Osteocalcin of maternal and embryonic origins synergize to establish homeostasis in offspring.

Many physiological osteocalcin-regulated functions are affected in adult offspring of mothers experiencing unhealthy pregnancy. Furthermore, osteocalcin signaling during gestation influences cognition and adrenal steroidogenesis in adult mice. Together these observations suggest that osteocalcin may broadly function during pregnancy to determine organismal homeostasis in adult mammals. To test this hypothesis, we analyzed in unchallenged wildtype and Osteocalcin-deficient, newborn and adult mice of various genotypes and origin maintained on different genetic backgrounds, the functions of osteocalcin in the pancreas, liver and testes and their molecular underpinnings. This analysis revealed that providing mothers are Osteocalcin-deficient, Osteocalcin haploinsufficiency in embryos hampers insulin secretion, liver gluconeogenesis, glucose homeostasis, testes steroidogenesis in adult offspring; inhibits cell proliferation in developing pancreatic islets and testes; and disrupts distinct programs of gene expression in these organs and in the brain. This study indicates that osteocalcin exerts dominant functions in most organs it influences. Furthermore, through their synergistic regulation of multiple physiological functions, osteocalcin of maternal and embryonic origins contributes to the establishment and maintenance of organismal homeostasis in newborn and adult offspring.

Developmental origin, functional maintenance and genetic rescue of osteoclasts.

Osteoclasts are multinucleated giant cells that resorb bone, ensuring development and continuous remodelling of the skeleton and the bone marrow haematopoietic niche. Defective osteoclast activity leads to osteopetrosis and bone marrow failure1-9, whereas excess activity can contribute to bone loss and osteoporosis10. Osteopetrosis can be partially treated by bone marrow transplantation in humans and mice11-18, consistent with a haematopoietic origin of osteoclasts13,16,19 and studies that suggest that they develop by fusion of monocytic precursors derived from haematopoietic stem cells in the presence of CSF1 and RANK ligand1,20. However, the developmental origin and lifespan of osteoclasts, and the mechanisms that ensure maintenance of osteoclast function throughout life in vivo remain largely unexplored. Here we report that osteoclasts that colonize fetal ossification centres originate from embryonic erythro-myeloid progenitors21,22. These erythro-myeloid progenitor-derived osteoclasts are required for normal bone development and tooth eruption. Yet, timely transfusion of haematopoietic-stem-cell-derived monocytic cells in newborn mice is sufficient to rescue bone development in early-onset autosomal recessive osteopetrosis. We also found that the postnatal maintenance of osteoclasts, bone mass and the bone marrow cavity involve iterative fusion of circulating blood monocytic cells with long-lived osteoclast syncytia. As a consequence, parabiosis or transfusion of monocytic cells results in long-term gene transfer in osteoclasts in the absence of haematopoietic-stem-cell chimerism, and can rescue an adult-onset osteopetrotic phenotype caused by cathepsin K deficiency23,24. In sum, our results identify the developmental origin of osteoclasts and a mechanism that controls their maintenance in bones after birth. These data suggest strategies to rescue osteoclast deficiency in osteopetrosis and to modulate osteoclast activity in vivo.

Clinical Validation of Digitally Acquired Clinical Data and Machine Learning Models for Remote Measurement of Psoriasis and Psoriatic Arthritis: A Proof-of-Concept Study.

