Development of transgenic Paulownia trees expressing antimicrobial thionin genes for enhanced resistance to fungal infections using chitosan nanoparticles.

There is an increasing focus on genetically altering Paulownia trees to enhance their resistance against fungal infections, given their rapid growth and quality wood production. The aim of this research was to establish a technique for incorporating two antimicrobial thionin genes, namely thionin-60 (thio-60) and thionin-63 (thio-63), into Paulownia tomentosa and Paulownia hybrid 9501 through the utilization of chitosan nanoparticles. The outcomes revealed the successful gene transfer into Paulownia trees utilizing chitosan nanoparticles. The effectiveness of thionin proteins against plant pathogens Fusarium and Aspergillus was examined, with a specific focus on Fusarium equiseti due to limited available data. In non-transgenic Paulownia species, the leaf weight inhibition percentage varied from 25 to 36 %, whereas in transgenic species, it ranged from 22 to 7 %. In general, Paulownia species expressing thio-60 displayed increased resistance to F. equiseti, while those expressing thio-63 exhibited heightened resistance to A. niger infection. The thionin proteins displayed a strong affinity for the phospholipid bilayer of the fungal cell membrane, demonstrating their capability to disrupt its structure. The transgenic plants created through this technique showed increased resistance to fungal infections. Thionin-60 demonstrated superior antifungal properties in comparison to thio-63, being more effective at disturbing the fungal cell membrane. These findings indicate that thio-60 holds potential as a novel antifungal agent and presents a promising approach for enhancing the antimicrobial traits of genetically modified Paulownia trees.

New Fusarochromanone Derivatives from the Marine Fungus Fusarium equiseti UBOCC-A-117302.

Two new fusarochromanone derivatives, deacetylfusarochromene (1) and deacetamidofusarochrom-2',3-diene (2), along with the previously reported metabolites fusarochromanone TDP-2 (3), fusarochromene (4), 2,2-dimethyl-5-amino-6-(2'E-ene-4'-hydroxylbutyryl)-4-chromone (5), fusarochromanone (6), (-)-chrysogine (7), and equisetin (8), were isolated from the marine fungus Fusarium equiseti UBOCC-A-117302. The structures of the compounds were determined by extensive spectrometric (HRMS) and spectroscopic (1D and 2D NMR) analyses, as well as specific rotation. Among them, 2 and 5 showed inhibition of three protein kinases with IC50 values ranging from 1.42 to 25.48 µM. Cytotoxicity and antimicrobial activity of all isolated compounds were also evaluated. Six fusarochromanone derivatives (1-6) exhibited diverse activities against three cell lines, RPE-1, HCT-116, and U2OS (IC50 values ranging from 0.058 to 84.380 µM). Equisetin (8) showed bactericidal activities against Bacillus cereus and Listeria monocytogenes (MBC values of 7.8 and 31.25 µM, respectively), and bacteriostatic activity against Enterococcus faecalis (MIC value of 31.25 µM). Compounds 2 and 4 showed bacteriostatic activities against Listeria monocytogenes (MIC of 125 µM).

Complete genome sequence of a novel mitovirus isolated from the fungus Fusarium equiseti causing potato dry rot.

In this study, a novel mitovirus was isolated from the fungus Fusarium equiseti causing potato dry rot and tentatively designated as "Fusarium equiseti mitovirus 1" (FeMV1). The full-length genome sequence of FeMV1 consists of 2,459 nucleotides with a predicted A + U content of 69.5%. Using the mold mitochondrial genetic code, an open reading frame (ORF) of 725 amino acids (aa) was predicted to encode an RNA-dependent RNA polymerase (RdRp). The RdRp protein contains six conserved motifs, with the highly conserved GDD in motif IV, and the 5'-untranslated region (UTR) and 3'-UTR of FeMV1 have the potential to fold into stem-loop secondary structures and a panhandle structure, both of which are typical characteristics of members of the family Mitoviridae. Results of a BLASTp search showed that the RdRp aa sequence of FeMV1 shared the highest sequence similarity with that of Fusarium poae mitovirus 2 (FpMV2) (76.84% identity, E-value = 0.0). Phylogenetic analysis based on the complete aa sequence of RdRp further suggested that FeMV1 is a new member of the family Mitoviridae. This is the first report of the complete genome sequence analysis of a mitovirus associated with F. equiseti.

First Report of Fusarium Sheath Rot of Rice Caused by Fusarium incarnatum-equiseti Species Complex in the United States.

