RESUMO
Digestive tract tumors are heterogeneous and involve the dysregulation of multiple signaling pathways. The Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway plays a notable role in the oncogenesis of digestive tract tumors. Typically activated by pro-inflammatory cytokines, it regulates important biological processes, such as cell growth, differentiation, apoptosis, immune responses, and inflammation. The aberrant activation of this pathway manifests in different forms, including mutations in JAKs, overexpression of cytokine receptors, and sustained STAT activation, and contributes to promoting the malignant characteristics of cancer cells, including uncontrolled proliferation, resistance to apoptosis, enhanced invasion and metastasis, angiogenesis, acquisition of stem-like properties, and drug resistance. Numerous studies have shown that aberrant activation of the JAK-STAT pathway is closely related to the development and progression of digestive tract tumors, contributing to tumor survival, angiogenesis, changes in the tumor microenvironment, and even immune escape processes. In addition, this signaling pathway also affects the sensitivity of digestive tract tumors to chemotherapy and targeted therapy. Therefore, it is crucial to comprehensively understand the oncogenic mechanisms underlying the JAK-STAT pathway in order to develop effective therapeutic strategies against digestive tract tumors. Currently, several JAK-STAT inhibitors are undergoing clinical and preclinical trials as potential treatments for various human diseases. However, further investigation is required to determine the role of this pathway, as well as the effectiveness and safety of its inhibitors, especially in the context of digestive tract tumors. In this review, we provide an overview of the structure, classic activation, and negative regulation of the JAK-STAT pathway. Furthermore, we discuss the pathogenic mechanisms of JAK-STAT signaling in different digestive tract tumors, with the aim of identifying potential novel therapeutic targets. Video Abstract.
Assuntos
Neoplasias Gastrointestinais , Janus Quinases , Humanos , Janus Quinases/metabolismo , Transdução de Sinais , Fatores de Transcrição STAT/metabolismo , Microambiente TumoralRESUMO
The widespread occurrence of fowl adenovirus serotype 4 (FAdV-4)-induced hepatitis-hydropericardium syndrome (HHS) has led to significant economic losses for the poultry industry. A sensitive, accurate, and practical FAdV-4 diagnostic approach is urgently required to limit the incidence of the disease. In the present study, a practical method for detecting FAdV-4 was developed using the CRISPR/Cas13a system and recombinase-aided amplification. The approach was based on 37°C isothermal detection with visible results being achieved. The detection limit of the target gene with this approach was only 101â copies/µl, making it very sensitive and specific. Clinical samples fared well when tested with the Cas13a detection method. For identifying FAdV-4, this novel detection approach was found to be sensitive, specific, and effective.RESEARCH HIGHLIGHTS First study using the CRISPR/Cas13a-based lateral flow detection assay for FAdV-4 detection.The results can be observed by the naked eye.The developed assay could provide an alternative tool for detection of FAdV-4 with minimal equipment.