OBJECTIVE: Psoriatic disease remains underdiagnosed and undertreated. We developed and validated a suite of novel, sensor-based smartphone assessments (Psorcast app) that can be self-administered to measure cutaneous and musculoskeletal signs and symptoms of psoriatic disease. METHODS: Participants with psoriasis (PsO) or psoriatic arthritis (PsA) and healthy controls were recruited between June 5, 2019, and November 10, 2021, at 2 academic medical centers. Concordance and accuracy of digital measures and image-based machine learning models were compared to their analogous clinical measures from trained rheumatologists and dermatologists. RESULTS: Of 104 study participants, 51 (49%) were female and 53 (51%) were male, with a mean age of 42.3 years (SD 12.6). Seventy-nine (76%) participants had PsA, 16 (15.4%) had PsO, and 9 (8.7%) were healthy controls. Digital patient assessment of percent body surface area (BSA) affected with PsO demonstrated very strong concordance (Lin concordance correlation coefficient [CCC] 0.94 [95% CI 0.91-0.96]) with physician-assessed BSA. The in-clinic and remote target plaque physician global assessments showed fair-to-moderate concordance (CCCerythema 0.72 [0.59-0.85]; CCCinduration 0.72 [0.62-0.82]; CCCscaling 0.60 [0.48-0.72]). Machine learning models of hand photos taken by patients accurately identified clinically diagnosed nail PsO with an accuracy of 0.76. The Digital Jar Open assessment categorized physician-assessed upper extremity involvement, considering joint tenderness or enthesitis (AUROC 0.68 [0.47-0.85]). CONCLUSION: The Psorcast digital assessments achieved significant clinical validity, although they require further validation in larger cohorts before use in evidence-based medicine or clinical trial settings. The smartphone software and analysis pipelines from the Psorcast suite are open source and freely available.

A serotonin-dependent mechanism explains the leptin regulation of bone mass, appetite, and energy expenditure.

Leptin inhibition of bone mass accrual requires the integrity of specific hypothalamic neurons but not expression of its receptor on these neurons. The same is true for its regulation of appetite and energy expenditure. This suggests that leptin acts elsewhere in the brain to achieve these three functions. We show here that brainstem-derived serotonin (BDS) favors bone mass accrual following its binding to Htr2c receptors on ventromedial hypothalamic neurons and appetite via Htr1a and 2b receptors on arcuate neurons. Leptin inhibits these functions and increases energy expenditure because it reduces serotonin synthesis and firing of serotonergic neurons. Accordingly, while abrogating BDS synthesis corrects the bone, appetite and energy expenditure phenotypes caused by leptin deficiency, inactivation of the leptin receptor in serotonergic neurons recapitulates them fully. This study modifies the map of leptin signaling in the brain and identifies a molecular basis for the common regulation of bone and energy metabolisms. For a video summary of this article, see the PaperFlick file with the Supplemental Data available online.

A novel estimator for the two-way partial AUC.

BACKGROUND: The two-way partial AUC has been recently proposed as a way to directly quantify partial area under the ROC curve with simultaneous restrictions on the sensitivity and specificity ranges of diagnostic tests or classifiers. The metric, as originally implemented in the tpAUC R package, is estimated using a nonparametric estimator based on a trimmed Mann-Whitney U-statistic, which becomes computationally expensive in large sample sizes. (Its computational complexity is of order [Formula: see text], where [Formula: see text] and [Formula: see text] represent the number of positive and negative cases, respectively). This is problematic since the statistical methodology for comparing estimates generated from alternative diagnostic tests/classifiers relies on bootstrapping resampling and requires repeated computations of the estimator on a large number of bootstrap samples. METHODS: By leveraging the graphical and probabilistic representations of the AUC, partial AUCs, and two-way partial AUC, we derive a novel estimator for the two-way partial AUC, which can be directly computed from the output of any software able to compute AUC and partial AUCs. We implemented our estimator using the computationally efficient pROC R package, which leverages a nonparametric approach using the trapezoidal rule for the computation of AUC and partial AUC scores. (Its computational complexity is of order [Formula: see text], where [Formula: see text].). We compare the empirical bias and computation time of the proposed estimator against the original estimator provided in the tpAUC package in a series of simulation studies and on two real datasets. RESULTS: Our estimator tended to be less biased than the original estimator based on the trimmed Mann-Whitney U-statistic across all experiments (and showed considerably less bias in the experiments based on small sample sizes). But, most importantly, because the computational complexity of the proposed estimator is of order [Formula: see text], rather than [Formula: see text], it is much faster to compute when sample sizes are large. CONCLUSIONS: The proposed estimator provides an improvement for the computation of two-way partial AUC, and allows the comparison of diagnostic tests/machine learning classifiers in large datasets where repeated computations of the original estimator on bootstrap samples become too expensive to compute.

Lrp5 controls bone formation by inhibiting serotonin synthesis in the duodenum.