Fungal diseases, including sheath rot (Sarocladium oryzae), cause significant losses of yield and milling quality of rice (Oryza sativa). In August 2021, symptoms like sheath rot were observed on 20% of rice plants (cv. Presidio) in 1-hectare field in Eagle Lake, Texas. Initial lesions occurred on the upper flag leaf sheaths and were oblong or irregular oval, with gray to light brown centers, and a dark reddish-brown diffuse margin. Lesions enlarged, coalesced, and covered a large area of the sheath. Infection led to panicle rot with kernels turning dark brown. Unlike sheath rot, sheath infection also led to inside culm infection with irregular dark brown lesions. Infected tissue pieces were sterilized with 1% NaOCl for 2 min, followed by 75% ethanol for 30 s, washed in sterile H2O three times, air dried and incubated on PDA at 27℃. Fungal isolates were obtained from 15 diseased plant samples and their singled-spored fungal colonies were whitish, loosely floccose and produced light yellow pigmentation. On carnation leaf agar, macroconidia were slightly curved and tapered at the ends, with 3 to 5 septa, and measured 17.5 to 34.3 × 3.1 to 5.0 µm. Microconidia were ovoid, usually with 0 to 1 septum and were 4.0 to 15.5 × 2.5 to 4.5 µm. Spherical shaped chlamydospores were produced in chain. These morphological characteristics were consistent to those described for Fusarium incarnatum-equiseti species complex (O'Donnell et al. 2009), including F. incarnatum (Wang et al. 2021) and F. equiseti (Avila et al. 2019). For molecular identification, DNA of a representative isolate was extracted and ITS, LSU, and EF1 of the fungus were amplified using the primers of ITS1/ITS4 (Wang et al. 2014), D1/D2 domain region of LSU (Fell et al. 2000), and EF1 (Wang et al. 2014), respectively, and sequenced. The ITS sequence (OL344049) was 99.61% identical to F. incarnatum-equiseti species complex (FD_01692) in Fusarium-ID database and 99.61% identical to F. equiseti (LC514690, KY523100, MW016539) and F. incarnatum (MH979697) in NCBI database. The LSU sequence (OK559512) was 98.77% similar to F. equiseti (MN877913, MN368509) and F. incarnatum (MH877332, MH877326); the EF1 sequence (OK570044) was 99.27% similar to F. equiseti (MK278902) in NCBI database. A phylogenetic analysis based on the concatenated nucleotide sequences grouped this isolate in the F. incarnatum-equiseti species complex clade at 100% bootstrap support. To evaluate pathogenicity, a conidial suspension of 1 x 106 conidia/ml or sterilized water (the controls) was injected into the sheaths and young panicles of three rice plants (cv. Presidio) at boot. Treated plants were maintained in a greenhouse at 25 to 30℃. After 3 weeks, typical symptoms, like those observed in the field, developed on the inoculated plants but not on the controls. The same fungus was consistently re-isolated from the diseased plants. To our knowledge, this is the first report of Fusarium sheath rot caused by F. incarnatum-equiseti species complex in rice in the U. S. F. incarnatum-equiseti species complex has been reported to be associated with panicle infection in wild rice (O. latifolia) in Brazil (Tralamazza et al. 2021). F. incarnatum has also been reported to cause panicle rot in China (Wang et al. 2021). F. proliferatum has been reported to cause Fusarium sheath rot in India (Prabhukarthikeyan et al. 2021) and the U. S. (Cartwright et al. 1995). This research demonstrates the potential of different pathogens being involved in causing sheath rot of rice.

First Report of Fusarium equiseti Causing Fusarium Wilt on Potato (Solanum tuberosum) in China.

