splice site mutations, respectively. All the GATA3 gene mutations of the 5 patients are classified as pathogenic or likely pathogenic by the Clin Var database and American College of Medical Genetics and Genomics(ACMG). Conclusions: Attention should be paid to genetic diseases in patients with childhood-onset hypoparathyroidism. The possibility of hypoparathyroidism-deafness-renal dysplasia syndrome should be considered in hypoparathyroidism patients with hearing loss or renal dysplasia. GATA3 gene screening is highly recommended for the confirmation of the diagnosis.


Assuntos
Hipoparatireoidismo , Anormalidades Urogenitais , Criança , Fator de Transcrição GATA3/genética , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Hipoparatireoidismo/genética , Mutação , Estudos Retrospectivos
4.
J Endocrinol Invest ; 44(4): 773-780, 2021 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32725396

RESUMO

PURPOSE: Tumor-induced osteomalacia (TIO) is an acquired form of hypophosphatemia caused by tumors with excess production of fibroblast growth factor 23 (FGF23). Some reports showed that TIO patients had renal Fanconi syndrome (FS) with unidentified mechanism. In this study, we investigated the association between genetic polymorphisms of phosphate transporters in renal proximal tubules and TIO with FS. METHODS: We recruited 30 TIO patients with FS (TIO-FS) as well as 30 TIO patients (TIO-nonFS) without any urine abnormalities matched by age and gender. We collected clinical manifestations and conducted targeted sequencing of SLC34A1, SLC34A3 and XPR1 genes and the association analysis between variants in TIO with FS and phenotypes. RESULTS: TIO-FS group had lower levels of serum phosphate (0.44 ± 0.12 vs. 0.51 ± 0.07 mmol/L, p < 0.05) than TIO-nonFS group. Among the 16 SNPs in SLC34A1, SLC34A3 and XPR1 genes, GG/GC genotypes of rs148196667 in XPR1 and AA/TA genotypes of rs35535797 in SLC34A3 were associated with a reduced susceptibility to have FS. The G allele of rs148196667 in XPR1 decreased the risk of FS. The GGAA haplotype in SLC34A3 and GCT haplotype in XPR1 were associated with a decreased risk for FS. CONCLUSIONS: The polymorphisms of XPR1 and SCL34A3 are associated with TIO patients with Fanconi syndrome. It provides novel insight to the relationship of phosphate transportation and general functions of renal proximal tubules.


Assuntos
Síndrome de Fanconi , Receptores Acoplados a Proteínas G/genética , Receptores Virais/genética , Proteínas Cotransportadoras de Sódio-Fosfato Tipo IIc/genética , Adulto , China/epidemiologia , Síndrome de Fanconi/epidemiologia , Síndrome de Fanconi/genética , Síndrome de Fanconi/fisiopatologia , Feminino , Fator de Crescimento de Fibroblastos 23 , Fatores de Crescimento de Fibroblastos/metabolismo , Humanos , Hipofosfatemia/diagnóstico , Hipofosfatemia/etiologia , Túbulos Renais Proximais/metabolismo , Masculino , Osteomalacia/complicações , Osteomalacia/diagnóstico , Osteomalacia/epidemiologia , Osteomalacia/metabolismo , Síndromes Paraneoplásicas/complicações , Síndromes Paraneoplásicas/diagnóstico , Síndromes Paraneoplásicas/epidemiologia , Síndromes Paraneoplásicas/metabolismo , Fosfatos/metabolismo , Polimorfismo Genético , Receptor do Retrovírus Politrópico e Xenotrópico
5.
Zhonghua Wai Ke Za Zhi ; 59(6): 401-421, 2021 Jun 01.
Artigo em Zh | MEDLINE | ID: mdl-34102722

RESUMO

Pancreatic neuroendocrine neoplasms (pNENs) are highly heterogeneous, and the management of pNENs patients can be intractable. To address this challenge, an expert committee was established on behalf of the Group of Pancreatic Surgery, Chinese Society of Surgery, Chinese Medical Association, which consisted of surgical oncologists, gastroenterologists, medical oncologists, endocrinologists, radiologists, pathologists, and nuclear medicine specialists. By reviewing the important issues regarding the diagnosis and treatment of pNENs, the committee concluded evidence-based statements and recommendations in this article, in order to further improve the management of pNENs patients in China.


