Recycling glycoproteins do not return to the cis-Golgi.

Recycling of a number of glycoproteins along the site of action of mannosidase I (the distal endoplasmic reticulum/cis-Golgi) was followed in several different cell lines. Treatment of cells with 1-deoxymannojirimycin (dMM) produced high mannose oligosaccharides at positions otherwise occupied by complex-type oligosaccharides in these glycoproteins. Conversion of high-mannose-type oligosaccharides to complex oligosaccharides of proteins initially synthesized in the presence of dMM was used as a marker for recycling of glycoproteins along the site of action of dMM. In contrast to findings reported by Snider and Rogers (Snider, M. D., and O. C. Rogers. 1986. J. Cell Biol. 103:265-275), removal of dMM did not result in reconversion of high-mannose oligosaccharides to complex-type sugars, even after prolonged periods of culture. We conclude that surface glycoproteins do not recycle through the cis-medial Golgi elements.

Z-DNA forms without an alternating purine-pyrimidine sequence in solution.

Nuclear magnetic resonance spectra (proton and phosphorus-31) and ultraviolet absorption spectra of the DNA decamer d(br5CGbr5CGATbr5CGbr5CG), in which the central two adenine-thymine base pairs are out of order with the rest of the purine-pyrimidine alternation sequence, indicate that under appropriate solvent conditions (high salt and methanol) the molecule undergoes a structural transition from a right-handed B-DNA conformation to a left-handed Z-DNA conformation. Measurements of the two-dimensional nuclear Overhauser effect on the decamer indicate that all of the guanines as well as the two equivalent thymines adopt the syn conformation.

Non-Watson-Crick G.C and A.T base pairs in a DNA-antibiotic complex.

The structure of a DNA octamer d(GCGTACGC) cocrystallized with the bisintercalator antibiotic triostin A has been solved. The DNA forms an unwound right-handed double helix. Four base pairs are of the Watson-Crick type while four are Hoogsteen base pairs, including two A.T and two G.C base pairs. This is the first observation in an oligonucleotide of Hoogsteen G.C base pairs where the cystosine is protonated. It is likely that these also occur in solutions of DNA complexed to this antibiotic.

Left-handed double helical DNA: variations in the backbone conformation.

Four different crystals of d(CpGpCpGpCpG) have been solved by x-ray diffraction analysis and all form similar left-handed double helical Z-DNA molecules in the crystal lattice. Two different conformations are observed for the phosphates in the GpC sequences, as the phosphates are found either facing the helical groove or rotated away from it. The latter conformation is often found when hydrated magnesium ions are complexed to a phosphate oxygen atom. These different conformations may be used when right-handed B-DNA joins left-handed Z-DNA. Atomic coordinates and torsion angles are presented for both types of Z-DNA.

The molecular structure of a DNA-triostin A complex.

The molecular structure of triostin A, a cyclic octadepsipeptide antibiotic, has been solved complexed to a DNA double helical fragment with the sequence CGTACG (C, cytosine; G, guanine; T, thymine; A, adenine). The two planar quinoxaline rings of triostin A bis intercalate on the minor groove of the DNA double helix surrounding the CG base pairs at either end. The alanine residues form hydrogen bonds to the guanines. Base stacking in the DNA is perturbed, and the major binding interaction involves a large number of van der Waals contacts between the peptides and the nucleic acid. The adenine residues in the center are in the syn conformation and are paired to thymine through Hoogsteen base pairing.

Complete assignment and conformational analysis of a deoxyribotetranucleotide. d(TAAT). A 360 and 500 Mhz NMR study.