Assuntos
Infecções por Adenoviridae , Aviadenovirus , Doenças das Aves Domésticas , Animais , Infecções por Adenoviridae/diagnóstico , Infecções por Adenoviridae/veterinária , Sorogrupo , Repetições Palindrômicas Curtas Agrupadas e Regularmente Espaçadas , Galinhas , Adenoviridae/genética , Aviadenovirus/genéticaRESUMO
BACKGROUND: Pullorum disease caused by Salmonella pullorum is one of the most important infectious diseases in the poultry industry, responsible for causing substantial economic losses globally. On farms, the traditional method to detect S. pullorum infection mainly involves the collection of feces and sera to test for antigens and antibodies, respectively, but the regularity of Salmonella pullorum dissemination in internal organs and shedding patterns and antibody production in infected chickens remains unclear. Herein we aimed to investigate the dissemination of S. pullorum to different organs and bacterial shedding patterns in the faeces as well as serum antibody production post-infection in chickens of different ages. RESULT: In this study, the liver and heart of 2-day-old chickens showed the highest copy numbers of S. pullorum at 6.4 × 106 and 1.9 × 106 copies of DNA target sequences/30 mg, respectively. In case of 10-day-old chickens, the percentage of S. pullorum fecal shedding (0%-40%) and antibody production (0%-56.6%) markedly fluctuated during the entire experiment; furthermore, in case of 42-week-old chickens, the percentage of birds showing S. pullorum shedding in the faeces showed a downward trend (from 63.33% to 6.6% in the oral inoculation group and from 43.3% to 10% in the intraperitoneal injection group), while that of birds showing serum antibody production remained at a high level (38.3% and 80% in the oral inoculation and intraperitoneal injection groups, respectively). We also performed cohabitation experiments, showed that 15% 10-day-old and 3.33% 42-week-old chickens were infected via the horizontal transmission in cohabitation with S. pullorum infected chickens, and revealed a high risk of horizontal transmission of S. pullorum. CONCLUSION: This study systematically evaluated the dissemination of S. pullorum in internal organs and bacterial fecal shedding patterns, and antibody production in infected chickens. Collectively, our findings indicate how to effectively screen S. pullorum-negative chickens on livestock farms and should also help in the development of measures to control and eradicate S. pullorum.
Assuntos
Doenças das Aves Domésticas , Salmonelose Animal , Animais , Formação de Anticorpos , Galinhas/microbiologia , Doenças das Aves Domésticas/microbiologia , Salmonella , Salmonelose Animal/microbiologiaRESUMO
Avian pathogenic Escherichia coli (APEC), a type of extraintestinal pathogenic E. coli, causes avian colibacillosis, a disease of significant economic importance to poultry producers worldwide, which is characterized by systemic infection. However, the pathogenesis of avian pathogenic E. coli strains is not well defined. Here, the role of a flagellar rotor protein encoded by the fliG gene of avian pathogenic E. coli strain AE17 was investigated. To study the role of FliG in the pathogenicity of APEC, fliG mutant and complemented strains were constructed and characterized. The inactivation of fliG had no effect on APEC growth, but significantly reduced bacterial motility. Compared with the wild type, the fliG mutant was highly attenuated in a chick infection model and showed severe defects in its adherence to and invasion of chicken embryo fibroblast DF-1 cells. The fliG mutant also showed reduced resistance to serum in chicks. The expression of the inflammatory cytokines interleukin 1ß (IL1ß), IL6, and IL8 was reduced in HD-11 macrophages infected with the fliG mutant strain compared with their expression in the wild-type strain. These results demonstrate that the FliG contributes to the virulence of APEC.
Assuntos
Infecções por Escherichia coli , Proteínas de Escherichia coli , Doenças das Aves Domésticas , Animais , Embrião de Galinha , Galinhas , Escherichia coli/genética , Infecções por Escherichia coli/veterinária , Proteínas de Escherichia coli/genética , Virulência , Fatores de Virulência/genéticaRESUMO
BACKGROUND: Indoles are important bioactive compounds that have been extensively studied in organic chemistry. In this work, a green and efficient process for the synthesis of Indoles from 1,3-diketones with fumaronitrile was developed. RESULTS: Under optimal conditions (1,3-diketones (0.5 mmol), fumaronitrile (1 mmol), water (2 ml), lipase (15 mg), 30 °C, 24 h), high yields and satisfactory regioselectivity of cyano-containing multi-substituted indoles could be obtained when CRL (C. rugosa lipase) was used as the catalyst. CONCLUSION: This enzymatic method demonstrates the great potential for the synthesis of indoles and extends the application of enzyme in organic synthesis.
Assuntos
Candida/enzimologia , Indóis/metabolismo , Lipase/metabolismo , Pseudomonas aeruginosa/enzimologia , Animais , Biocatálise , Indóis/química , Estrutura Molecular , SuínosRESUMO
A woman with coronavirus disease in her 35th week of pregnancy delivered an infant by cesarean section in a negative-pressure operating room. The infant was negative for severe acute respiratory coronavirus 2. This case suggests that mother-to-child transmission is unlikely for this virus.