Loss- and gain-of-function mutations in the broadly expressed gene Lrp5 affect bone formation, causing osteoporosis and high bone mass, respectively. Although Lrp5 is viewed as a Wnt coreceptor, osteoblast-specific disruption of beta-Catenin does not affect bone formation. Instead, we show here that Lrp5 inhibits expression of Tph1, the rate-limiting biosynthetic enzyme for serotonin in enterochromaffin cells of the duodenum. Accordingly, decreasing serotonin blood levels normalizes bone formation and bone mass in Lrp5-deficient mice, and gut- but not osteoblast-specific Lrp5 inactivation decreases bone formation in a beta-Catenin-independent manner. Moreover, gut-specific activation of Lrp5, or inactivation of Tph1, increases bone mass and prevents ovariectomy-induced bone loss. Serotonin acts on osteoblasts through the Htr1b receptor and CREB to inhibit their proliferation. By identifying duodenum-derived serotonin as a hormone inhibiting bone formation in an Lrp5-dependent manner, this study broadens our understanding of bone remodeling and suggests potential therapies to increase bone mass.

Magnetically recoverable Fe3O4 nanocatalyst for the synthesis of biodynamically significant 1H-pyrazolo[1,2-b]phthalazine-5,10-diones derivatives and its DFT study.

An environmentally sustainable and proficient method is reported for the synthesis of medicinally important pyrazolo[1,2-b] phthalazine dione derivatives by aqueous micellar medium catalysed by Fe3O4 NPs. Dialkyl acetylenedicarboxylate with isocyanides in the presence of phthalhydrazide is used as starting material. The main advantages of this protocol are the availability of starting materials, short reaction times, green solvents and practical simplicity.

Machine learning based prediction of phase ordering dynamics.

Machine learning has proven exceptionally competent in numerous applications of studying dynamical systems. In this article, we demonstrate the effectiveness of reservoir computing, a famous machine learning architecture, in learning a high-dimensional spatiotemporal pattern. We employ an echo-state network to predict the phase ordering dynamics of 2D binary systems-Ising magnet and binary alloys. Importantly, we emphasize that a single reservoir can be competent enough to process the information from a large number of state variables involved in the specific task at minimal computational training cost. Two significant equations of phase ordering kinetics, the time-dependent Ginzburg-Landau and Cahn-Hilliard-Cook equations, are used to depict the result of numerical simulations. Consideration of systems with both conserved and non-conserved order parameters portrays the scalability of our employed scheme.

Deep learning-based classification of posttraumatic stress disorder and depression following trauma utilizing visual and auditory markers of arousal and mood.

BACKGROUND: Visual and auditory signs of patient functioning have long been used for clinical diagnosis, treatment selection, and prognosis. Direct measurement and quantification of these signals can aim to improve the consistency, sensitivity, and scalability of clinical assessment. Currently, we investigate if machine learning-based computer vision (CV), semantic, and acoustic analysis can capture clinical features from free speech responses to a brief interview 1 month post-trauma that accurately classify major depressive disorder (MDD) and posttraumatic stress disorder (PTSD). METHODS: N = 81 patients admitted to an emergency department (ED) of a Level-1 Trauma Unit following a life-threatening traumatic event participated in an open-ended qualitative interview with a para-professional about their experience 1 month following admission. A deep neural network was utilized to extract facial features of emotion and their intensity, movement parameters, speech prosody, and natural language content. These features were utilized as inputs to classify PTSD and MDD cross-sectionally. RESULTS: Both video- and audio-based markers contributed to good discriminatory classification accuracy. The algorithm discriminates PTSD status at 1 month after ED admission with an AUC of 0.90 (weighted average precision = 0.83, recall = 0.84, and f1-score = 0.83) as well as depression status at 1 month after ED admission with an AUC of 0.86 (weighted average precision = 0.83, recall = 0.82, and f1-score = 0.82). CONCLUSIONS: Direct clinical observation during post-trauma free speech using deep learning identifies digital markers that can be utilized to classify MDD and PTSD status.

Efficient one-pot synthesis of substituted diphenyl 1, 3-thiazole through multicomponent reaction by using green and efficient Iron-catalyst via Cross-Dehydrogenative Coupling(CDC).