Assuntos
Tumores Neuroendócrinos , Neoplasias Pancreáticas , China , Humanos , Tumores Neuroendócrinos/cirurgia , Tumores Neuroendócrinos/terapia , Pancreatectomia , Neoplasias Pancreáticas/cirurgia , Neoplasias Pancreáticas/terapia
6.
Zhonghua Nei Ke Za Zhi ; 59(1): 23-28, 2020 Jan 01.
Artigo em Zh | MEDLINE | ID: mdl-31887832

RESUMO

Objective: To investigate the association of GNA11 gene polymorphisms with the risk of adult-onset non-surgical hypoparathyroidism (Ns-HypoPT). Methods: Genotyping of GNA11 single nucleotide polymorphisms (SNPs) (rs28685098, rs4806907, rs11084997 and rs78003011) was carried out in 203 patients and 209 healthy participants by sequenom MassArray iPLEX System. These SNPs are located in promoter and 3'untranslated region (3'UTR) of GNA11 gene, respectively. Results: Allele and genotype frequencies of rs11084997 in patients were significantly different from those of controls (genotype GG:60.5% vs. 49.8%, GC: 35.5% vs. 41.6%, CC: 4.0% vs. 8.6%, P=0.038; G allele 78.3% vs. 70.6%, C allele 21.7% vs. 29.4%, P=0.012), and the C allele of rs11084997 carriers had a lower risk to develops Ns-HypoPT in additive and dominant genetic models [OR=0.382 (0.160-0.915), 0.647 (0.437-0.957)]. CC-Haplotype formed by the minor alleles of rs4806907 and rs11084997 was associated with a decreased risk of Ns-HypoPT in additive, dominant and recessive genetic model [OR=0.317 (0.126-0.801), 0.640 (0.430-0.952), 0.367 (0.148-0.912)]. Conclusion: The minor allele C of rs11084997 in GNA11 gene promoter was associated with decreased risk of Ns-HypoPT in Chinese population.


Assuntos
Subunidades alfa de Proteínas de Ligação ao GTP/genética , Predisposição Genética para Doença , Hipoparatireoidismo/genética , Adulto , Alelos , Povo Asiático , Estudos de Casos e Controles , China , Subunidades alfa de Proteínas de Ligação ao GTP/metabolismo , Frequência do Gene , Genótipo , Humanos , Hipoparatireoidismo/diagnóstico , Polimorfismo de Nucleotídeo Único
7.
Zhonghua Nei Ke Za Zhi ; 59(10): 788-795, 2020 Oct 01.
Artigo em Zh | MEDLINE | ID: mdl-32987481

RESUMO

Objective: To provide more options for preoperative localization diagnosis in patients with primary hyperparathyroidism (PHPT), the diagnostic efficacy of parathyroid 4-dimensional computed tomography (4D-CT) in patients with PHPT was evaluated. Methods: This was a single-center retrospective study including 57 patients with surgical proved PHPT. All of the patients underwent 4D-CT, 99Tcm -sestamibi parathyroid imaging (MIBI), and ultrasonography (US) preoperatively. The reference standard for correct localization was based on operation reports and pathology confirmation. The patients were grouped according to the preoperative serum calcium levels, tumor diameter, or ectopic lesions (yes/no), respectively. The sensitivity, specificity, positive predictive value, negative predictive value and area under the curve (AUC) of 4D-CT, MIBI and US, alone or in combination, were analyzed in total and each subgroup patients. Results: Fifty-seven patients (39 women, 18 men; mean age of 56.5 years) were evaluated, including four cases with multi-gland disease and thirteen cases with ectopic parathyroid lesions. In all the patients, similar diagnostic efficacy was found in 4D-CT (AUC: 0.943) and MIBI (AUC: 0.927), both of which were higher than that of US (AUC: 0.847) (P = 0.01 for 4D-CT vs. US; P = 0.04 for MIBI vs. US). In a subset analysis for ectopic quadrants, the diagnostic efficacy of 4D-CT was significantly higher than that of MIBI (P = 0.04) or US (P = 0.01), with the sensitivity of 100%, 69.2%, and 61.5%, and AUC of 0.989, 0.846, and 0.808 for 4D-CT, MIBI and US, respectively. Conclusions: 4D-CT has similar diagnostic efficacy for preoperative localization to MIBI in patients with PHPT, and it is superior to MIBI and US in identifying the ectopic parathyroid gland. 4D-CT can be recommended as an alternative preoperative localization method, especially when parathyroid lesions could not be precisely located by US and MIBI.