Potato (Solanum tuberosum) is one of the most economically important crops in China, containing carbohydrates, protein, fiber, numerous vitamins and minerals, and is a heart healthy food (Raidl, 2020). Potato infected by Fusarium spp. exhibits quality and yield decline, and even death. In infected plants, the upper leaves exhibit chlorosis, the lower leaves wither and the vascular bundles of stems and tubers turn yellow, and then tan to brown. In August 2018, symptomatic potato stems and roots were collected from Zhangye city, Gansu province, China. Diseased stem tissues were surface sterilized with 75% alcohol for 30 s, and then rinsed in sterile water. The tissue pieces were placed on potato dextrose agar (PDA) and incubated at 25°C in darkness. Fusarium-like colonies were consistently isolated and three monoconidial isolates were obtained. Isolate 3SMJ-2 was selected as a representative for morphological characterization, molecular analysis, and pathogenicity tests. 3SMJ-2 was inoculated in PDA liquid medium, grown on a shaker for 7 days at 25℃ to obtain a mix suspension of hypha fragments and spores (107 spores/mL). Healthy potato plants, named "Xin Daping" and were planted in pots (17 cm diameter by 12 cm) filled with 2L of sterile soil per pot. After 8 weeks, the plants were inoculated with the inoculum or distilled water. Then they were incubated in growth chambers at 25°C under a 12-h/12-h day/night potato period with 90% relative humidity for 24 h. For each treatment, 3 pots were inoculated. After 50 days, 100% of the inoculated potato plants exhibited wilt symptoms similar to those in the field but the control plants were symptomless. A Fusarium identical to strain 3SMJ-2 was re-isolated from symptomatic potato plants to fulfilling Koch's postulates. Morphological characteristics of the re-isolated strain were identical to the original isolate, which confirmed pathogenicity of strain 3SMJ-2 originally isolated from the potatoes. Colonies of 3SMJ-2 were white with short conidiophores, a few microconidia and sickle-shaped macroconidia (25.2 to 42.9× 3.1 to 4.6 µm) (n = 60) with 4~7 septa, and mostly 5 septa, after cultivated on PDA in an incubator at 25℃ for 14 days. Spherical terminal or intercalary chlamydospores were observed on the mycelium. Strain 3SMJ-2 was identified preliminarily as Fusarium sp. based on morphological characteristics (Leslie et al., 2006). Genomic DNA was extracted from 3SMJ-2 using the OMEGA Fungal DNA kit according to the manufacturer's protocol. The internal transcribed spacer (ITS), translation elongation factor 1-alpha (TEF) and RNA polymerase II second largest subunit (RPB2) were amplified using ITS1/ITS4 (White et al., 1990), Ef728M/Tef1R (Stepien et al., 2012) and 5F2 /7cR (O'Donnell et al., 2007), respectively. After sequencing by Beijing TSINGKE Biological Technology Co., Ltd., 3 fragments of approximately 519 bp, 587 bp and 1059 bp from the strain 3SMJ-2 were deposited in GenBank as MN420681, MW561963 and MW561964. The ITS, TEF and RPB2 sequences were 100%, 100% and 99.8% identical to those of F.equiseti (KY365589, KF499577, and MH582110). Based on the pathogenicity tests, morphological characteristics and molecular analyses, we identified the strain 3SMJ-2 as F. equiseti, the pathogen causing Fusarium wilt on potato in Zhangye City. Although, F. equiseti has been reported to cause root rot of cowpea (Li et al., 2017) and sugar beet (Cao et al., 2018) in China. To our knowledge, this is the first report confirming F. equiseti causing potato wilt in China. Potato is an economically important crop in Gansu and the occurrence of the new disease caused by F. equiseti on potato needs to be properly managed to reduce yield loss.

First Report of Fusarium equiseti, Causing Fruit Rot Disease of Watermelon in Malaysia.