Assuntos
Infecções por Coronavirus/transmissão , Pneumonia Viral/transmissão , Adulto , Betacoronavirus , COVID-19 , Cesárea , China , Infecções por Coronavirus/terapia , Feminino , Humanos , Recém-Nascido , Transmissão Vertical de Doenças Infecciosas , Masculino , Pandemias , Pneumonia Viral/terapia , Gravidez , SARS-CoV-2RESUMO
BACKGROUND & AIMS: Portal vein thrombosis (PVT) is a common and serious complication in patients with cirrhosis. However, little is known about PVT in patients with cirrhosis and acute decompensation (AD). We investigated the prevalence and clinical significance of PVT in nonmalignant patients with cirrhosis and AD. METHODS: We performed a retrospective study of 2 cohorts of patients with acute exacerbation of chronic liver disease who participated in the Chinese AcuTe on CHronic LIver FailurE study, established by the Chinese Chronic Liver Failure Consortium, from January 2015 through December 2016 (n = 2600 patients) and July 2018 through January 2019 (n = 1370 patients). We analyzed data on the prevalence, clinical manifestations, and risk factors of PVT from 2826 patients with cirrhosis, with and without AD. RESULTS: The prevalence of PVT in patients with cirrhosis and AD was 9.36%, which was significantly higher than in patients with cirrhosis without AD (5.24%) (P = .04). Among patients with cirrhosis and AD, 63.37% developed PVT recently (the first detected PVT with no indication of chronic PVT). Compared with patients without PVT, a significantly higher proportion of patients with PVT had variceal bleeding (47.33% vs 19.63%; P < .001) and patients with PVT had a significantly higher median serum level of D-dimer (2.07 vs 1.25; P < .001). Splenectomy and endoscopic sclerotherapy were independent risk factors for PVT in patients with cirrhosis and AD. The 1-year mortality rate did not differ significantly between patients with vs without PVT. CONCLUSIONS: In an analysis of data from 2826 patients with cirrhosis, a significantly higher proportion of those with AD had PVT than those without AD. PVT was associated with increased variceal bleeding, which would increase the risk for AD. Strategies are needed to prevent PVT in patients with cirrhosis, through regular screening, to reduce portal hypertension. ClinicalTrials.gov no: NCT02457637 and NCT03641872.
Assuntos
Varizes Esofágicas e Gástricas , Trombose Venosa , Varizes Esofágicas e Gástricas/complicações , Varizes Esofágicas e Gástricas/epidemiologia , Varizes Esofágicas e Gástricas/patologia , Hemorragia Gastrointestinal/patologia , Humanos , Cirrose Hepática/complicações , Cirrose Hepática/patologia , Veia Porta/patologia , Prevalência , Estudos Retrospectivos , Trombose Venosa/complicações , Trombose Venosa/epidemiologia , Trombose Venosa/patologiaRESUMO
Porcine epidemic diarrhea virus (PEDV) is responsible for the acute infectious swine disease porcine epidemic diarrhea (PED). PED causes damage to the intestine, including villus atrophy and shedding, leading to serious economic losses to the pig industry worldwide. We carried out an in vitro study to investigate cell apoptosis and the cell cycle in a PEDV-infected host using transcriptomic shotgun sequencing (RNA-Seq) to study gene responses to PEDV infection. Results revealed that the PEDV infection reduced proliferation activity, blocked the cell cycle at S-phase and induced apoptosis in IPEC-J2 cells. The expression of gene levels related to ribosome proteins and oxidative phosphorylation were significantly up-regulated post-PEDV infection. Although the significantly down-regulated on PI3K/Akt signaling pathway post-PEDV infection, the regulator-related genes of mTOR signaling pathway exerted significantly up-regulated or down-regulated in IPEC-J2 cells. These results indicated that ribosome proteins and oxidative phosphorylation process were widely involved in the pathological changes and regulation of host cells caused by PEDV infection, and PI3K/AKT and mTOR signaling pathways played a vital role in antiviral regulation in IPEC-J2 cells. These data might provide new insights into the specific pathogenesis of PEDV infection and pave the way for the development of effective therapeutic strategies.