Assuntos
Tomografia Computadorizada Quadridimensional , Hiperparatireoidismo Primário , Feminino , Humanos , Hiperparatireoidismo Primário/diagnóstico por imagem , Hiperparatireoidismo Primário/cirurgia , Masculino , Pessoa de Meia-Idade , Compostos Radiofarmacêuticos , Estudos Retrospectivos , Sensibilidade e Especificidade , Tecnécio Tc 99m Sestamibi
8.
J Endocrinol Invest ; 42(10): 1245-1252, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31004291

RESUMO

PURPOSE: Primary hypertrophic osteoarthropathy (PHO) is an inherited disease characterized by digital clubbing, periostosis and pachydermia with defects in the degradation of prostaglandin E2 (PGE2). Mutations in SLCO2A1 gene-encoding prostaglandin transporter (PGT) resulted in PHO, autosomal recessive 2 (PHOAR2). The spectrum of mutations and variable clinical complications of PHOAR2 has been delineated. In this study, we investigated a Chinese PHO family with a manifestation of Bartter-like hypokalemia. METHODS: Clinical manifestations were collected and genetic analyses were performed in the PHO family. RESULTS: The 33-year-old male proband had severe hypokalemia due to potassium loss from the kidney, while his brother had mild hypokalemia. After being treated with etoricoxib, the serum potassium level of the patient increased rapidly to the normal range which corresponded with the reduction in his serum PGE2 and PE2 metabolite (PGEM) levels. A novel SLCO2A1 compound heterozygous mutation of p.I284V and p.C459R was identified in two PHO patients in this family. CONCLUSIONS: The present findings supported that the Bartter-like hypokalemia is a new complication of PHOAR2 caused by the high level of PGE2. Etoricoxib was demonstrated to be effective for the renal hypokalemia in PHO patients.


Assuntos
Síndrome de Bartter/genética , Hipopotassemia/genética , Mutação de Sentido Incorreto , Transportadores de Ânions Orgânicos/genética , Osteoartropatia Hipertrófica Primária/genética , Adulto , Povo Asiático/genética , Síndrome de Bartter/complicações , China , Análise Mutacional de DNA , Família , Heterozigoto , Humanos , Hipopotassemia/etiologia , Masculino , Osteoartropatia Hipertrófica Primária/complicações , Linhagem
9.
Zhonghua Yi Xue Za Zhi ; 98(8): 581-586, 2018 Feb 27.
Artigo em Zh | MEDLINE | ID: mdl-29534385