Watermelon (Citrullus lanatus) accounts for almost 13% of all tropical fresh fruit production in Malaysia. They are grown, mostly in Johor, Kedah, Kelantan, Pahang, and Terengganu areas of Malaysia on 10,406 ha and yielding 172,722 Mt. In 2019, a new fruit rot disease was observed in two major production areas in Peninsular Malaysia. Disease symptoms included water-soaked brown lesions on the fruit surface in contact with the soil. The lesions enlarged gradually and ultimately covered the whole fruit with white mycelium leading to internal fruit decay. Disease surveys were conducted in December 2019 and November 2020 in fields at Kuantan, Pahang and Serdang, Selangor. Disease incidence was 10% in 2019 and 15% in 2020. Infected fruits were collected and washed under running tap water to wash off adhering soil and debris. Fruit tissue sections 1 to 2 cm in length were surface sanitized with 0.6% sodium hypochlorite (NaOCl) for 3 min. and washed twice with sterile distilled water. The disinfected air-dried tissues were then transferred onto potato dextrose agar (PDA) media and incubated at 25±2℃ for 3 days. Fungal colonies with whitish mycelium and pink pigment isolated using single spore culture. The pure cultures were placed onto carnation leaf agar (CLA), and the culture plates were incubated at 25±2℃ for 15 days for morphological characterization. On CLA, macroconidia were produced from monophialides on branched conidiophores in orange sporodochia. Macroconindia were thick-walled, strong dorsiventral curvature, 5 to 7 septate with a tapered whip-liked pointed apical cell and characteristic foot-shaped basal cell, 21.9 to 50.98 µm long and 2.3 to 3.60 µm wide. Typical verrucose thick chlamydospores with rough walls were profuse in chains or clumps, sub-globose or ellipsoidal. Based on morphological characteristics they were identified as Fusarium equiseti (Leslie and Summerell 2006). Molecular identification of both U4-1 and N9-1 pure culture isolates were carried out using two primer pair sets; internal transcribed spacer (ITS) ITS-1/ ITS-4 and translation elongation factor 1 alpha (TEF1-α) (EF-1/EF-2). A Blastn analysis of the ITS gene sequence of U4-1(MW362286) and N9-1 (MW362287) showed >99% similarity index to the reference gene sequence of F. equiseti isolate 19MSr-B3-4 (LC514690). The TEF1-α sequences of U4-1 (accession no. MW839563) and N9-1 (accession no. MW839564) showed 100% identity; with an e-value of zero, to the reference gene sequence of F. equiseti isolate URM: 7561 (accession no. LS398490). Each isolate also had a >99% identity with isolate NRRL 34070 (accession no. GQ505642) in Fusarium MLST database that belongs to the F. incarnatum-equiseti species complex (O'Donnell et al. 2015). Based on phylogenetic analysis of the aligned sequences (TEF1-α) by the maximum likelihood method, the U4-1 and N9-1 isolates were confirmed to be F. equiseti as was reported in Georgia, USA (Li and Ji 2015) and in Harbin, Heilongjiang Province, China (Li et al. 2018). Finally, the two pure culture isolates of U4-1 and N9-1 were used to fulfill Koch's postulates. Stab inoculations of five healthy watermelon fruits (cv. 345-F1 hybrid seedless round watermelon) were performed with a microconidial suspension of individual isolates (4x106 spores/mL). Five control fruits were stabbed with double distilled water. The inoculated fruits were incubated under 95% relative humidity at a temperature of 25±2℃ for 48 h followed by additional incubation inside an incubator at 25±2℃ for 8 days. Ten days post-inoculation, the control fruits showed no disease symptoms. However, inoculated fruits exhibited typical symptoms of fruit rot disease like water-soaked brown lesions, white mycelium on the fruit surface and internal fruit decay, which is similar to the farmer's field infected fruits. The suspected pathogen was successfully re-isolated from the symptomatic portion of inoculated fruit and morphologically identified for verification. To our knowledge, this is the first report of F. equiseti causing fruit rot of watermelon in Malaysia. Malaysia exports watermelon year-round to many countries around the world. The outbreak of this new fruit rot disease could potentially pose a concern to watermelon cultivation in Malaysia.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Construction of the PG-deficient mutant of Fusarium equiseti by CRISPR/Cas9 and its pathogenicity of pitaya.