Assuntos
Apoptose , Ciclo Celular , Células Epiteliais/virologia , Vírus da Diarreia Epidêmica Suína , Doenças dos Suínos , Animais , Linhagem Celular , Infecções por Coronavirus/veterinária , Intestinos , Fosfatidilinositol 3-Quinases , Proteínas Proto-Oncogênicas c-akt , Transdução de Sinais , Suínos , Serina-Treonina Quinases TORRESUMO
Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1α gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame.
Assuntos
Fusarium , China , Filogenia , Doenças das Plantas , VirulênciaRESUMO
BACKGROUND: Patients with hepatitis B-related acute-on-chronic liver failure (HB-ACLF) may have an increased circulating microbial burden. This study aimed to assess circulating microbial load and composition and to explore the association between the circulating microbiome and both systemic inflammation (SI) and clinical outcome in HB-ACLF. METHODS: Plasma from 50 HB-ACLF patients, 23 healthy controls and 25 patients with compensated liver cirrhosis (C-LC) was analysed for chemokines/cytokines and bacterial DNA and further analysed by 16S rDNApyrosequencing. Linear discriminant analysis effect size (LEfSe) and inferred metagenomics analyses were performed. RESULTS: The circulating bacterial DNA was significantly increased in HB-ACLF patients compared to that in the control groups. The overall microbial diversity was significantly decreased in HB-ACLF patients. HB-ACLF patients were enriched with Moraxellaceae, Sulfurovum, Comamonas and Burkholderiaceae but were depleted in Actinobacteria, Deinococcus-Thermus, Alphaproteobacteria, Xanthomonadaceae and Enterobacteriaceae compared to controls. Network analysis revealed a direct positive correlation between Burkholderiaceae and chemokine IP-10 in HB-ACLF patients. The relative abundance of Prevotellaceae independently predicted 28-day mortality. Inferred functional metagenomics predicted an enrichment of bacteria with genes related to methane, alanine, aspartate, glutamate, pyrimidine, purine and energy metabolism. CONCLUSIONS: HB-ACLF patients display increased circulating microbial burden, altered microbiome composition and a shift in microbiome functionality. The alteration in circulating microbiota is associated with SI and clinical outcome in HB-ACLF.
Assuntos
Insuficiência Hepática Crônica Agudizada/sangue , Hepatite B Crônica/sangue , Cirrose Hepática/sangue , Microbiota , Insuficiência Hepática Crônica Agudizada/microbiologia , Insuficiência Hepática Crônica Agudizada/mortalidade , Adulto , Biomarcadores/sangue , Estudos de Casos e Controles , Citocinas/sangue , DNA Bacteriano/sangue , Feminino , Hepatite B Crônica/microbiologia , Humanos , Mediadores da Inflamação/sangue , Cirrose Hepática/microbiologia , Masculino , Pessoa de Meia-Idade , Valor Preditivo dos TestesRESUMO
AIM: Flare-ups of chronic hepatitis B can sometimes be severe and even progress to acute-on-chronic liver failure (ACLF), with high short-term mortality. A timely estimation of the risk of death should be initiated early. The aim of the present study was to determine whether novel biomarkers add prognostic information beyond current clinical scoring systems. METHODS: Patients with hepatitis B-associated ACLF were prospectively enrolled from five hospitals in China between August 2017 and March 2018. Their plasma was screened for soluble CD163 (sCD163), neutrophil gelatinase-associated lipocalin (NGAL), and copeptin. The association between these biomarkers and mortality was analyzed. The performance of the Model for End-stage Liver Disease, Asian-Pacific Association for the Study of the Liver-ACLF Research Consortium score, and the Chronic Liver Failure Consortium ACLF score, with or without biomarkers, were compared. RESULTS: One hundred fifty one patients were enrolled. Advanced ACLF patients had significantly higher levels than early ACLF individuals of plasma biomarkers sCD163 (P = 0.001), NGAL (P = 0.006), and copeptin (P = 0.049). Thirty-four deaths occurred during the 28-day follow-up period (22.5%). Both sCD163 and NGAL showed a strong independent association with 28-day mortality, whereas copeptin did not. Scoring systems incorporating sCD163 and NGAL had better discrimination and calibration, as measured by area under the receiver operating characteristic curves, the Akaike information criteria, integrated discrimination improvement, and net reclassification improvement. CONCLUSIONS: Soluble CD163 and NGAL are independently associated with short-term mortality in hepatitis B-associated ACLF. Use of a combination of sCD163 and NGAL improves prognostication.
