Benzo[g]quinoxaline-Based Complexes [Ir(pbt)2(dppn)]Cl and [Ir(pt)2(dppn)]Cl: Modulation of Photo-Oxidation Activity and Light-Controlled Luminescence.

Based on benzo[i]dipyrido[3,2-a:2',3'-c]phenazine (dppn) with photo-oxidation activity, complexes [Ir(pbt)2(dppn)]Cl (1) and [Ir(pt)2(dppn)]Cl (2) have been synthesized (pbtH = 2-phenylbenzothiazole, and ptH = 2-phenylthiazole), with two aims, including studying the influence of the cyclometalating ligands (pbt- in 1, pt- in 2) on the photo-oxidation activity of these complexes and exploring their photo-oxidation-induced luminescence. Both 1H nuclear magnetic resonance (NMR) and electrospray (ES) mass spectrometry indicate that the benzo[g]quinoxaline moiety in complex 1 can be oxidized at room temperature upon irradiation with 415 nm light. Thus, this complex in CH2Cl2 shows photo-oxidation-induced turn-on yellow luminescence. In contrast, complex 2 reveals significant structural decomposition during the process of photo-oxidation due to incorporating a cyclometalating ligand pt- instead of pbt- in complex 1. In this paper, we report the photo-oxidation behaviors and the related luminescence modulation in 1 and 2 and discuss the relationship between structure and photo-oxidation activity in these complexes.

Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect.

The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6- = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH- ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level.

Two Anthracene-Based Ir(III) Complexes [Ir(pbt)2(aip)]Cl and [Ir(pbt)2(aipm)]Cl: Relationship between Substituent Group and Photo-oxidation Activity as Well as Photo-oxidation-Induced Luminescence.

Two anthracene-based complexes [Ir(pbt)2(aip)]Cl (1) and [Ir(pbt)2(aipm)]Cl (2) have been synthesized based on the ligands aip = 2-(9-anthryl)-1H-imidazo[4,5-f][1,10]phenanthroline, aipm = 2-(9-anthryl)-1-methyl-imidazo[4,5-f][1,10]phenanthroline, and pbtH = 2-phenylbenzothiazole in order to explore both the influence of the substituent group R1 (R1 = H in 1 and CH3 in 2) on photo-oxidation activity and photo-oxidation-induced luminescence. Both 1H NMR spectra and ES mass spectra indicate that the anthracene moiety in complex 1 can be oxidized at room temperature upon irradiation with 365 nm light. Thus, this complex shows photo-oxidation-induced turn-on yellow luminescence. Compared to 1, complex 2 incorporates an R1 = CH3 group, resulting in very weak photo-oxidation activity. On the basis of experimental results and quantum chemical calculation, we report the differences between 1 and 2 in both photo-oxidation behavior and the related luminescence modulation and discuss the relationship between photo-oxidation activity and substituent group R1 in these complexes.