Fusarium is an important plant pathogen and many cell wall-degrading enzymes (CWDEs) are produced in Fusarium-infected plant tissues. To investigate the role of CWDEs in the pathogenicity of pitaya pathogen, we isolated a Fusarium equiseti strain from the diseased pitaya fruit and the activities of CWDEs were determined. The higher polygalacturonase (PG) activity was confirmed both in vitro and vivo. Aiming at the PG gene, the CRISPR/Cas9 system of F. equiseti was constructed and optimized for the first time. Through the process of microhomology-mediated end joining, the flanking region containing 30 bp was used to mediate the homologous recombination of Cas9 double-strand breaks, and the PG gene knockout mutants were obtained by protoplast transformation. Through the phenotypic and pathogenicity experiments of the wild-type strain and mutant strain, the results showed that the colony growth rate and spore production of the strain without the PG gene decreased to some extent, and the lesion diameter and the degree of pericarp cell damage decreased, which showed that the CRISPR/Cas9 system could be used in F. equiseti and PG enzyme and can play a significant role in the interaction between F. equiseti and pitaya fruit.

First Report of Fusarium Wilt Caused by Fusarium equiseti on Cabbage (Brassica oleracea var. capitate L.) in Korea.

Cabbage (Brassica oleracea var. capitate L.) is an important vegetable crop that is widely cultivated throughout the world. In August 2019, wilting symptoms on cabbage (stunted growth, withered leaves, and wilted plants) were observed in a cabbage field of Pyeongchang, Gangwon Province, with an incidence of 5 to 10%. To identify the cause, symptomatic root tissue was excised, surface-sterilized with 70% ethanol, and rinsed thrice with sterile distilled water. The samples were dried on blotter paper, placed onto potato dextrose agar (PDA), and incubated at 25°C for 1 week. Five morphologically similar fungal isolates were sub-cultured and purified using the single spore isolation method (Choi et al. 1999). The fungus produced colonies with abundant, loosely floccose, whitish-brown aerial mycelia and pale-orange pigmentation on PDA. Macroconidia had four 4 to six 6 septa, a foot-shaped basal cell, an elongated apical cell, and a size of 20.2 to 31.8 × 2.2 to 4.1 µm (n = 30). No microconidia were observed. Chlamydospores were produced from hyphae and were most often intercalary, in pairs or solitary, globose, and frequently formed chains (6.2? to 11.7 µm, n = 10). Based on these morphological characteristics, the fungus was identified as Fusarium equiseti (Leslie and Summerell 2006). A representative isolate was deposited in the Korean Agricultural Culture Collection (KACC48935). For molecular characterization, portions of the translation elongation factor 1-alpha (TEF-1α) and second largest subunit of RNA polymerase II (RPB2) genes were amplified from the representative isolate using the primers pair of TEF-1α (O'Donnell et al. 2000) and GQ505815 (Fusarium MLST database), and sequenced. Searched BLASTn of the RPB2 sequence (MT576587) to the Fusarium MLST database showed 99.94% similarity to the F. incarnatum-equiseti species complex (GQ505850) and 98.85 % identity to both F. equiseti (GQ505599) and F. equiseti (GQ505772). Further, the TEF-1α sequence (MT084815) showed 100% identity to F. equiseti (KT224215) and 99.85% identity to F. equiseti (GQ505599), respectively. Therefore, the fungus was identified as F. equiseti based on morphological and molecular identification. For pathogenicity testing, a conidial suspension (1 × 106 conidia/ml) was prepared by harvesting macroconidia from 2-week-old cultures on PDA. Fifteen 4-week-old cabbage seedlings (cv. 12-Aadrika) were inoculated by dipping roots into the conidial suspension for 30 min. The inoculated plants were transplanted into a 50-hole plastic tray containing sterilized soil and maintained in a growth chamber at 25°C, with a relative humidity of >80%, and a 12-h/12-h light/dark cycle. After 4 days, the first wilt symptoms were observed on inoculated seedlings, and the infected plants eventually died within 1 to 2 weeks after inoculation. No symptoms were observed in plants inoculated with sterilized distilled water. The fungus was re-isolated from symptomatic tissues of inoculated plants and its colony and spore morphology were identical to those of the original isolate, thus confirming Koch's postulates. Fusarium wilt caused by F. equiseti has been reported in various crops, such as cauliflower in China, cumin in India, and Vitis vinifera in Spain (Farr and Rossman 2020). To our knowledge, this is the first report of F. equiseti causing Fusarium wilt on cabbage in Korea. It This disease poses a threat to cabbage production in Korea, and effective disease management strategies need to be developed.

First report of stem and root rot of coriander caused by Fusarium equiseti in China.

Coriander (Coriandrum sativum L.) is one of the most important vegetables used as a seasoning in China. During the summer of 2019 and 2020, two-month-old coriander plants with stem and root rot were observed in commercial fields located in Tianjin, China. Symptoms were first observed when temperatures were about 24°C. Diseased plants had chlorotic lower leaves, were stunted, had rotted roots and stems, and eventually wilted and died (Fig. S1). In severe cases, disease incidence was approximately 85%. Plant samples with the same symptoms were collected from five fields by five-point sampling method (4 plants/point; 20 plants/field), out of which twenty plants were arbitrarily selected for pathogen isolation. Root tissue fragments (3 mm2; 3 fragements/plant) at the boundary of the symptomatic area were excised, washed in 1% NaClO for 2 min, rinsed in sterile distilled water (SDW), and incubated on PDA containing 50 mg/liter of streptomycin sulfate. Plates were incubated at 25°C for 5 days in the dark. 25% of the isolates were tentatively identified as Fusarium equiseti according to cultural and morphological characteristics (Leslie and Summerell, 2006). Colonies developed abundant white aerial mycelium with pale brown pigments on PDA. Microconidia were single-celled, hyaline, non-septate and ovoid, and ranged from 4.6 to 17.6 × 1.5 to 3.8 µm (n = 40). Macroconidia were mostly five-septate, slightly curved at apex, and ranged from 13.3 to 34.6 × 2.2 to 4.3 µm (n = 40). Chlamydospores with thick, roughened walls were abundant in clumps or chains, ellipsoidal or subglobose. Diseased-plant samples and pathogen isolates were deposited to China General Microbiological Culuture Collection Center (CGMCC). Species identity was confirmed by amplifying and sequencing the ITS, TEF1-α, mtSSU and RPB2 (Carbone and Kohn 1999; Li et al. 1994; Miller and Huhndorf 2005). BLASTn analyses of ITS amplicon (Genbank No. MT579854), TEF1-α (MT586131), mtSSU (MT587798) and RPB2 (MT648497) genes obtained with cognate sequences available in GenBank showed 99.8% (498 bp out of 499 bp), 100% (493 bp out of 493 bp), 99.7% (625 bp out of 627 bp) and 98.9% (656 bp out of 663 bp) identity to F. equiseti (LS479418 [ITS], KU939020 [TEF1-α], MF667972 [mtSSU] and MG839490 [RPB2]) in NCBI databases, respectively. Pathogenicity tests were conducted with each F. equiseti isolate. Plants were grown in sterilized 10-cm diameter plastic pots containing steamed peat substrate, and three replicated pots (five plants/pot) were included in each treatment. Fifteen-day-old coriander plants were inoculated with 5 mL of 1×106 conidia/mL suspension by root-drenching method. Control plants were inoculated with SDW. Each treatment was incubated in a greenhouse at 29/22°C (12h/12h, light/dark), and watered every other day to keep high humidity. After 4 days, symptoms similar to those observed in the field were observed on inoculated plants (Fig. S2), whereas control plants remained symptomless. Reisolation of F. equiseti from inoculated plants fulfilled Koch's postulates, and identification was confirmed by morphological and molecular methods. To our knowledge, this is the first report of F. equiseti causing coriander stem and root rot in China. This pathogen poses a threat to coriander production, and its accurate identification is necessary to develop effective management strategies.