A proton NMR study at 360 MHz and 500 MHz was carried out on the tetranucleoside triphosphate d(TAAT) at a temperature of 27 degrees C. Extensive decoupling experiments allowed a complete and unambiguous spectral assignment. The data are interpreted in terms of the N and S deoxyribose pseudorotational ranges. From the observed proton-proton coupling constants it is calculated that (a) the populations of deoxyribose S-form are as follows: dT(1)-, 85%; -dA(2)-, 97%; -dA(3)-, 81%; -dT(4), 64%; and (b) the g+ populations (backbone notation) along the exocyclic C4'-C5' bond in -dA(2)-, -dA(3)- and dT(4) are 82%, 86% and 78%, respectively. From these values, combined with chemical shift considerations, it is concluded that the central -dA(2)-dA(3)- part of the molecule occurs preferentially as a mixture of two right-handed single-helical conformations, denoted S-S and S-N, in a ratio of approximately 8 : 2. This situation closely mimics that found for the 3'-end of d(A-A-A) (Olsthoorn, C.S.M., Bostelaar, L.J., Van Boom, J. H. and Altona, C. (1980) Eur. J. Biochem 112, 95--110). Similarly, the conformational behavior of the dT(1)-dA(2)- and -dA(3)-dT(4) terminals appears roughly identical to that displayed by the corresponding dinucleoside monophosphates. The molecules as a whole does not show signs of cooperatively of stacking.

Complex of lac repressor headpiece with a 14 base-pair lac operator fragment studied by two-dimensional nuclear magnetic resonance.

Two-dimensional nuclear Overhauser enhancement spectra are presented of the complex of lac repressor headpiece with a 14 base-pair lac operator fragment. Analysis of nuclear Overhauser enhancements observed between protein and DNA shows that the second helix of the headpiece ("the recognition helix") binds in the major groove of DNA as has been suggested, but that the orientation of this helix is approximately 180 degrees different from the proposed models.

Structure of the complex of lac repressor headpiece and an 11 base-pair half-operator determined by nuclear magnetic resonance spectroscopy and restrained molecular dynamics.

The structure of the complex of lac repressor headpiece and an 11 base-pair lac half-operator has been determined by NMR spectroscopy and restrained Molecular Dynamics calculations. In total 508 distances were derived from two-dimensional nuclear Overhauser enhancement measurements, 260 of which are within the headpiece, 212 within the operator and 36 between operator and headpiece. An equilibrium restrained Molecular Dynamics calculation of the complex in aqueous solution, spanning 85 picoseconds, has been used to analyze the structure. Configuration sampling by an annealing procedure has been undertaken as well in order to estimate the precision of the structure determination. Our data confirm the results of previous two-dimensional NMR studies that the orientation of the recognition helix of lac repressor in the major groove of DNA with respect to the operator dyad axis is opposite to the orientation found in complexes of other DNA binding proteins of the helix-turn-helix class. We find a number of tight contacts between the protein and the operator that are in agreement with the available genetic and biochemical data. The anchoring of lac headpiece on the operator is similar to that of other repressors. Other features are unique for lac headpiece: relative few direct hydrogen bonds between side-chains and bases; extensive apolar contacts; many direct and water-bridged contacts to phosphates from residues in or close to the recognition helix. Overall, an interconnected set of interactions is observed, involving base-specific contacts, phosphate contacts, intra-protein and water-bridged hydrogen bonds. Several of these interactions appear to be dynamic, i.e. fluctuating in time, rather than static.

Crystallization of complexes of EcoRV endonuclease with cognate and non-cognate DNA fragments.

Complexes of the type II restriction endonuclease EcoRV with a variety of short, selfcomplementary deoxyoligonucleotides have been crystallized. The best crystals diffract to about 2.7 A resolution and consist of 1:1 complexes between endonuclease dimers and duplexes of the cognate decamer GGGATATCCC containing the hexameric RV recognition sequence GATATC. Crystals with the non-cognate DNA octamer duplexes CGAGCTCG and CGAATTCG diffract to 3.0 and 3.5 A resolution, respectively, and contain two DNA duplexes per enzyme dimer.

NMR studies of DNA three-way junctions containing two unpaired thymidine bases: the influence of the sequence at the junction on the stability of the stacking conformers.