RESUMO

Objective: To investigate the glucose and lipid metabolic disorders in patients with myasthenia gravis (MG) without glucocorticoid therapy, and the relationships between insulin, insulin resistance, muscle strength, serum levels of osteocalcin, 25-hydroxy vitamin D (25OHD) and glucose and lipid metabolism. Methods: A total of 102 MG patients [(40±11) years old, 43 males and 59 females] without glucocorticoid treatment were enrolled in this cross-sectional study. Height, weight and the handgrip of dominant hands were measured. Serum levels of fasting blood glucose (FBG), 2-hour postprandial blood glucose (2 h PBG), glycosylated hemoglobin (HbA1c), fasting insulin (FINS), 2-hour postprandial insulin (2 h PINS), total cholesterol (TC), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and osteocalcin, 25OHD were detected. Insulin resistance was assessed using homeostasis model assessment of insulin resistance (HOMA-IR). Results: The proportion of impaired fasting glucose or impaired glucose tolerance, type 2 diabetes, dyslipidemia, hyperinsulinemia in male and female were 30.0%, 10.0%, 50.0%, 33.3% and 17.5%, 3.5%, 27.7%, 7.1%, respectively. Serum osteocalcin levels in male and female were 2.8 (1.7, 4.4) µg/L and 2.3 (1.3, 3.9) µg/L, respectively. And 25OHD levels in male and female were (93.5±34.9) nmol/L and (81.0±30.5) nmol/L, respectively. Handgrip of male and female was (37.0±9.4) kg and (20.5±6.3) kg. After adjusted for age, FINS (r=0.619, P<0.001), 2 h PINS (r=0.640, P<0.001), HOMA-IR (r=0.534, P<0.001) were positively correlated with 2 h PBG, and the handgrip was negatively correlated with TC (r=-0.486, P=0.026), LDL-C (r=-0.485, P=0.026) in male. FINS (r=0.352, P=0.008; r=0.300, P=0.026; r=0.646, P<0.001) and 2 h PINS (r=0.278, P=0.040; r=0.518, P<0.001; r=0.382, P=0.006) and HOMA-IR (r=0.695, P<0.001; r=0.583, P<0.001; r=0.818, P<0.001) were positively correlated with FBG, 2 h PBG, HbA1c, and the handgrip were negatively correlated with FBG (r=-0.424, P=0.016), 2 h PINS (r=-0.345, P=0.034) and positively correlated with HDL-C (r=0.389, P=0.037) in female. There was no association between osteocalcin, 25OHD and glucose and lipid metabolism. Multivariate linear regression analysis also found that there were significant relationships between handgrip, insulin, insulin resistance levels and glucose and lipid metabolic disorders. Conclusion: There was a high proportion of glucose and lipid metabolic disorders in MG patients without glucocorticoid treatment, and the mechanism may be related to insulin resistance induced by muscle weakness.


Assuntos
Miastenia Gravis , Adulto , Glicemia , Estudos Transversais , Diabetes Mellitus Tipo 2 , Feminino , Glucose , Força da Mão , Humanos , Insulina , Resistência à Insulina , Masculino , Pessoa de Meia-Idade
10.
Zhonghua Yi Xue Za Zhi ; 98(18): 1408-1413, 2018 May 15.
Artigo em Zh | MEDLINE | ID: mdl-29804403

RESUMO

Objective: To explore the association between α-actinin-3 (ACTN3) polymorphism and muscle strength in postmenopausal women. Methods: Five hundred and ninety-eight postmenopausal women with an average of (62.9±7.0) years old in Dongcheng District of Beijing were included. The ACTN3 polymorphism including rs540874, rs618838 and rs2229456 were genotyped by Sequenom Mass Array to explore their associations with muscle strength. One hundred and sixty-three of them were trained with regular Tai chi movement while 271 were administered with elemental calcium 600 mg/d combined with Vitamin D 800 U/d or calcitriol 0.25 µg/d for 2 years. Association between changes of muscle strength and ACTN3 polymorphism were analyzed. Results: The rs540874 genotypes were found to be significantly associated with chair stand test[GG (9.02±3.85) s vs GA (9.27±4.14) s vs AA (9.68±5.00) s, P=0.015]. Right grip strength in women with G allele were likely to be higher compared with A allele, but it was not statistically significant (P=0.056). Multiple linear regression showed that the chair stand test of AA genotype was statistically longer than that of GG and GA genotype (ß=2.639, 95% CI: 1.632-4.646, P=0.010). The associations between rs618838, rs2229456 genotypes and muscle strength of both lower and upper limbs were not significant (all P>0.05). In addition, muscle strength of lower limbs of patients with rs540874 genotyped with G allele, rs618838 genotyped with C allele and rs2229456 genotyped with A allele increased significantly after enhanced exercise and vitamin D supplementation (all P<0.05). Conclusions: The rs540874 polymorphism of ACTN3 gene was associated with the muscle function of lower limb in postmenopausal women. The improvement of muscle strength after intervention were possibly correlated with rs540874, rs618838 and rs2229456 polymorphisms.