Anti-Phytopathogenic and Cytotoxic Activities of Crude Extracts and Secondary Metabolites of Marine-Derived Fungi.

Thirty-one isolates belonging to eight genera in seven orders were identified from 141 strains that were isolated from several marine plants. Alternaria sp. and Fusarium sp. were found to be the predominant fungi. Evaluation of the anti-phytopathogenic bacterial and fungal activities, as well as the cytotoxicity of these 31 extracts, revealed that most of them displayed different levels of bioactivities. Due to their interesting bioactivities, two fungal strains-Fusarium equiseti (P18) and Alternaria sp. (P8)-were selected for chemical investigation and compounds 1-4 were obtained. The structure of 1 was elucidated by 1D and 2D NMR analysis, as well as high-resolution electrospray ionization mass spectroscopy (HRESIMS), and the absolute configuration of its stereogenic carbon (C-11) was established by comparison of the experimental and calculated electronic circular-dichroism (ECD) spectra. Moreover, alterperylenol (4) exhibited antibacterial activity against Clavibacter michiganensis with a minimum inhibitory concentration (MIC) of 1.95 µg/mL, which was 2-fold stronger than that of streptomycin sulfate. Additionally, an antibacterial mechanism study revealed that 4 caused membrane hyperpolarization without evidence of destruction of cell membrane integrity. Furthermore, stemphyperylenol (3) displayed potent antifungal activity against Pestallozzia theae and Alternaria brassicicola with MIC values equal to those of carbendazim. The cytotoxicity of 1 and 2 against human lung carcinoma (A-549), human cervical carcinoma (HeLa), and human hepatoma (HepG2) cell lines were also evaluated.

Different Culture Metabolites of the Red Sea Fungus Fusarium equiseti Optimize the Inhibition of Hepatitis C Virus NS3/4A Protease (HCV PR).

The endophytic fungus Fusarium equiseti was isolated from the brown alga Padina pavonica, collected from the Red Sea. The fungus was identified by its morphology and 18S rDNA. Cultivation of this fungal strain in biomalt-peptone medium led to isolation of 12 known metabolites of diketopeprazines and anthraquinones. The organic extract and isolated compounds were screened for their inhibition of hepatitis C virus NS3/4A protease (HCV PR). As a result, the fungal metabolites showed inhibition of HCV protease (IC50 from 19 to 77 µM), and the fungus was subjected to culture on Czapek's (Cz) media, with a yield of nine metabolites with potent HCV protease inhibition ranging from IC50 10 to 37 µM. The Cz culture extract exhibited high-level inhibition of HCV protease (IC50 27.6 µg/mL) compared to the biomalt culture extract (IC50 56 µg/mL), and the most potent HCV PR isolated compound (Griseoxanthone C, IC50 19.8 µM) from the bio-malt culture extract showed less of an inhibitory effect compared to isolated ω-hydroxyemodin (IC50 10.7 µM) from the optimized Cz culture extract. Both HCV PR active inhibitors ω-hydroxyemodin and griseoxanthone C were considered as the lowest selective safe constituents against Trypsin inhibitory effect with IC50 48.5 and 51.3 µM, respectively.

A fungal P450 enzyme from Fusarium equiseti HG18 with 7ß-hydroxylase activity in biosynthesis of ursodeoxycholic acid.

Cytochrome P450 enzyme with 7ß-hydroxylation capacity has attracted widespread attentions due to the vital roles in the biosynthesis of ursodeoxycholic acid (UDCA), a naturally active molecule for the treatment of liver and gallbladder diseases. In this study, a novel P450 hydroxylase (P450FE) was screen out from Fusarium equiseti HG18 and identified by a combination of genome and transcriptome sequencing, as well as heterologous expression in Pichia pastoris. The biotransformation of lithocholic acid (LCA) by whole cells of recombinant Pichia pastoris further confirmed the C7ß-hydroxylation with 5.2% UDCA yield. It was firstly identified a fungal P450 enzyme from Fusarium equiseti HG18 with the capacity to catalyze the LCA oxidation producing UDCA. The integration of homology modeling and molecular docking discovered the substrate binding to active pockets, and the key amino acids in active center were validated by site-directed mutagenesis, and revealed that Q112, V362 and L363 were the pivotal residues of P450FE in regulating the activity and selectivity of 7ß-hydroxylation. Specifically, V362I mutation exhibited 2.6-fold higher levels of UDCA and higher stereospecificity than wild-type P450FE. This advance provided guidance for improving the catalytic efficiency and selectivity of P450FE in LCA hydroxylation, indicative of the great potential in green synthesis of UDCA from biologically toxic LCA.