DNA three-way junctions (TWJs) containing unpaired residues at the branch point can adopt a conformation in which one helix is stacked upon another, forming a coaxial, quasicontinuous double helix. As in four-way junctions (FWJs), two conformers with different stacking arrangements between the arms are possible. However, in both types of structures a markedly strong preference for one conformer has been observed. To investigate the basis for this preference, in particular the influence of the stacking proclivity of the base-pairs at the centre of the junction, two linear oligomers (36 nucleotides), TWJ1 and TWJ2, differing only in one base-pair (G.C versus C.G, respectively) at the branch point, were designed and chemically synthesized. Each one is expected to fold into a stable three-way junction, containing two unpaired thymidine bases at the junction region and two arms capped with a hairpin loop. The data obtained from 1H and 31P-NMR spectroscopy confirm that both oligomers are present as stable three-way junctions. In both TWJs two of the helical arms stack preferentially upon each other. However, the stacking arrangement is similar in both molecules. From this it is deduced that purine-purine stacking across the junction cannot be considered as a major factor that determines the preferred stacking arrangement.

Triple helix formation by oligopurine-oligopyrimidine DNA fragments. Electrophoretic and thermodynamic behavior.

The 26mer oligodeoxynucleotide d(GAAGGAGGAGATTTTTCTCCTCCTTC) adopts in solution a unimolecular hairpin structure (h), with an oligopurine-oligopyrimidine (Pu-Py) stem. When h is mixed with d(CTTCCTCCTCT) (s1) the two strands co-migrate in polyacrylamide gel electrophoresis at pH 5. If s1 is substituted with d(TCTCCTCCTTC) (s2), such behavior is not observed and the two strands migrate separately. This supports the suggestion of the formation of a triple-stranded structure by h and s1 (h:s1) but not by h and s2, and confirms the strand polarity requirement of the third pyrimidine strand, which is necessary for this type of structure. The formation of a triple helix by h:s1 is supported by electrophoretic mobility data (Ferguson plot) and by enzymatic assay with DNase I. Circular dichroism measurements show that, upon triple helix formation, there are two negative ellipticities: a weaker one (delta epsilon = 80 M-1 cm-1) at 242 nm and a stronger one (delta epsilon = 210 M-1 cm-1) at 212 nm. The latter has been observed also in triple-stranded polynucleotides, and can be considered as the trademark for a Py:Pu:Py DNA triplex. Comparison of ultraviolet absorption at 270 nm and temperature measurements shows that the triple-stranded structure melts with a biphasic profile. The lower temperature transition is bimolecular and is attributable to the breakdown of the triplex to give h and s1, while the higher temperature transition is monomolecular and is due to the transition of hairpin to coil structure. The duplex-to-triplex transition is co-operative, fully reversible and with a hyperchromism of about 10%. The analysis of the melting curves, with a three-state model, allows estimation of the thermodynamic parameters of triple helix formation. We found that the duplex-to-triplex transition of h: s1 is accompanied by an average change in enthalpy (less the protonation contribution) of -73(+/- 5) kcal/mol of triplex, which corresponds to -6.6(+/- 0.4) kcal/mol of binding pyrimidine, attributable to stacking and hydrogen bonding interactions.

A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment.

The duplex of d(GGTACGCGCGTGCGCGATGG) and d(CCATCGCGCGTGCGCGTACC) containing an inverted repeat has been studied by spectroscopic and electrophoretic techniques. Prior to melting this DNA fragment, like many other palindromes, transforms into hairpin structures but with four non-self-complementary bases ("dangling ends") at their termini. Most surprisingly, it is found that these dangling ends promote an unusually facile hairpin-duplex interconversion in contrast to very slow ones found in all the "blunt end" palindromes studied so far. Kinetic studies provide evidence, for the first time in a linear DNA fragment, that a cruciform intermediate is involved in the hairpin to duplex interconversion.

Conformational aspects of an uncharged phosphate analogon built in at the branch-point of a DNA four-way junction.

Electrostatic interactions appear to be important in the conformation and dynamics of DNA four-way junctions. Particularly, the Coulomb repulsion between two approaching phosphate groups at the site of strand exchange is commonly supposed to have a negative influence on the thermodynamic stability of the fully stacked conformation. We synthesized a unimolecular DNA four-way junction containing an uncharged methylene-acetal linkage, -O3'-CH2-O5'-, instead of a regular phosphodiester linkage, -O3'-PO2-O5'-, between two specific residues at the branch-point to examine the effect of charge removal. Complete sequential 1H-NMR assignments of the non-exchangeable base protons and H1'/H2'/H2" sugar protons were obtained with the aid of NOESY and TOCSY experiments. On the basis of the NMR data it is concluded that the stacking arrangement at the branch-point of the modified oligonucleotide is similar to that of the previously studied parent four-way junction. Surprisingly, this is not the stacking arrangement in which the close phosphate-phosphate contact at the site of strand exchange would be absent. Some implications of this novel information regarding the role of the phosphate-phosphate repulsion in four-way junctions are discussed.