RESUMO
BACKGROUND: Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. RESULTS: For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553-6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. CONCLUSIONS: SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.
Assuntos
Frutas/genética , Genes de Plantas , Folhas de Planta/genética , Sesamum/genética , Alelos , Mapeamento Cromossômico , Cromossomos de Plantas , Clonagem Molecular , DNA de Plantas , Frutas/crescimento & desenvolvimento , Genes Recessivos , Variação Genética , Padrões de Herança , Mutação , Folhas de Planta/crescimento & desenvolvimento , Proteínas de Plantas/genética , Proteínas Repressoras/genética , Análise de Sequência de DNA , TranscriptomaRESUMO
Sesame is an ancient oilseed crop with high oil content and quality. However, the evolutionary history and genetic mechanisms of its valuable agronomic traits remain unclear. Here, we report chromosome-scale genomes of cultivated sesame (Sesamum indicum L.) and six wild Sesamum species, representing all three karyotypes within this genus. Karyotyping and genome-based phylogenic analysis revealed the evolutionary route of Sesamum species from n = 13 to n = 16 and revealed that allotetraploidization occurred in the wild species Sesamum radiatum. Early divergence of the Sesamum genus (48.5-19.7 million years ago) during the Tertiary period and its ancient phylogenic position within eudicots were observed. Pan-genome analysis revealed 9164 core gene families in the 7 Sesamum species. These families are significantly enriched in various metabolic pathways, including fatty acid (FA) metabolism and FA biosynthesis. Structural variations in SiPT1 and SiDT1 within the phosphatidyl ethanolamine-binding protein gene family lead to the genomic evolution of plant-architecture and inflorescence-development phenotypes in Sesamum. A genome-wide association study (GWAS) of an interspecific population and genome comparisons revealed a long terminal repeat insertion and a sequence deletion in DIR genes of wild Sesamum angustifolium and cultivated sesame, respectively; both variations independently cause high susceptibility to Fusarium wilt disease. A GWAS of 560 sesame accessions combined with an overexpression study confirmed that the NAC1 and PPO genes play an important role in upregulating oil content of sesame. Our study provides high-quality genomic resources for cultivated and wild Sesamum species and insights that can improve molecular breeding strategies for sesame and other oilseed crops.