Assuntos
Polimorfismo Genético , Actinina , Idoso , Pequim , Feminino , Genótipo , Humanos , Pessoa de Meia-Idade , Força Muscular , Músculo Esquelético , Pós-Menopausa
11.
Zhonghua Yi Xue Za Zhi ; 98(26): 2073-2077, 2018 Jul 10.
Artigo em Zh | MEDLINE | ID: mdl-30032503

RESUMO

Objective: To evaluate the diagnostic value of medium dose dexamethasone androgen suppression tests (DAST) in female hyperandrogenism. Methods: DAST results were retrospectively analyzed in 85 cases of women with hyperandrogenism including 55 cases of congenital adrenal hyperplasia (CAH), 10 cases of testosterone-producing tumors and 20 cases of polycystic ovary syndrome (PCOS) between January 1984 and December 2017 in Peking Union Medical College Hospital. The suppression rate of testosterone and 17 hydroxyprogesterone (17OHP) were evaluated. The cut-off point of suppression rates were calculated by receiver operating characteristic (ROC) curve in the differential diagnosis of CAH and non-CAH causes. Results: The 1-day medium dose DAST was performed simultaneously in 41 cases of CAH patients and the 5-days medium dose DAST was performed simultaneously in 19 cases of CAH patients. The results indicated that the average suppression rate of testosterone were 77.9% and 91.3% (P<0.001) and the average suppression rate of 17OHP was 95.2% and 97.0%, respectively (P=0.220). In patients (41 cases of CAH, 10 cases of testosterone producing tumor and 20 cases of PCOS) with 1-day DAST, the optimal testosterone suppression rate was 61.2% (the sensitivity and specificity was 87.8% and 96.7%, respectively) and the optimal 17OHP suppression rate was 87.1% (the sensitivity and specificity was 95.1% and 93.3%, respectively) in the identification of CAH and non-CAH cases. There is no clinical significance between the testosterone and 17OHP suppression rate in the differential diagnosis of CAH and non-CAH cases. Conclusions: There was no difference in the suppression rate of 17OHP between the 1-day and 5-days DAST in CAH cases. The sensitivity of suppression rate of 17OHP is equal in the differential diagnosis of hyperandrogenism. One-day approach DAST could be used as functional test for the diagnosis of the etilology of hyperandrogenism (CAH or non-CAH).


Assuntos
Hiperandrogenismo , Hiperplasia Suprarrenal Congênita , Androgênios , Dexametasona , Feminino , Humanos , Síndrome do Ovário Policístico , Estudos Retrospectivos , Testosterona
12.
Zhonghua Wai Ke Za Zhi ; 56(11): 837-842, 2018 Nov 01.
Artigo em Zh | MEDLINE | ID: mdl-30392304

RESUMO

Objective: To explore the accuracy in localizing occult insulinomas with Glucagon-like peptide-1 receptor(GLP-1R) PET-CT with (68)Ga-exendin-4. Methods: In this prospective cohort study, patients with biochemically proven endogenous hyperinsulinemic hypoglycemia and negative contrast-enhanced CT with pancreatic perfusion scans were enrolled consecutively at Department of Nuclear Medicine, Peking Union Medical College Hospital from February 2014 to June 2018.There were 37 males and 32 females, with age of (43.2±17.9)years. (68)Ga-exendin-4 PET-CT, MRI and endoscopic ultrasound(EUS) were done before elective surgery. Sensitivity, specificity, accuracy, positive predictive value(PPV) and negative predictive value(NPV) of the above imaging modalities were calculated. Results: A total of 69 patients were recruited. Thirty-two patients were diagnosed with insulinomas at histology. Four patients with positive (68)Ga-exendin-4 PET-CT findings did not undergo surgery so far. Twenty-eight patients were proven to be noninsulinoma induced hyperinsulinemic hypoglycemia. Five patients were unknown of etiology of hypoglycemia. The sensitivity, specificity, accuracy, PPV and NPV of (68)Ga-exendin-4 in localizing occult insulinomas were 96.9%(31/32), 100%(30/30), 98.3%(59/60), 100%(29/29), 96.8%(30/31), respectively.The sensitivity, specificity, accuracy, PPV and NPV of MRI were 74.1%(20/27), 9/11, 76.3%(29/38), 90.9%(20/22), 9/16, respectively. The sensitivity, specificity, accuracy, PPV and NPV of EUS were 75.0% (15/20), 2/2, 77.3%(17/22), 15/15, and 2/7. Conclusion: (68)Ga-exendin-4 PET-CT has a high sensitivity, specificity and accuracy for detection of occult insulinoma, which shows superiority to MRI and EUS.