The transition from a neutral-pH double helix to a low-pH triple helix induces a conformational switch in the CCCG tetraloop closing a Watson-Crick stem.

The CCCG-loop in a DNA fragment, which is capable of forming an intramolecular triple helix as well as a hairpin structure, was investigated by NMR and molecular modeling studies. The structure of this loop is found as a type II conformation, one of the three commonly observed folding patterns of tetraloops, irrespective of the geometry of the underlying helix. In each situation, the loop exhibits a base-pair between the first cytosine and the guanine residue of the loop. The geometry of this base-pair, however, depends upon the circumstances. At neutral pH, in the hairpin form of the molecule, a Watson-Crick C.G base-pair is formed, whereas at low pH, when the strand exists as an intramolecular triple helix, a Hoogsteen C(+)-G base-pair is present. We used molecular modeling to lay the foundations for understanding the observed conformational switch. A lower amount of strain, related to the short C1'-C1' of the base-pair, and protonation effects of the structure comprising the Hoogsteen base-pair turn out to outweigh the effects of a more stable base-pair, improved stacking and more favorable interactions in the minor groove of the structure comprising the Watson-Crick C.G base-pair. The models also provide an explanation for the general preference of loops meeting the consensus sequence--d(CYNG)--to fold into a type II conformation, i.e. with the base of second loop residue turned into the minor groove.

Structure of 11-deoxydaunomycin bound to DNA containing a phosphorothioate.

The anthracyclines form an important family of cancer chemotherapeutic agents with a strong dependence of clinical properties on minor differences in chemical structure. We describe the X-ray crystallographic solution of the three-dimensional structure of the anthracycline 11-deoxydaunomycin plus d(CGTsACG). In this complex, two drug molecules bind to each hexamer duplex. Both the drug and the DNA are covalently modified in this complex in contrast with the three previously reported DNA-anthracycline complexes. In the 11-deoxydaunomycin complex the 11 hydroxyl group is absent and a phosphate oxygen at the TpA step has been replaced by a sulfur atom leading to a phosphorothioate with absolute stereochemistry R. Surprisingly, removal of a hydroxyl group from the 11 position does not alter the relative orientation of the intercalated chromophore. However, it appears that the phosphorothioate modification influenced the crystallization and caused the 11-deoxydaunomycin-d(CGTsACG) complex to crystallize into a different lattice (space group P2) with different lattice contacts and packing forces than the non-phosphorothioated DNA-anthracycline complexes (space group P4(1)2(1)2). In the minor groove of the DNA, the unexpected position of the amino-sugar of 11-deoxydaunomycin supports the hypothesis that in solution the position of the amino sugar is dynamic.

Activation of the genes for variant surface glycoproteins 117 and 118 in Trypanosoma brucei.

We have studied the activation of genes for VSGs (variant surface glycoproteins) in Trypanosoma brucei (strain 427) in six independently isolated trypanosome clones; four expressing the gene for VSG 118 and two the gene for VSG 117. In all cases, gene activation is brought about by a duplicative transposition of the gene to an expression site located close to the end of a chromosome. The DNA segments flanking the expression-linked extra gene copy are nearly devoid of restriction enzyme recognition sites and their lengths vary by more than 10,000 base-pairs among different variants. From the correspondence of five upstream restriction sites, we conclude that the same expression site is used in each case. The transposition event does not lead to detectable alterations in the sequence coding for the mature protein. All restriction enzyme recognition sites detected in the basic copy gene are present also in each of the expression-linked copies. This argues against the introduction of mutations by an error-prone polymerase during the synthesis of the expression-linked copy. In five of the six variants, the 3' end of the VSG messenger RNA differs from that of the corresponding basic copy gene by multiple point mutations, insertions and deletions, starting at positions varying from 16 nucleotides upstream to 113 downstream of the last codon of the mature protein. We attribute this end alteration to the recombination process that introduces the gene into the expression site. We confirm that the expression-linked gene copy is more sensitive to DNase I than the corresponding basic copy gene. This appears to be due to its activated state and not to its location near the end of a chromosome, because another basic copy VSG gene permanently located near a chromosome end is not hypersensitive to DNase I. The mature transcripts of the 117 and 118 genes all possess the same 35 nucleotides at their 5' ends and these are not encoded contiguously in the basic gene copies with the remainder of the mRNAs. This extends our previous conclusion, that mature VSG mRNAs are formed by a splicing process in which the 35-nucleotide sequence encoded in the expression site is fused onto the body of the mRNA contributed by the transposed gene.