A clean and efficient, multi-component strategy for the synthesis of biologically important trisubstituted thiazole via the reaction of readily available barbituric acid, acetophenone, and aryl thioamides is reported in the presence of FeCl3.6H2O / O2(Air) in DMF solvent. The advantages of the present methodology include a one-pot reaction, environment-friendly approach, cost-effectiveness, broad substrate scope, operational simplicity, short reaction time, easy workup procedure, and high yields.

Maternal vitamin B12 in mice positively regulates bone, but not muscle mass and strength in post-weaning and mature offspring.

Vitamin B12 deficiency has been shown to affect bone mass in rodents and negatively impact bone formation in humans. In this study using mouse models, we define the effect of B12 supplementation in the wild-type mother and B12 deficiency in a mouse genetic model (Gif-/- mice) during gestation on bone and muscle architecture and mechanical properties in the offspring. Analysis of bones from 4-wk-old offspring of the wild-type mother following vehicle or B12 supplementation during gestation (from embryonic day 0.5 to 20.5) showed an increase in bone mass caused by an isolated increase in bone formation in the B12-supplemented group compared with vehicle controls. Analysis of the effect of B12 deficiency in the mother in a mouse genetic model (Gif-/- mice) on the long bone architecture of the offspring showed a compromised cortical and trabecular bone mass, which was completely prevented by a single injection of B12 in the B12-deficient Gif-/- mothers. Biomechanical analysis of long bones of the offspring born from B12-supplemented wild-type mothers showed an increase in bone strength, and conversely, offspring born from B12-deficient Gif-/- mothers revealed a compromised bone strength, which could be rescued by a single injection of B12 in the B12-deficient Gif-/- mother. Muscle structure and function analysis however revealed no significant effect on muscle mass, structure, and grip strength of B12 deficiency or supplementation in Gif-/- mice compared with littermate controls. Together, these results demonstrate the beneficial effect of maternally derived B12 in the regulation of bone structure and function in the offspring.

Metal-free visible-light-mediated organophotoredox catalysis: synthesis of 3-functionalized indole via C-C, C-N bond formation.

A visible-light-mediated, mild and one-pot three-component reaction in the presence of organophotoredox catalyst Eosin Y using EtOH:H2O as reaction medium for the synthesis of 3-functionalized indole derivatives was developed. Visible light used in the protocol is green, inexpensive, readily available energy source. The sustainable reagents make the protocol compatible with green chemistry demands.

Validation of Visual and Auditory Digital Markers of Suicidality in Acutely Suicidal Psychiatric Inpatients: Proof-of-Concept Study.

BACKGROUND: Multiple symptoms of suicide risk have been assessed based on visual and auditory information, including flattened affect, reduced movement, and slowed speech. Objective quantification of such symptomatology from novel data sources can increase the sensitivity, scalability, and timeliness of suicide risk assessment. OBJECTIVE: We aimed to examine measurements extracted from video interviews using open-source deep learning algorithms to quantify facial, vocal, and movement behaviors in relation to suicide risk severity in recently admitted patients following a suicide attempt. METHODS: We utilized video to quantify facial, vocal, and movement markers associated with mood, emotion, and motor functioning from a structured clinical conversation in 20 patients admitted to a psychiatric hospital following a suicide risk attempt. Measures were calculated using open-source deep learning algorithms for processing facial expressivity, head movement, and vocal characteristics. Derived digital measures of flattened affect, reduced movement, and slowed speech were compared to suicide risk with the Beck Scale for Suicide Ideation controlling for age and sex, using multiple linear regression. RESULTS: Suicide severity was associated with multiple visual and auditory markers, including speech prevalence (ß=-0.68, P=.02, r2=0.40), overall expressivity (ß=-0.46, P=.10, r2=0.27), and head movement measured as head pitch variability (ß=-1.24, P=.006, r2=0.48) and head yaw variability (ß=-0.54, P=.06, r2=0.32). CONCLUSIONS: Digital measurements of facial affect, movement, and speech prevalence demonstrated strong effect sizes and linear associations with the severity of suicidal ideation.

Assessment of persistent organic pollutants in soil and sediments from an urbanized flood plain area.