Assuntos
Insulinoma , Neoplasias Pancreáticas , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Adulto , Exenatida , Feminino , Radioisótopos de Gálio , Humanos , Insulinoma/diagnóstico por imagem , Masculino , Pessoa de Meia-Idade , Neoplasias Pancreáticas/diagnóstico por imagem , Peptídeos , Tomografia por Emissão de Pósitrons , Estudos Prospectivos , Sensibilidade e Especificidade , Tomografia Computadorizada por Raios X
13.
Zhonghua Nei Ke Za Zhi ; 56(1): 19-23, 2017 Jan 01.
Artigo em Zh | MEDLINE | ID: mdl-28056318

RESUMO

Objective: To study the clinical characteristics of primary hypoparathyroidism in adults. Methods: The clinical data of 200 cases with adult-onset primary hypoparathyroidism in Peking Union Medical College Hospital during December 1987 to December 2015 were collected and analyzed retrospectively. Among them, 128 cases were followed up for a median period of 3 years. Results: The major manifestations at their first visits were tetany and numbness in the distal extremities(81.5%, 163/200 and 62.0%, 124/200). Thirty-two percent of the cases (62 cases) had history of seizures, and 60.9%(98/161) and 74.4%(96/129) of them were with intracerebral calcifications and cataracts, respectively.Most of subjects(155/200)had more than one year delay in diagnosis. Hypercalciuria occurred in 67.2%(86/128) of the cases during the follow-up. No significant differences in the clinical characteristics and biochemical markers between the hypercalciuria subjects and the non-hypercalciuria subjects. Renal nephrocalcinosis or stones were found in 6.5%(5/77) of the cases, and kidney function decreased in 6.6%(6/91) of the patients. Kidney function was negatively associated with age and duration of disease. Conclusions: The predominant manifestations of primary hypoparathyroidism in adults included tetany and numbness in the distal extremities and seizures. It is often misdiagnosed. Calcium supplement combined with vitamin D or its metabolites effectively relieve clinical symptoms and signs. The serum and urinary calcium levels should be monitored frequently to reduce renal complications.


Assuntos
Calcitriol/uso terapêutico , Cálcio , Hipocalcemia/tratamento farmacológico , Hipoparatireoidismo/complicações , Hipoparatireoidismo/diagnóstico , Hormônio Paratireóideo/sangue , Vitamina D/uso terapêutico , Adulto , Calcitriol/efeitos adversos , Cálcio/sangue , Cálcio/urina , Feminino , Humanos , Hipocalcemia/sangue , Hipocalcemia/urina , Hipoparatireoidismo/sangue , Hipoparatireoidismo/terapia , Hipoparatireoidismo/urina , Rim/fisiopatologia , Masculino , Nefrocalcinose/epidemiologia , Estudos Retrospectivos , Convulsões/etiologia , Albumina Sérica/análise
14.
Zhonghua Nei Ke Za Zhi ; 56(10): 760-762, 2017 Oct 01.
Artigo em Zh | MEDLINE | ID: mdl-29036958

RESUMO

Bartter syndrome (BS) is a hereditary condition transmitted as an autosomal recessive (Bartter type 1 to 4) or dominant trait (Bartter type 5). The disease associates hypokalemic alkalosis with varying degrees of hypercalciuria. Here we presented a case (BS type Ⅱ) of a 17 years old female presented with polyhydramnios, polyuria, nephrocalcinosis and hypokalemia, which was alleviated after treatment with celecoxib and vitamin D(3). DNA sequencing identified compound heterozygous KCNJ1 gene mutations, c. 931C >T (p.R311W) and c. 445-446insCCTGAACAC (p.V149Afs, 150X), with the latter a novel mutation. Her father and mother were heterozygous carriers of c. 931C >T (p.R311W) and c. 445-446insCCTGAACAC (p.V149Afs, 150X), respectively. In conclusion, this case of BS type Ⅱ is caused by a novel compound heterozygous KCNJ1 mutation. Further studies are needed to verify the effect of celecoxib in BS patients.