(1----5)-linked beta-D-galactofuranosides are immunodominant in extracellular polysaccharides of Penicillium and Aspergillus species.

Aspergillus and Penicillium species produce extracellular polysaccharides which are immunologically active. Methyl beta-D-galactofuranoside interferes with the reaction between the polysaccharide antigens and the antibodies raised in rabbits. Of the different interlinked dimers of beta-D-galactofuranosides (1----2; 1----3; 1----5; 1----6) the (1----5) interlinked beta-D-galactofuranoside gave the highest inhibition. An increasing inhibitory effect of di-, tri-, tetra-, penta-, hexa-, and heptamer of (1----5) interlinked beta-D-galactofuranosides was observed. It was noticed that the penta-, hexa- and heptamer of (1----5) interlinked beta-D-galactofuranosides were able to link antibodies raised against the extracellular polysaccharides produced by Penicillium species. The tetramer molecule was able to neutralize the binding of antibodies, which are naturally present in human sera, to the polysaccharides produced by Penicillium and Aspergillus species.

A dot-blot screening procedure for mutated ras oncogenes using synthetic oligodeoxynucleotides.

To analyze human tumors for the presence of mutated ras oncogenes, a procedure was developed based on selective hybridization of mutation-specific oligodeoxynucleotide probes to genomic DNA [Bos et al., Nucl. Acids Res. 12 (1984) 9155-9163]. We have improved this procedure both in sensitivity and speed by including an in vitro amplification step of ras-specific sequences. This amplification step has first been described by Saiki et al. [Science 230 (1985) 1350-1353] and results in a more than 10(4)-fold increase in the sequence which might contain the mutation. Furthermore, we have improved the selectivity of our hybridizations. As a result, mutated ras oncogenes can now be detected with a dot-blot screening procedure requiring less than 1 microgram of tumor DNA.

A phosphorus NMR study of the reaction products of cis-diamminedichloroplatinum (II) with a double-helical oligonucleotide and with DNA.

The structural distortion of oligonucleotides upon cis-PtCl2(NH3)2[d(T-C-T-C-G-G-T-C-T-C)-N7(5), N7(6)] reveals shifting of 4 phosphorus resonances due to platination. 3 Resonances could be assigned by selective 31P-irradiation, showing P(6) (P between the two Gs) to be shifted 1.5 ppm to low field. In the concomitant double strands P(6) is shifted 0.9 ppm to lower field. A similar peak has been observed in platinated salmon sperm DNA (37 degrees C), indicating that Pt-binding to GpG-fragments in DNA is similar to that found for the decanucleotide, so the distortion of DNA might be comparable.

Interaction between the left-handed Z-DNA and polyamine. The crystal structure of the d(CG)3 and N-(2-aminoethyl)-1,4-diamino-butane complex.

The DNA fragment d(CG)3 was co-crystallized with N-(2-aminoethyl)-1,4-diaminobutane (PA(24], a chemically synthesized polyamine. The complex crystal contained one polyamine, 3 magnesium cations and one sodium cation per duplex of d(CG)3, and well diffracted the X-ray intensities up to 1.0 A resolution. The d(CG)3 took a left-handed Z-DNA conformation, and the PA(24) molecule electrostatically interacted with the phosphate groups of the d(CG)3 duplex.