Polycyclic aromatic hydrocarbons (PAHs), organochlorine pesticides (OCPs) and phenolic compounds (PCs) are persistent organic compounds. Contamination of these potentially toxic organic pollutants in soils and sediments is most studied environmental compartments. In recent past, studies were carried out on PAHs, OCPs and PCs in various soils and sediments in India. But, this is the first study on these pollutants in soils and sediments from an urbanized river flood plain area in Delhi, India. During 2018, a total of fifty-four samples including twenty-seven each of soil and sediment were collected and analyzed for thirteen priority PAHs, four OCPs and six PCs. The detected concentration of ∑PAHs, ∑OCPs and ∑PCs in soils ranged between 473 and 1132, 13 and 41, and 639 and 2112 µg/kg, respectively, while their concentrations in sediments ranged between 1685 and 4010, 4.2 and 47, and 553 and 20,983 µg/kg, respectively. PAHs with 4-aromatic rings were the dominant compounds, accounting for 51 and 76% of total PAHs in soils and sediments, respectively. The contribution of seven carcinogen PAHs (7CPAHs) in soils and sediments accounted for 43% and 61%, respectively, to ∑PAHs. Among OCPs, p, p'-DDT was the dominant compound in soils, while α-HCH was found to be dominated in sediments. The concentrations of ∑CPs (chlorophenols) were dominated over ∑NPs (nitrophenols) in both the matrices. Various diagnostic tools were applied for the identification of their possible sources in soil and sediments. The observed concentrations of PAHs, OCPs and PCs were more or less comparable with the recently reports from various locations around the world including India. Soil quality guidelines and consensus-based sediment quality guidelines were applied for the assessment of ecotoxicological health effect.

First report of Sclerotium rolfsii causing collar rot on Berseem (Trifolium alexandrinum) in India.

Berseem (Trifolium alexandrinum) is a winter season legume fodder crop widely cultivated in the central and northern parts of India. It is considered the 'King of fodder' for its high quality green fodder, which is a rich source of protein and low in fibre. Symptoms similar to collar rot were observed in experimental sites at the ICAR-Indian Grassland and Fodder Research institute (IGFRI), Jhansi (N25º 52' 749.20″, E78º 55' 452.70″), Uttar Pradesh, India in March 2019. The incidence of disease was ranged from 18 to 22% during 2019. Symptoms included dark colored water-soaked lesions at the base of stems, stem thinning (resembles wire stem) and eventually wilting of the whole plant. A white mycelial mat was observed on the stem and collar region and light brown to tan colored sclerotial bodies formed as disease progressed. To determine the etiology of the infection, 30 diseased plants with typical symptoms were collected from the 3 different fields and used for the isolation of causal agent. Infected stem portion were cut in to small pieces (5mm), surface sterilized with 2% sodium hypochlorite (NaOCl) for 2 minutes, washed three times with sterile distilled water and air dried. The sterilized infected tissues were cultured on potato dextrose agar amended with streptomycin sulphate @ 50µg/ml and incubated at 28±1º C for 3 days. After four days, hyaline septate mycelia ranging 2-3µm in diameter grow radially over the whole plate (90 mm). Sclerotia formation started 6 days after incubation. Sclerotia were initially white and later turned brownish to tan as they matured. The number of sclerotia per plate ranged from 55 to 120 (n=5) at 12 days after inoculation. The diameter of matured sclerotial bodies ranged from 0.1mm to 1.35mm (n=25). Genomic DNA was extracted from mycelium using the CTAB method (Murray and Thompson, 1980). Three regions of rDNA viz., internal transcribed spacer (ITS), large subunit (LSU), and small subunit (SSU) were used to identify the etiology of the disease. The isolate was amplified with ITS1 (5'CGGATCTCTTGGTTCTGGGA3')/ ITS4 (5'GACGCTCGAACATGCC3') described by White et al. (1990) and sequenced. The ITS sequence (NCBI GenBank Accession No: MT026581) showed 98.21 % similar to Athelia rolfsii (MH514001.1). The isolate also amplified with primers LSU (LROR: ACCCGCTGAACTTAAGC/ LR5: TCCTGAGGGAAACTTCG) and SSU (NS1: GTAGTCATATGCTTGTCTC/ NS4: CTTCCGTCAATTCCTTTAAG). The LSU (MT225781) and SSU (MT225782) sequences showed 99.90 % and 100 % similarity to Athelia rolfsii (AY635773.1) and Athelia rolfsii (AY635773.1) respectively. Based on the morphological and molecular characteristics, the pathogen responsible for collar rot in berseem was identified as Athelia rolfsii (Anamorph: Sclerotium rolfsii) (Mordue, 1974). To confirm pathogenicity, inoculum was prepared by inoculating mycelial plugs of pathogen into autoclaved corn sand meal (5:95) and incubated at 28±1º C for 12 days. The inoculum (30g) was placed at stem portion of 15 day old seedlings (n=30) of berseem (Cv. Wardan) raised in pots filled with sterilized soil. Seedlings (n=25) inoculated with sterilized corn sand meal (30g) served as the control. The pots were placed inside of a plant growth chamber (26±2º C, 65% RH) for 15 days. Water soaked spots with white mycelium were observed on the collar region after 3 days. After 7 days, stems were completely covered by mycelia and death of seedlings was observed 14 days after inoculation. The pathogen was recovered from the artificially inoculated berseem seedlings (n=15). No symptoms were observed in control plants. Based on morphological and molecular characterization, the present isolate was confirmed as Sclerotium rolfsii. To the best of our knowledge, this is the first report of S. rolfsii causing collar rot of berseem in India.