Biocontrol of Fusarium equiseti using chitosan nanoparticles combined with Trichoderma longibrachiatum and Penicillium polonicum.

A safe and ecofriendly biocontrol of pathogenic Fusarium equiseti was developed based on chitosan nanoparticles (CNPs) combined with Trichoderma longibrachiatum and Penicillium polonicum. Two strains of F. equiseti which were isolated from wilting tomato plant as well as three antagonistic fungi including Trichoderma longibrachiatum and two strains of Penicillium polonicum were isolated from the surrounding soil. All the isolated pathogenic and antagonistic fungi were identified using genomic DNA sequences. The antifungal activity of the three antagonistic fungi were studied against the two strains of F. equiseti. Also, CNPs which were prepared according to the ionic gelation method using sodium tripolyphosphate anions in acetic acid solution were used to enhance the antifungal activity of the three antagonistic fungi. The results exhibit that, combination of T. longibrachiatum with CNPs and P. polonicum with CNPs achieve high antifungal activity against F. equiseti by an inhibition rate equal to 71.05% and 66.7%, respectively.

Optimization of Submerged Culture Parameters of the Aphid Pathogenic Fungus Fusarium equiseti Based on Sporulation and Mycelial Biomass.

Fusarium equiseti (JMF-01), as an entomopathogenic fungus, can effectively control agricultural pests and has the potential to be a biocontrol agent. To promote mycelial growth and sporulation, we investigated the optimal submerged culture conditions for F. equiseti. In this study, we used the single-factor method and Box-Behnken design and determined the virulence of the submerged culture against Myzus persicae after optimization. As a result, the highly significant factors affecting the spore concentration of strain JMF-01 were the primary inoculum density and the initial pH, and the highly significant factor affecting the mycelial biomass was the medium-to-flask ratio. The highest mycelial biomass value was 0.35 g when the incubation time was 5.68 days, the initial pH was 5.11, the medium-to-flask ratio was 0.43, and 1 mL of the primary inoculum with spore density of 0.97 × 107 conidia/mL was added. When the incubation time was 6.32 days, the initial pH was 4.46, the medium-to-flask ratio was 0.35, the primary inoculum density was 1.32 × 107 conidia/mL of 1 mL, and the highest spore concentration of 6.49 × 108 blastospores/mL was obtained. Compared with the unoptimized medium conditions, the optimized submerged culture had the highest mycelial biomass and spore concentration, which were 3.46 and 2.06 times higher, respectively. The optimized submerged culture was highly pathogenic toward M. persicae, reaching a 95% mortality rate. Our results provide optimal submerged culture conditions for F. equiseti and lay the basis for later research to expand production for pest control.

Benzimidazole Derivatives Suppress Fusarium Wilt Disease via Interaction with ERG6 of Fusarium equiseti and Activation of the Antioxidant Defense System of Pepper Plants.

Sweet pepper (Capsicum annuum L.), also known as bell pepper, is one of the most widely grown vegetable crops worldwide. It is attacked by numerous phytopathogenic fungi, such as Fusarium equiseti, the causal agent of Fusarium wilt disease. In the current study, we proposed two benzimidazole derivatives, including 2-(2-hydroxyphenyl)-1-H benzimidazole (HPBI) and its aluminum complex (Al-HPBI complex), as potential control alternatives to F. equiseti. Our findings showed that both compounds demonstrated dose-dependent antifungal activity against F. equiseti in vitro and significantly suppressed disease development in pepper plants under greenhouse conditions. According to in silico analysis, the F. equiseti genome possesses a predicted Sterol 24-C-methyltransferase (FeEGR6) protein that shares a high degree of homology with EGR6 from F. oxysporum (FoEGR6). It is worth mentioning that molecular docking analysis confirmed that both compounds can interact with FeEGR6 from F. equiseti as well as FoEGR6 from F. oxysporum. Moreover, root application of HPBI and its aluminum complex significantly enhanced the enzymatic activities of guaiacol-dependent peroxidases (POX), polyphenol oxidase (PPO), and upregulated four antioxidant-related enzymes, including superoxide dismutase [Cu-Zn] (CaSOD-Cu), L-ascorbate peroxidase 1, cytosolic (CaAPX), glutathione reductase, chloroplastic (CaGR), and monodehydroascorbate reductase (CaMDHAR). Additionally, both benzimidazole derivatives induced the accumulation of total soluble phenolics and total soluble flavonoids. Collectively, these findings suggest that the application of HPBI and Al-HPBI complex induce both enzymatic and nonenzymatic antioxidant defense machinery.