Assuntos
Sesamum , Sesamum/genética , Sesamum/metabolismo , Estudo de Associação Genômica Ampla , Fenótipo , Genômica , Evolução MolecularRESUMO
Sesame (Sesamum indicum L.) is an ancient and important oilseed crop. However, few sesame reference genes have been selected for quantitative real-time PCR until now. Screening and validating reference genes is a requisite for gene expression normalization in sesame functional genomics research. In this study, ten candidate reference genes, i.e., SiACT, SiUBQ6, SiTUB, Si18S rRNA, SiEF1α, SiCYP, SiHistone, SiDNAJ, SiAPT and SiGAPDH, were chosen and examined systematically in 32 sesame samples. Three qRT-PCR analysis methods, i.e., geNorm, NormFinder and BestKeeper, were evaluated systematically. Results indicated that all ten candidate reference genes could be used as reference genes in sesame. SiUBQ6 and SiAPT were the optimal reference genes for sesame plant development; SiTUB was suitable for sesame vegetative tissue development, SiDNAJ for pathogen treatment, SiHistone for abiotic stress, SiUBQ6 for bud development and SiACT for seed germination. As for hormone treatment and seed development, SiHistone, SiCYP, SiDNAJ or SiUBQ6, as well as SiACT, SiDNAJ, SiTUB or SiAPT, could be used as reference gene, respectively. To illustrate the suitability of these reference genes, we analyzed the expression variation of three functional sesame genes of SiSS, SiLEA and SiGH in different organs using the optimal qRT-PCR system for the first time. The stability levels of optimal and worst reference genes screened for seed development, anther sterility and plant development were validated in the qRT-PCR normalization. Our results provided a reference gene application guideline for sesame gene expression characterization using qRT-PCR system.
Assuntos
Regulação da Expressão Gênica de Plantas , Genes de Plantas/genética , Reação em Cadeia da Polimerase em Tempo Real/métodos , Reação em Cadeia da Polimerase em Tempo Real/normas , Sesamum/genética , Flores/genética , Perfilação da Expressão Gênica/normas , Estudos de Associação Genética , Especificidade de Órgãos/genética , Proteínas de Plantas/genética , Proteínas de Plantas/metabolismo , Padrões de Referência , SoftwareRESUMO
Porcine epidemic diarrhea virus (PEDV) infection causes severe diarrhea in pigs and can be fatal in newborn piglets. Exosomes are extracellular vesicles secreted by cells that transfer biologically active proteins, lipids, and RNA to neighboring or distant cells. Herein, the morphology, particle size, and secretion of exosomes derived from a control and PEDV-infected group are examined, followed by a proteomic analysis of the exosomes. The results show that the exosomes secreted from the Vero cells had a typical cup-shaped structure. The average particle size of the exosomes from the PEDV-infected group was 112.4 nm, whereas that from the control group was 150.8 nm. The exosome density analysis and characteristic protein determination revealed that the content of exosomes in the PEDV-infected group was significantly higher than that in the control group. The quantitative proteomics assays revealed 544 differentially expressed proteins (DEPs) in the PEDV-infected group's exosomes compared with those in the controls, with 236 upregulated and 308 downregulated proteins. The DEPs were closely associated with cellular regulatory pathways, such as the phosphatidylinositol-4,5-bisphosphate 3-kinase (PI3K)-protein kinase B (Akt) signaling pathway, extracellular matrix-receptor interaction, focal adhesion, and cytoskeletal regulation. These findings provide the basis for further investigation of the pathogenic mechanisms of PEDV and the discovery of novel antiviral targets.
Assuntos
Exossomos , Vírus da Diarreia Epidêmica Suína , Chlorocebus aethiops , Animais , Suínos , Células Vero , Proteômica , Transdução de SinaisRESUMO
Salmonella is one of the most important zoonotic pathogens that can cause both acute and chronic illnesses in poultry flocks, and can also be transmitted to humans from infected poultry. The purpose of this study was to investigate the prevalence, antimicrobial resistance, and molecular characteristics of Salmonella isolated from diseased and clinically healthy chickens in Anhui, China. In total, 108 Salmonella isolates (5.66%) were successfully recovered from chicken samples (n = 1908), including pathological tissue (57/408, 13.97%) and cloacal swabs (51/1500, 3.40%), and S. Enteritidis (43.52%), S. Typhimurium (23.15%), and S. Pullorum (10.19%) were the three most prevalent isolates. Salmonella isolates showed high rates of resistance to penicillin (61.11%), tetracyclines (47.22% to tetracycline and 45.37% to doxycycline), and sulfonamides (48.89%), and all isolates were susceptible to imipenem and polymyxin B. In total, 43.52% isolates were multidrug-resistant and had complex antimicrobial resistance patterns. The majority of isolates harbored cat1 (77.78%), blaTEM (61.11%), and blaCMY-2 (63.89%) genes, and the antimicrobial resistance genes in the isolates were significantly positively correlated with their corresponding resistance phenotype. Salmonella isolates carry high rates of virulence genes, with some of these reaching 100% (invA, mgtC, and stn). Fifty-seven isolates (52.78%) were biofilm-producing. The 108 isolates were classified into 12 sequence types (STs), whereby ST11 (43.51%) was the most prevalent, followed by ST19 (20.37%) and ST92 (13.89%). In conclusion, Salmonella infection in chicken flocks is still serious in Anhui Province, and not only causes disease in chickens but might also pose a threat to public health security.