Genetic data for PowerPlex 21™ autosomal and PowerPlex 23 Y-STR™ loci from population of the state of Uttar Pradesh, India.

In the present study, the statistical forensic parameters were evaluated for the loci present in PowerPlex 21 autosomal and PowerPlex 23 Y-STR multiplex systems in 168 unrelated individuals living in the state of Uttar Pradesh, India. The combined discrimination power (CPD) and combined exclusion power (CPE) was 1 and 0.999999 respectively for all 20 autosomal STR loci. Penta E showed the greatest (0.980) and CSF1PO showed the lowest (0.855) power of discrimination in the studied population. The haplotype diversity for 23 Y-STR loci was observed to be 0.999. The study also presents the first global report on polymorphism on D1S1656, D6S1043 and D12S391 autosomal STR loci in the Indian population. The resulting data revealed that these STR multiplex systems are highly polymorphic and can be used for forensic purposes.

Clay based nanocomposites for removal of heavy metals from water: A review.

The exponential increment in world population, recent industrialization, civilization, agricultural and household activities leads to greater levels of water pollution in terms of organic and inorganic contaminants. However, numerous workers have done research for the removal of these pollutants and various types of clays and/or modified clays have been extensively used for this purpose. But all identified adsorbent materials are not able to remove pollutants after certain concentration and sometimes these contaminants are left as such in environment which may create other environmental issues. This paper presents comprehensive information for the adsorption of heavy metal ions from water and waste water using various nanostructured adsorbents such as different clay minerals (kaolinite, montmorillonite) and clay (bentonite), carbon nanotube and nanocomposites. In addition to this, the efficiency of developed materials for the removal of heavy metals is also discussed in details along with comparison of their adsorption efficiencies, pH and change in specific surface area, initial metal ion concentration and contact time. This paper also states the future directions which could be followed to challenge the situation of removal of traces of heavy metals from water, hence protecting water bodies from high pollution load.

Polyaniline/MWCNTs/starch modified carbon paste electrode for non-enzymatic detection of cholesterol: application to real sample (cow milk).