Assuntos
Síndrome de Bartter/diagnóstico , Mutação/genética , Canais de Potássio Corretores do Fluxo de Internalização/genética , Análise de Sequência de DNA/métodos , Adolescente , Síndrome de Bartter/genética , Celecoxib , Feminino , Heterozigoto , Humanos , Hipercalciúria , Fenótipo
15.
Zhonghua Yi Xue Za Zhi ; 97(36): 2833-2838, 2017 Sep 26.
Artigo em Zh | MEDLINE | ID: mdl-29050147

RESUMO

Objective: To explore the association of vitamin D receptor (VDR) gene polymorphisms with idiopathic hypoparathyroidism (IHP). Methods: Two hundred and three patients with IHP and 209 healthy age- and sex-matched subjects were recruited at Peking Union Medical College Hospital between December 1987 and December 2015 as case group and control group, respectively. The VDR gene polymorphisms including rs739837, rs3847987 and rs2228570 were analyzed by Sequenom Mass Array. The frequency of different genotypes and alleles was detected, then their association with pathogenesis of IHP was analyzed. The clinical characteristics, biochemical indicators were collected to explore the genotype-phenotype relationship. The role of reactions to vitamin D treatment were compared between patients with different genotypes. Results: There was no significant difference in the genotypes and allele frequency distribution of SNPs between the two groups (all P>0.05). However, in the initially-treated patients, the genotypes of rs739837 were related to serum calcium level (r=0.186, P=0.026). And patients with GG genotype of rs2228750 had higher level of urine calcium than GA and AA (277.7 mg vs 141.1 mg, P=0.024) after treating with oral vitamin D(3) and calcium. Conclusions: Functional SNPs of VDR gene including rs739837, rs3847987 and rs2228570 might be irrelevant to the pathogenesis of IHP. But the genotypes of rs739837 were related to serum calcium level, and rs2228570 may have an effect on the different responses to vitamin D and its analogues in IHP patients.


Assuntos
Hipoparatireoidismo , Polimorfismo de Nucleotídeo Único , Receptores de Calcitriol/genética , Estudos de Casos e Controles , Frequência do Gene , Predisposição Genética para Doença , Genótipo , Humanos , Hipoparatireoidismo/genética , Fenótipo , Vitamina D
16.
Zhonghua Nei Ke Za Zhi ; 55(8): 604-8, 2016 Aug 01.
Artigo em Zh | MEDLINE | ID: mdl-27480553

RESUMO

OBJECTIVE: Several genes have been recognized to be associated with non-surgical hypoparathyroidism. Data about gene mutations in adult-onset hypoparathyroidism patients is lacking. This study was designed to screen gene mutation in adult-onset hypoparathyroidism in Chinese through the targeted next-generation sequencing (NGS). METHODS: We recruited 17 patients with adult-onset hypoparathyroidism who were regularly followed or newly diagnosed at our centre during the past one year. Nine of them developed hypercalciuria during the treatment with calcium and vitamin D. Eight of them were newly diagnosed with no treatment. Targeted NGS was performed to screen 11 related genes, including AIRE, AP2S1, CASR, CLDN16, FAM111A, GATA3, GCM2, PTH, TBCE, TBX1 and TRPM6. RESULTS: A novel homozygosis mutation of GCMB gene[c.130G>A (p.G44S)]was identified which was predicted to be deleterious by PolyPhen2. The patient was a 36-year-old woman who suffered from paroxysmal carpopedal spasms for ten years. Before treatment, the serum calcium and phosphorus was 1.48 mmol/L and 2.29 mmol/L, respectively.Parathyroid hormonel (PTH) concentration was lower than 3.0 ng/L. Intracranial calcification and cataract were also identified. She developed hypercalciuria during treatment with calcium and vitamin D. She had no physical deformity or family history of hypoparathyroidism. CONCLUSIONS: In this study, the genetic defect was only identified in 1 patient (5.9%). In adult-onset hypoparathyroidism without other diagnostic clues, the gene mutation screening as the first choice to clarify the etiology was not recommended.