RESUMO
Purpose: Heterocyclic compounds are organic compounds with heterocyclic structures, which are common in drug molecules. They include pyrazines with diverse functions, including anti-cancer, antimicrobial, antidiabetic, and anticholinergic activities. In this study a new small molecular compound B7 based on tetrazolium substituted pyrazine was synthesized and its effect on the progression of colorectal cancer (CRC) and its potential mechanism were investigated. Methods: We synthesized a series of tetrazolium-substituted pyrazine compounds by chemoenzymatic method. NCM460 (Human), HCT116 (Human), SW480 (Human) cell lines were selected to analyse the inhibitory effect of B7 on CRC by CCK-8, apoptosis, cell migration and invasion, qPCR, Western blotting, molecular docking, immunofluorescence. Moreover, a CRC xenograft model of mice was used to analyzed the role of B7 in vivo. Results: Among these compounds, 3-methyl-5je-6-bis (1H-tetrazole-5-yl) pyrazine-2-carboxylic acid (B7) inhibited CRC cell proliferation and induced apoptosis. The expression of Caspase-3 was increased after B7 treatment. In addition, the mitochondria abnormalities was observed in B7 group due to decrease the expression of Beclin-1. In addition, B7 inhibited the migration and invasion in CRC cells. Finally, the results showed that B7 had anti-tumor activity in CRC xenograft model of mice. Conclusion: In summary, compound B7 was synthesized efficiently using tetrazolium-substituted pyrazine via a chemoenzymatic method. Moreover, B7 have ability to regulate the expression of Caspase-3 which induced apoptosis in CRC cells. In addition, decreased Beclin-1 expression after B7 treatment, indicating inhibited autophagy. This study showed that B7 effectively induced apoptosis and inhibited autophagy in CRC cells.
RESUMO
Klebsiella variicola is an emerging pathogen that has become a threat to human and animal health. There is evidence that long noncoding RNAs (lncRNAs) are involved in a host cell's response to microbial infections. However, no study has defined the link between K. variicola pathogenesis and lncRNAs until now. We used RNA sequencing to comprehensively analyze the lncRNAs and mRNAs in the chicken spleen after K. variicola infection. In total, we identified 2896 differentially expressed mRNAs and 578 differentially expressed lncRNAs. To examine the potential functions of these lncRNAs, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes signaling pathway enrichment analyses were performed on the target mRNAs of these differently expressed lncRNAs. The results suggested that lncRNAs play essential roles in modulating mRNA expression and triggering downstream immune signaling pathways to regulate the immune response in the chicken spleen. Using previous microRNA sequencing data, we constructed lncRNA-miRNA-mRNA regulatory networks to clarify the regulatory mechanisms in the chicken immune system. Several potential regulatory pairs related to K. variicola infection were found, involving XR_001467769.2, TCONS_00018386, gga-miR-132a-3p, gga-miR-132b-5p, gga-miR-2954, and novel62_mature. In conclusion, our findings make a significant contribution towards understanding the role of lncRNA in chicken spleen cells during K. variicola infection, thereby establishing a solid foundation for future research in this area.