Nanocomposite materials are potentially revolutionizing many technologies, including sensors. In this paper, we described the application of "PANI/MWCNTs/Starch" modified carbon paste electrode (PCS-CPE) as a simple and highly sensitive cholesterol sensor. This novel nano-composite material has integrated nano-morphology, where polyaniline could interact effectively with the additives; pi-pi stacking "MWCNTs," and covalently bonded with starch. Specific binding sites (sugar chains), better electro-catalytic properties and fast electron transfer facilitated the oxidation of cholesterol. Fourier transform infrared spectra confirmed the interaction of cholesterol with the composite material. The sensing response of PCS was measured by cyclic voltammetry and chronoamperometry (0.1 M PBS-5 used as supporting electrolyte). As the amount of cholesterol increased in the test solution, cyclic voltammograms showed a rise of peak current (cathodic and anodic). Under the normal experimental conditions, the developed sensor exhibited wide linear dynamic range (0.032 to 5 mM) (upper limit is due to lack of solubility of cholesterol), high sensitivity (800 µAmM-1 cm-2), low detection limit (0.01 mM) and shorter response time (within 4-6 s). Analytical specificity, selectivity, and sensitivity during cholesterol estimation were compared with the response of some other analytes (ascorbic acid, glucose, l-dopa, urea and lactic acid). This novel sensor was successfully applied to estimate cholesterol in cow milk (used as a model real sample). The sensing platform is highly sensitive and shows a linear response towards cholesterol without using any additional redox mediator or enzyme, thus this material is extremely promising for the realization of a low-cost integrated cholesterol sensor device. Graphical abstract Cyclic voltammetric response of cholesterol of composite modified carbon paste capillary electrode.

CREB mediates brain serotonin regulation of bone mass through its expression in ventromedial hypothalamic neurons.

Serotonin is a bioamine regulating bone mass accrual differently depending on its site of synthesis. It decreases accrual when synthesized in the gut, and increases it when synthesized in the brain. The signal transduction events elicited by gut-derived serotonin once it binds to the Htr1b receptor present on osteoblasts have been identified and culminate in cAMP response element-binding protein (CREB) regulation of osteoblast proliferation. In contrast, we do not know how brain-derived serotonin favors bone mass accrual following its binding to the Htr2c receptor on neurons of the hypothalamic ventromedial nucleus (VMH). We show here--through gene expression analysis, serotonin treatment of wild-type and Htr2c(-/-) hypothalamic explants, and cell-specific gene deletion in the mouse--that, following its binding to the Htr2c receptor on VMH neurons, serotonin uses a calmodulin kinase (CaMK)-dependent signaling cascade involving CaMKKß and CaMKIV to decrease the sympathetic tone and increase bone mass accrual. We further show that the transcriptional mediator of these events is CREB, whose phosphorylation on Ser 133 is increased by CaMKIV following serotonin treatment of hypothalamic explants. A microarray experiment identified two genes necessary for optimum sympathetic activity whose expression is regulated by CREB. These results provide a molecular understanding of how serotonin signals in hypothalamic neurons to regulate bone mass accrual and identify CREB as a critical determinant of this function, although through different mechanisms depending on the cell type, neuron, or osteoblast in which it is expressed.

Regulation of bone mass through pineal-derived melatonin-MT2 receptor pathway.

Tryptophan, an essential amino acid through a series of enzymatic reactions gives rise to various metabolites, viz. serotonin and melatonin, that regulate distinct biological functions. We show here that tryptophan metabolism in the pineal gland favors bone mass accrual through production of melatonin, a pineal-derived neurohormone. Pineal gland-specific deletion of Tph1, the enzyme that catalyzes the first step in the melatonin biosynthesis lead to a decrease in melatonin levels and a low bone mass due to an isolated decrease in bone formation while bone resorption parameters remained unaffected. Skeletal analysis of the mice deficient in MT1 or MT2 melatonin receptors showed a low bone mass in MT2-/- mice while MT1-/- mice had a normal bone mass compared to the WT mice. This low bone mass in the MT2-/- mice was due to an isolated decrease in osteoblast numbers and bone formation. In vitro assays of the osteoblast cultures derived from the MT1-/- and MT2-/- mice showed a cell intrinsic defect in the proliferation, differentiation and mineralization abilities of MT2-/- osteoblasts compared to WT counterparts, and the mutant cells did not respond to melatonin addition. Finally, we demonstrate that daily oral administration of melatonin can increase bone accrual during growth and can cure ovariectomy-induced structural and functional degeneration of bone by specifically increasing bone formation. By identifying pineal-derived melatonin as a regulator of bone mass through MT2 receptors, this study expands the role played by tryptophan derivatives in the regulation of bone mass and underscores its therapeutic relevance in postmenopausal osteoporosis.