Fusarium equiseti-inoculation altered rhizosphere soil microbial community, potentially driving perennial ryegrass growth and salt tolerance.

Fusarium equiseti is an effective plant growth-promoting fungi that induce systemic disease resistance in plants. However, the role of F. equiseti in regulating salt stress response and the underlying mechanisms remain largely unknown. Here, we investigated the effect of F. equiseti Z7 strain on the growth and salt stress response in perennial ryegrass. Additionally, the role of Z7 in regulating the abundance, composition, and structure of native microbial communities in the rhizosphere soil was determined. We observed that Z7 could produce indole-3-acetic acid (IAA) and siderophores. Hence, Z7 inoculation further enhanced plant growth and salt tolerance in perennial ryegrass. Inoculating Z7 increased K+ and decreased Na+ in plant tissues. Z7 inoculation also enhanced soil quality by reducing soluble salt and increasing available phosphorus. Moreover, inoculating Z7 altered the compositions of bacterial and fungal communities in the rhizosphere soil. For instance, beneficial bacterial genera, such as Flavobacterium, Enterobacter, Agrobacterium, and Burkholderiales were dominantly enriched in Z7-inoculated soil. Interestingly, the relative abundance of these genera showed significantly positive correlations with the fresh weight of perennial ryegrass. Our results demonstrate that Z7 could remarkably promote plant growth and salt tolerance by regulating ion homeostasis in plant tissues and microbial communities in the rhizosphere soil. This study provides a scientific foundation for applying microbes to improve plant growth under extreme salt stress conditions.

Indole alkaloids fusarindoles A-E from marine-derived fungus Fusarium equiseti LJ-1.

Five undescribed indole alkaloids, fusarindoles A-E, together with seven known compounds were obtained from the marine-derived fungus Fusarium equiseti LJ-1. Their chemical structures and absolute configurations were determined by comprehensive analysis of the NMR, HRMS, UV, IR, ECD calculation and single-crystal X-ray diffraction data. The possible biosynthetic pathways of fusarindoles C-E were proposed. The cytotoxicities of eleven compounds, including fusarindoles A-E and six known compounds, against five human cancer cell lines A549, CNE2, SUNE1, HepG2 and QGY7701 were evaluated.

Activity of Aqueous Extracts from Native Plants of the Yucatan Peninsula against Fungal Pathogens of Tomato In Vitro and from Croton chichenensis against Corynespora cassiicola on Tomato.

Plant extracts are a valuable alternative to control pathogens of horticultural crops. In the present study, four species of pathogenic fungi were isolated from leaf spots on Solanum lycopersicum and identified by traditional and molecular techniques as Alternaria alternata ITC24, Corynespora cassiicola ITC23, Curvularia lunata ITC22, and Fusarium equiseti ITC32. When 11 aqueous extracts from eight native plants of the Yucatan Peninsula were tested against the four fungi in vitro, the extract from Croton chichenensis roots was most active, inhibiting mycelial growth (79-100%), sporulation (100%), and conidial germination (71-100%) at 3% (w/v). A logarithmic-diagrammatic scale of the pathosystem C. cassiicola-S. lycopersicum was established and used to assess disease severity on inoculated tomato plants in a greenhouse after treatment with the aqueous extract from C. chichenensis roots at 12% (w/v). After 21 days, the disease severity was 57% lower than on the control without extract applied. This dose of the extract was not phytotoxic to tomato leaves and was compatible with the beneficial organisms Bacillus subtilis CBCK47 and Trichodema asperellum Ta13-17. The antifungal efficacy of C. chichenensis is highly promising for incorporation into integrated disease management of tomato crops.

Decalintetracids A and B, two pairs of unusual 3-decalinoyltetramic acid derivatives with phytotoxicity from Fusarium equiseti D39.

The filamentous fungi Fusarium sp. are well-known for their ability to produce abundant specialised metabolites with attractive chemical structures and bioactivities. In this study, chemical analyses of the endophyte F. equiseti D39 led to the isolation and identification of two pairs of undescribed 3-decalinoyltetramic acids (3DTAs) E/Z diastereomers, decalintetracids A and B. Their structures were elucidated by comprehensive spectroscopic analysis and quantum-chemical calculations. Although 3DTAs were commonly reported from fungi, decalintetracid A possessed an unprecedented tricyclo [7.2.1.02,7] dodecane skeleton, which added the diversity of these fungal metabolites. In addition, decalintetracid B was featured by a unique 6/6/5 ring system core. A plausible biosynthetic pathway for decalintetracids A and B was proposed. Both compounds exhibited phytotoxicity toward Amaranthus retroflexus L. and Amaranthus hybrid, indicating their potential as natural herbicides.