Assuntos
Genômica/métodos , Hipercalciúria/induzido quimicamente , Hipoparatireoidismo/genética , Mutação , Análise de Sequência de DNA , Adulto , Idade de Início , Povo Asiático/genética , Cálcio/uso terapêutico , Análise Mutacional de DNA , Feminino , Fator de Transcrição GATA3 , Homozigoto , Humanos , Hipoparatireoidismo/tratamento farmacológico , Hipoparatireoidismo/etnologia , Masculino , Hormônio Paratireóideo/sangue , Espasmo/etiologia , Vitamina D/uso terapêutico
17.
Zhonghua Nei Ke Za Zhi ; 55(10): 769-773, 2016 Oct 01.
Artigo em Zh | MEDLINE | ID: mdl-27686437

RESUMO

Objective: To study the clinical characteristics of childhood- and adolescent- onset hypoparathyroidism. Methods: The clinical data of 128 hypoparathyroidism patients with onset before the age of 18 years were collected and analyzed retrospectively. Results: The predominant features of the hypoparathyroidism were carpopedal spasm (89.3%, 108/121) and seizures (66.1%, 84/127). Intracranial calcification was identified in 89.4%(101/113) of the patients. Duration is an independent predictive factor (OR=1.483, P=0.011) for intracranial calcification. All the patients were treated with calcium and vitamin D or its metabolites. Hypercalciuria was associated with serum calcium (P=0.016). Conclusions: Carpopedal spasm and seizures were the main manifestations of childhood- and adolescent- onset hypoparathyroidism. Calcium and vitamin D or its metabolites are effective. Monitoring the concentration of serum and urinary calcium is of highly importance for the prevention of hypercalciuria.


Assuntos
Cálcio/administração & dosagem , Hipocalcemia/complicações , Hipoparatireoidismo/tratamento farmacológico , Convulsões/etiologia , Vitamina D/administração & dosagem , Adolescente , Idade de Início , Cálcio/sangue , Cálcio/urina , Criança , Pré-Escolar , Feminino , Hospitais , Humanos , Hipoparatireoidismo/complicações , Hipoparatireoidismo/metabolismo , Masculino , Estudos Retrospectivos , Convulsões/diagnóstico , Espasmo/etiologia , Resultado do Tratamento
18.
Zhonghua Nei Ke Za Zhi ; 55(11): 859-862, 2016 Nov 01.
Artigo em Zh | MEDLINE | ID: mdl-27801341

RESUMO

Objective: To explore tissue expression of cyclin-dependent kinase inhibitor p27Kip1 and ß-catenin in multiple endocrine neoplasia type1 (MEN1)-related parathyroid tumors (MHPT). Methods: Immunohistochemistry was performed to analyze the expression of p27Kip1 and ß-catenin in parathyroid glands from 31 subjects with MHPT collected at Peking Union Medical College Hospital from 2002 to 2013. Five normal parathyroid glands were used as control. Results: In MHPT subjects, nuclear expression of p27Kip1 was absent in 4 (12.9%), weak in 10 (32.3%) and moderated staining in 17 parathyroid specimens (54.8%), respectively. While, in normal subjects, the nuclear expression of p27Kip1 was observed in all subjects and was stronger than that from MHPT subjects (P=0.001). As to the expression of ß-catenin, normal parathyroid showed a distinct to moderate membrane staining, a moderate to weak cytoplasmic staining and negative nuclear staining. Similarly, MHPT exhibited a marked to moderate membrane (P=0.087), a moderated to weak cytoplasmic (P=0.357), and negative nuclear ß-catenin staining. Conclusions: The expression of p27Kip1 is reduced or absent in MHPT tissue, and no nuclear expression of ß-catenin is observed in the tumors, which suggesting p27Kip1, but not ß-catenin nuclear accumulation, play a role in the development of the tumors.


Assuntos
Inibidor de Quinase Dependente de Ciclina p27/genética , Neoplasia Endócrina Múltipla Tipo 1/genética , Neoplasias das Paratireoides/genética , beta Catenina/genética , Regulação Neoplásica da Expressão Gênica , Humanos , Imuno-Histoquímica , Neoplasias das Paratireoides/patologia
19.
20.
Plant Dis ; 96(7): 1065, 2012 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-30727237

RESUMO

Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 µm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA