Genotypic and phenotypic features of 39 Chinese patients with glycogen storage diseases type I, VI, and IX.

Glycogen storage diseases (GSDs) are abnormally inherited glycogen metabolism mainly affecting the liver, muscles, and heart. Deficiency of proteins involved in glycogen metabolism caused by genetic mutations are responsible for different subtype of GSDs. However, there are still some challenges in diagnosing GSD. This study includes 39 suspected GSDs patients from unrelated families in China. Next-generation sequencing (NGS) was used to investigate the reason for their diseases at the genetic level. Finally, all 39 patients were diagnosed with GSDs, including 20 GSD-Ia, 4 GSD-VI, and 15 GSD IX (12 GSD-IXa patients and 3 GSD-IXb patients). Thirty-two mutations in G6PC1, PYGL, PHKA2, and PHKB genes were identified, with 14 of them being novel variants. The pathogenicity of novel variants was classified according to ACMG guildlines and predicted by in slico algorithms. Mutations p.L216L and p.R83H in G6PC1 gene may be the hot spot mutation in Chinese. Hearing impairment is a rare clinical feature of GSD Ia, which has also been observed in our cohort. The severity of GSD VI and IX was indicated by our patients. Close follow-up should be applied to GSD VI and IX patients. Our findings provided evidence for building the phenotype-genotype of GSDs and expanded the mutation spectrum of related genes.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Extending and outlining the genotypic and phenotypic spectrum of novel mutations of NALCN gene in IHPRF1 syndrome: identifying recurrent urinary tract infection.

Infantile hypotonia with psychomotor retardation and characteristic facies 1 (IHPRF1) is caused by biallelic mutations in the NALCN gene, the major ion channel responsible for the background Na + conduction in neurons. Through whole-exome sequencing (WES), we report three novel homozygous variants in three families, including c.1434 + 1G > A, c.3269G > A, and c.2648G > T, which are confirmed and segregated by Sanger sequencing. Consequently, intron 12's highly conserved splice donor location is disrupted by the pathogenic c.1434 + 1G > A variation, most likely causing the protein to degrade through nonsense-mediated decay (NMD). Subsequently, a premature stop codon is thus generated at amino acid 1090 of the protein as a result of the pathogenic c.3269G > A; p.W1090* variation, resulting in NMD or truncated protein production. Lastly, the missense mutation c.2648G > T; p.G883V can play a critical role in the interplay of functional domains. This study introduces recurrent urinary tract infections for the first time, broadening the phenotypic range of IHPRF1 syndrome in addition to the genotypic spectrum. This trait may result from insufficient bladder emptying, which may be related to the NALCN channelosome's function in background Na + conduction. This work advances knowledge about the molecular genetic underpinnings of IHPRF1 and introduces a novel phenotype through the widespread use of whole exome sequencing.

A novel homozygous CYP17A1 mutation causes partial 17 α-hydroxylase/17,20-lyase deficiency in 46,XX: a case report and literature review.

Aim: 17 α-hydroxylase/17,20-lyase deficiency (17-OHD) is an extremely rare autosomal recessive disorder that typically causes hypertension, hypokalaemia, primary amenorrhoea, and the absence of secondary sex characteristics in 46,XX individuals. Partial 17-OHD is even rarer than complete 17-OHD and is prone to missed diagnosis due to its subtler symptoms. The aim of this study was to help early detection and diagnosis of partial 17-OHD.Methods: We present a case of a 41-year-old female (46,XX) patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P). This patient experienced hypertension, hypokalaemia and adrenal hyperplasia, but did not present with primary amenorrhoea or absence of secondary sex characteristics. Initially, she was misdiagnosed and underwent right and left adrenalectomy, but the procedures were ineffective. Afterward, she received a one-month treatment of 0.5 mg dexamethasone, which greatly relieved her symptoms. Additionally, we reviewed reports of thirteen other patients with partial 17-OHD in 46,XX individuals from the literature, totalling fourteen probands.Results: We found that primary amenorrhoea, hypertension, hypokalaemia, and ovarian cysts accounted for 15.4%, 42.9%, 38.5%, and 72.7% of these patients, respectively. In contrast, elevated serum progesterone was present in all patients.Conclusion: Based on our literature review, the absence of primary amenorrhoea, hypertension or hypokalaemia cannot rule out suspicion for 17-OHD in 46,XX individuals. However, an elevation in serum progesterone levels is a highly sensitive indicator for diagnosing 17-OHD.

What is the context?17-OHD is a rare cause of secondary hypertension, often with hypokalaemia, primary amenorrhoea and absence of secondary sex characteristics.Partial 17-OHD is an even rarer subtype of 17-OHD, with subtler symptoms.There are few reports concerning partial 17-OHD, especially in 46,XX patients.What is new?We reported a case of a 46,XX patient with partial 17-OHD caused by a novel missense CYP17A1 mutation, c.391 A > C (p.T131P).We also conducted a literature review to summarise the clinical, hormonal and genetic characteristics of fourteen 46,XX probands with partial 17-OHD.From the literature review, we found that:Most 46,XX patients with partial 17-OHD presented with partial pubic hair, breast development, oligomenorrhea or secondary amenorrhoea, normotension, and/or normokalemia.All 46,XX patients with partial 17-OHD presented with elevated serum progesterone.However, the relationship between in vitro enzyme activities of the 17-hydroxylase and/or17,20-lyase and clinical severity is still unclear.What is the impact?The current study can help early detection and diagnosis of partial 17-OHD.

Novel Variant IMPDH1 c.134A>G, p.(Tyr45Cys): Phenotype-Genotype Correlation Revealed Likely Benign Clinical Significance.

Pathogenic variants in IMPDH1 are associated with autosomal dominant retinitis pigmentosa 10 (RP10), and Leber congenital amaurosis 11. This case report of a 13-year-old girl with Down's syndrome and keratoglobus is aimed at linking the novel variant IMPDH1 c.134A>G, p.(Tyr45Cys), a variant of uncertain significance, to a clinical phenotype and to provide grounds for the objective assignment of its benign features. RP10 is characterized by the early onset and rapid progression of ocular symptoms, beginning with nyctalopia in childhood, accompanied by typical RP fundus changes. As evidenced via thorough clinical examination and testing, none of the RP10 characteristics were present in our patient. On the contrary, our patient who was heterozygous for IMPDH1 c.134A>G, p.(Tyr45Cys) showed no signs of peripheral retinal dystrophy, and did not manifest any disease characteristics typical of the IMPDH1 gene mutation. Consequently, we conclude that the variant did not contribute to the phenotype. According to standards and guidelines for the interpretation of sequence variants, IMPDH1 c.134A>G, p.(Tyr45Cys) revealed likely benign features.

Modopathies Caused by Mutations in Genes Encoding for Mitochondrial RNA Modifying Enzymes: Molecular Mechanisms and Yeast Disease Models.

In eukaryotes, mitochondrial RNAs (mt-tRNAs and mt-rRNAs) are subject to specific nucleotide modifications, which are critical for distinct functions linked to the synthesis of mitochondrial proteins encoded by mitochondrial genes, and thus for oxidative phosphorylation. In recent years, mutations in genes encoding for mt-RNAs modifying enzymes have been identified as being causative of primary mitochondrial diseases, which have been called modopathies. These latter pathologies can be caused by mutations in genes involved in the modification either of tRNAs or of rRNAs, resulting in the absence of/decrease in a specific nucleotide modification and thus on the impairment of the efficiency or the accuracy of the mitochondrial protein synthesis. Most of these mutations are sporadic or private, thus it is fundamental that their pathogenicity is confirmed through the use of a model system. This review will focus on the activity of genes that, when mutated, are associated with modopathies, on the molecular mechanisms through which the enzymes introduce the nucleotide modifications, on the pathological phenotypes associated with mutations in these genes and on the contribution of the yeast Saccharomyces cerevisiae to confirming the pathogenicity of novel mutations and, in some cases, for defining the molecular defects.

Identification of h-TERT Promoter Mutations in Germline DNA from North Indian Lung Carcinoma Patients.

Lung cancer is a severe and the leading cause of cancer related deaths worldwide. The recurrent h-TERT promoter mutations have been implicated in various cancer types. Thus, the present study is extended to analyze h-TERT promoter mutations from the North Indian lung carcinoma patients. Total 20 histopathologically and clinically confirmed cases of lung cancer were enrolled in this study. The genomic DNA was extracted from venous blood and subjected to amplification using appropriate h-TERT promoter primers. Amplified PCR products were subjected for DNA Sanger sequencing for the identification of novel h-TERT mutations. Further, these identified h-TERT promoter mutations were analysed for the prediction of pathophysiological consequences using bioinformatics tools such as Tfsitescan and CIIDER. The average age of patients was 45 ± 8 years which was categorized in early onset of lung cancer with predominance of male patients by 5.6 fold. Interestingly, h-TERT promoter mutations were observed highly frequent in lung cancer. Identified mutations include c. G272A, c. T122A, c. C150A, c. 123 del C, c. C123T, c. G105A, c. 107 Ins A, c. 276 del C corresponding to -168 G>A, -18 T>A, -46 C>A, -19 del C, -19 C>T, -1 G>A, -3 Ins A, -172 del C respectively from the translation start site in the promoter of the telomerase reverse transcriptase gene which are the first time reported in germline genome from lung cancer. Strikingly, c. -18 T>A [C.T122A] was found the most prevalent variant with 75% frequency. Notwithstanding, other mutations viz c. -G168A [c. G272A] and c. -1 G>A [c. G105A] were found to be at 35% and 15% frequency respectively whilst the rest of the mutations were present at 10% and 5% frequency. Additionally, bioinformatics analysis revealed that these mutations can lead to either loss or gain of various transcription factor binding sites in the h-TERT promoter region. Henceforth, these mutations may play a pivotal role in h-TERT gene expression. Taken together, these identified novel promoter mutations may alter the epigenetics and subsequently various transcription factor binding sites which are of great functional significance. Thereby, it is plausible that these germline mutations may involve either as predisposing factor or direct participation in the pathophysiology of lung cancer through entangled molecular mechanisms.

Atypical Case of Highly Mutated h-TERT Promoter in Germline Genome from Buccal Mucosa Cancer.

Buccal mucosa cancer has an aggressive nature as it rapidly grows and penetrates with high recurrence rate. Strikingly, carcinoma of buccal mucosa is the most common cancer of oral cavity in India. Recently, telomerase and telomere biology have been implicated in the pathogenesis and progression in various cancers via regulation of telomere maintenance by telomerase expression which is controlled by telomerase reverse transcriptase (TERT) promoter. Strikingly, h-TERT promoter mutations have been incriminated in regulation of telomerase gene expression. Here, we present a 35 years old male with intense coughing, short breathlessness and fever since 15 days, was admitted to the pulmonary unit. He was a chronic smoker and gutka user. The cytopathological analysis of gastric aspirate revealed buccal mucosa carcinoma of IV stage. We identified h-TERT promoter mutations in isolated genomic DNA from whole blood using DNA sequencer. Genetic analysis disclosed that h-TERT promoter region was highly mutated in this patient. Identified mutations include C.-248 del G, C.-272 del G, C.-279 del G, C.-331 del G, C.-349 del G, C.-351 del C, C.-360 G > A, C.-362 T > A, C.-371 del T and C.-372 del T. Further, all identified mutations were subjected to predict the pathologic functional consequences using bioinformatics tools viz TFsitescan and CiiiDER which showed either loss or gain of transcription factors binding sites in h-TERT promoter. This is a unique case in which total 9 mutations were observed in h-TERT promoter in a single case. In conclusion, all together these mutations in h-TERT promoter may alter the epigenetics and subsequently the tenacity of binding transcription factors which are of functional significance.

Neurological comorbidities and novel mutations in Turkish cases with neurofibromatosis type 1.

Background and purpose:

Neuro­fibromatosis type 1 (NF1) is a rare, auto­somal dominant multisystemic disease. The NF1 gene is localized on chromosome 17q11.2. Patients with NF1 have different clinical presentations and comorbidities. The aim of the present study is to determine the novel mutations and neurological comorbidities of NF1.

Patients who were diagnosed with NF1 by clinical criteria of the National Institutes of Health were included in the study. After a detailed examination, the NF1 gene was analysed with the help of next generation sequencing technology from pe­ripheral blood samples via MiSeq (Illu­mina, USA). Bioinformatic analyzes were per­for­med to evaluate the clinical sig­ni­fi­cance of the detected variants via the in­ternational databanks in accordance with the ACMG (American College of Medical Ge­netics) guide­line. In addition, cerebral-spinal MRI, cerebral angiography, and ENMG exa­mi­na­tions were performed if deemed necessary.

Twenty patients (12 female, 8 male) were included in the study. The mean age was 25.8±10 (10-56) years. Previously defined 13 different pathogenic mutations according to the ACMG criteria were identified in 18 patients. Also, two novel mutations were detected in 2 cases. Moreover, neurological comorbidities (moyamoya disease, multiple sclerosis, Charcot Marie Tooth Type 1A) were found in 3 patients with NF1.

In the present study two novel mutations and three different neurological comorbidities were identified in NF1.

Gene analysis and clinical features of 22 GNE myopathy patients.

INTRODUCTION: GNE myopathy is an autosomal recessive distal myopathy caused by a biallelic mutation in UDP-N-acetylglucosamine 2-epomerase/N-acetylmannosamine kinase. In this study, we discuss the clinical features, pathological characteristics, genetic profiles, and atypical clinical manifestations of 22 Chinese GNE patients. MATERIALS AND METHODS: Retrospective analysis was performed for GNE myopathy patients at our institute between 2005 and 2021. Histopathological analysis and gene testing were done according to standard protocols. RESULTS: Molecular analysis revealed 14-reported and 7 novel mutations, including c.125G > A (p.P42Q), c.226G > A (p.V76I), c.970C > G (p.H324D), c.155A > G (p.D52G), c.1055G > A (p.R352H), c.1064G > A (p.G355E), and c.491 T > C (p.I164T) in GNE. D207V was the most frequent mutation showing an allele frequency of 25%. A total of 21 patients presented classic clinical manifestation, and only 1 patient had signs of proximal muscle weakness. A patient containing p.V603L and p.R160X mutations showed idiopathic thrombocytopenia and distal weakness. There were 4 female patients who experienced rapid deterioration after pregnancy. DISCUSSION: Our study revealed 7 novel mutations in GNE, where p.D207V was shown as a potential hotspot mutation in Chinese patients. Idiopathic thrombocytopenia should be a concern in GNE myopathy patients. Twenty-seven percent of female patients experienced rapid deterioration during pregnancy or after delivery.

Variant analysis of the first Lebanese SARS-CoV-2 isolates.

Recently the first genome sequences for 11 SARS-CoV-2 isolates from Lebanon became available. Here, we report the detection of variants within the genome of these strains. Pairwise alignment analysis using blastx was performed between these sequences and the UniProtKB data for the SARS-CoV-2 coronavirus to identify amino acid variations. Variants analysis was performed using multiple Bioinformatics tools. We noticed for the first time 18 mutations that have never been reported before. Among those, a frame shift (8651A>) in NSP4, a stop codon 6887A > T in NSP3 and two missense mutations in spike S2 were found. In addition, we found 28 variants in ORF1ab alone. A previously reported variant, 23403A > G, in the spike protein S2 was mostly seen. Two other known mutations 25563G > T in ORF3a and 14408C > T in ORF1ab were detected respectively in 6 and 8 out of the 11 isolates. Our results may help to prognose forthcoming infections in this region.

Subgenomic sequence analysis reveals emergence of new circulating recombinant forms of HIV-1 in Pakistan.

Background and Objective: Pakistan has witnessed a dramatic change in the increasing prevalence and emergence of HIV subtypes for more than two decades. Pakistani population is increasingly engaged in high-risk practices, and the prescribed drugs are potentially causing resistance. There are chances that these resistant strains are beginning to circulate from high-risk to the general population. Methods: The study was conducted at the section of Molecular Pathology Lab of Dow Diagnostic and Research Laboratory, Dow University of Health Sciences (DUHS) Karachi. In this study, we analyzed gene sequences of HIV for drug resistance and molecular epidemiology., along with amino acid sequence variability. Furthermore, we undertook phylogenetic analysis for possible geographic linkages of Pakistani HIV strains. Results: Our results demonstrate that A1 is the leading HIV subtype circulating in the country, whereas other emerging subtypes and recombinant forms, including subtype B, CRF02_AG, CRF10_CD CRF35_AD, and CRF11_cpx were also observed. Our sequences cluster with the Middle East, African, and a few European sequences according to geographical distribution. These sequences showed high-level resistance per drug resistance pattern, with 62.5% of patients exhibiting resistance to NNRTI drugs and 60% mutation at E138A and K103N, respectively, against NNRTI drugs. About 75% sequences showed resistance mutation at M184V against NRTI drugs. The antiretroviral drugs are now causing H-LR to the patients with no effect. Our results also revealed that certain regions of RT exhibited high sequence variability, especially at Amino Acids positions p.119, p.130, p.157, p.164. Conclusion: We hereby report major novel mutations and several minor mutations that may have a drastic change in the drug resistance pattern.

Clinical and molecular findings in 37 Turkish patients with isolated methylmalonic acidemia

Background/aim: Isolated methylmalonic acidemia (MMA) is caused by complete or partial deficiency of the enzyme methylmalonyl- CoA mutase (mut0 or mut­ enzymatic subtype), a defect of its cofactor adenosyl-cobalamin (cblA, cblB, or cblD-MMA), or deficiency of the enzyme methylmalonyl-CoA epimerase. While onset of the disease ranges from the neonatal period to adulthood, most cases present with lethargy, vomiting and ketoacidosis in the early infancy. Major secondary complications are; growth failure, developmental delay, interstitial nephritis with progressive renal failure, basal ganglia injury and cardiomyopathy. We aimed to demonstrate clinical and molecular findings based on long-term follow up in our patient cohort. Materials and methods: The study includes 37 Turkish patients with isolated MMA who were followed up for long term complications 1 to 14 years. All patients were followed up regularly with clinical, biochemical and dietary monitoring to determine long term complications. Next Generation Sequencing technique was used for mutation screening in five disease-causing genes including; MUT, MMAA, MMAB, MMADHC, MCEE genes. Mutation screening identified 30 different types of mutations. Results: While 28 of these mutations were previously reported, one novel MMAA mutation p.H382Pfs*24 (c.1145delA) and one novel MUT mutation IVS3+1G>T(c.752+1G>T) has been reported. The most common clinical complications were growth retardation, renal involvement, mental motor retardation and developmental delay. Furthermore, one of our patients developed cardiomyopathy, another one died because of hepatic failure and one presented with lactic acidosis after linezolid exposure. Conclusion: We have detected two novel mutations, including one splice-site mutation in the MUT gene and one frame shift mutation in the MMAA gene in 37 Turkish patients. We confirm the genotype-phenotype correlation in the study population according to the long-term complications.

Clinical findings and mutational spectrum of neurofibromatosis type 1 patients in a single center of south part of Turkey.

AIM: The aim of this study is to determine the mutation spectrums and clinical characteristics of NF1 patients followed up in our center and to investigate whether there is a genotype-phenotype relationship. MATERIAL AND METHODS: Sixty-three children and 34 relatives diagnosed with NF1 were included in the study. Age, gender, family history, clinical features, tumors detected in the patient at the time of diagnosis or during follow-up, orbital and cerebral magnetic resonance imaging (MRI) findings were recorded. Also results of the NF1 gene analysis results were recorded. RESULTS: Fifty-three different mutations were found as a result of the NF1 gene analysis studied from patients and their family members. Among these 53 mutations, stop codon mutation was the most frequently detected mutations. Sixteen out of 50 (32%) mutations were found to be novel mutations. Twenty-eight tumors developed in our patients. Twenty of them were optic gliomas and others were medullary thyroid carcinoma, glioblastome multiforme, pons glioma, acute lymphoblastic leukemia, pilocytic astrositoma, hypothalamic glioma, cerebral hamartoma and cardiac fibroma. No genotype-phenotype relationship was detected in patients Conclusion: Comprehensive mutation analysis of NF1 will increase our knowledge due to its different phenotypic characteristics even in the same mutation.

Identification and functional characterization of mutations in LPL gene causing severe hypertriglyceridaemia and acute pancreatitis.

Hypertriglyceridaemia is a very rare disorder caused by the mutations of LPL gene, with an autosomal recessive mode of inheritance. Here, we identified two unrelated Chinese patients manifested with severe hypertriglyceridaemia and acute pancreatitis. The clinical symptoms of proband 1 are more severe than proband 2. Whole exome sequencing and Sanger sequencing were performed. Functional analysis of the identified mutations has been done. Whole exome sequencing identified two pairs of variants in LPL gene in the proband 1 (c.162C>A and c.1322+1G>A) and proband 2 (c.835C>G and c.1322+1G>A). The substitution (c.162C>A) leads to the formation of a truncated (p.Cys54*) LPL protein. The substitution (c.835C>G) leads to the replacement of leucine to valine (p.Leu279Val). The splice donor site mutation (c.1322+1G>A) leads to the formation of alternative transcripts with the loss of 134 bp in exon 8 of the LPL gene. The proband 1 and his younger son also harbouring a heterozygous variant (c.553G>T; p.Gly185Cys) in APOA5 gene. The relative expression level of the mutated LPL mRNA (c.162C>A, c.835C>G and c.1322+1G>A) showed significant differences compared to wild-type LPL mRNA, suggesting that all these three mutations affect the transcription of LPL mRNA. These three mutations (c.162C>A, c.835C>G and c.1322+1G>A) showed noticeably decreased LPL activity in cell culture medium but not in cell lysates. Here, we identified three mutations in LPL gene which causes severe hypertriglyceridaemia with acute pancreatitis in Chinese patients. We also described the significance of whole exome sequencing for identifying the candidate gene and disease-causing mutation in patients with severe hypertriglyceridaemia and acute pancreatitis.

Micro and Martsolf syndromes in 34 new patients: Refining the phenotypic spectrum and further molecular insights.

Micro and Martsolf syndromes are rare clinically and genetically overlapping disorders caused by mutations in RAB3GAP1, RAB3GAP2, RAB18 and TBC1D20 genes. We describe 34 new patients, 27 with Micro and seven with Martsolf. Patients presented with the characteristic clinical manifestations of the two syndromes, including postnatal microcephaly, congenital cataracts, microphthalmia, optic atrophy, spasticity and intellectual disability. Brain imaging showed in the majority of cases polymicrogyria, thin corpus callosum, cortical atrophy, and white matter dysmyelination. Unusual additional findings were pectus excavatum (four patients), pectus carinatum (three patients), congenital heart disease (three patients) and bilateral calcification in basal ganglia (one patient). Mutational analysis of RAB3GAP1 and RAB3GAP2 revealed 21 mutations, including 14 novel variants. RAB3GAP1 mutations were identified in 22 patients with Micro, including a deletion of the entire gene in one patient. On the other hand, RAB3GAP2 mutations were identified in two patients with Micro and all Martsolf patients. Moreover, exome sequencing unraveled a TBC1D20 mutation in an additional family with Micro syndrome. Our results expand the phenotypic and mutational spectrum associated with Micro and Martsolf syndromes. Due to the overlapped severities and genetic basis of both syndromes, we suggest to be comprehended as one entity "Micro/Martsolf spectrum" or "RAB18 deficiency."

Antimicrobial resistance and novel mutations detected in the gyrA and parC genes of Pseudomonas aeruginosa strains isolated from companion dogs.

BACKGROUND: Fluoroquinolone agents, such as enrofloxacin and marbofloxacin, are commonly used for pseudomonal infection in veterinary medicine. However, the rate of resistance to fluoroquinolones is rapidly increasing, according to multiple studies in various countries. Point mutations in the quinolone resistance-determining region (QRDR) are closely related to the increased fluoroquinolone resistance of Pseudomonas aeruginosa. The aim of this study was to investigate current antimicrobial susceptibility and fluoroquinolone resistance in P. aeruginosa strains isolated from dogs. The presence of point mutations in the QRDR was confirmed by gyrA and parC polymerase chain reaction and nucleotide sequencing analysis. RESULTS: A total of 84 nonduplicated P. aeruginosa strains were obtained from 228 healthy dogs (healthy group) and 260 dogs with clinical signs (infected group). Among these isolates, 38 strains from the healthy group were detected in several sample types, whereas 46 strains from the infected group were obtained mostly from dogs' ears with otitis externa (41/260, 15.8%). All strains were resistant to nalidixic acid, while some were also resistant to enrofloxacin (23/84, 27.4%), marbofloxacin (17/84, 20.2%), levofloxacin (12/84, 14.3%), or ciprofloxacin (11/84, 13.1%). Enrofloxacin resistance was significantly higher in strains from the infected group than in those from the healthy group (p < 0.05). Among the 23 fluoroquinolone-resistant strains, 8 and 4 different mutations were detected in the gyrA and parC genes, respectively. Mutations in gyrA were significantly common in the infected group (p < 0.05). Hotspots for the gyrA and parC mutations were Thr83 (34.8%, 8/23) and Pro116 (91.3%, 21/23), respectively. Double and triple mutations were also found in 5 of the strains. CONCLUSION: Novel mutations in the gyrA and parC genes were first found in P. aeruginosa isolated from companion dogs in South Korea. These findings suggest that it is important to encourage prudent use of fluoroquinolone antibiotics in canine pseudomonal infection treatment.

Charcot-Marie-Tooth disease: experience from a large Italian tertiary neuromuscular center.

INTRODUCTION: Charcot-Marie-Tooth (CMT) disease is the most common inherited neuromuscular disease. Thanks to the advances of the latest generation sequencing, more than 80 causative genes have been reported to date. METHODS: In this retrospective, observational study, we have analyzed clinical, electrophysiological, and genetic data of CMT patients in care at Neuromuscular Center of Messina University Hospital, Messina, Italy, for at least 22 years (from 1994 to 2016). Our center is the only reference center for genetic neuropathies in Sicily and in the southern part of Calabria. RESULTS: We reviewed the clinical records of 566 patients with the aim to evaluate how many patients received a genetic diagnosis and the distribution of the genetic subtypes. About 352/566 (62.19%) received a genetic diagnosis. The most frequent genetic diagnoses were CMT1A/PMP22 duplication (51.13%), followed by HNPP/PMP22 deletion (15.05%), CMT1B/MPZ mutation (10.22%), CMTX/GJB1 mutation (9.37%), and CMT2F/HSPB1 (4%). Other rare mutations included MFN2 mutation (n. 8 pts), BSCL2 mutation (n.8 pts), PMP22 point mutation (n.7 pts), GDAP1 mutation (n.4 pts), GARSmutation (n. 2 pts), TRPV4 mutation (n. 2 pts), LITAF mutation (n.1 pt), and NEFL mutation (n. 1 pt). CONCLUSIONS: Our study provides further data on frequency of CMT genes, subtypes in a wide Mediterranean area and contributes to help clinicians in addressing the genetic testing workup.

Two Novel and Five Rare Mutations in the Non Coding Regions of the ß-Globin Gene in the Iranian Population.

ß-Thalassemia (ß-thal) is one of the most frequent genetic disorder in Iran with great mutational diversity. In this study, we describe two novel and five rare mutations in the non coding regions of the ß-globin gene; these mutations were identified in the non coding regions of the ß-globin gene (HBB) in the heterozygous state. Three alterations were detected in the promoter region, including -9 (C>G) [HBB: c.59C>G (novel mutation)], -54 (G>A) (HBB: c.-104G>A) and -57 (A>T) (HBB: c.-107A>T), three changes in the 5' untranslated region (5'UTR) including +11 (C>G) [HBB: c.-40C>G (novel mutation)], +41 (A>T) (HBB: c.-10A>T) and +43 (C>G) (HBB: c.-8C>G) and one mutation in the 3'UTR 62 (A>G) (HBB: c.*62A>G). Five mutations including -54, -57, +41, +11 and +43 were predicted to be deleterious in all except one in silico prediction tool, and the remaining two mutations were found to be most likely polymorphisms. In conclusion, two novel mutations were reported for the first time worldwide and five rare changes have not been reported previously in any other part of Iran. In the absence of further data, it is not possible to consider them as mutations that determine an ascertained healthy carrier state.

Novel GNE mutations in three Chinese patients with typical GNE myo-pathy.

GNE myopathy is an adult-onset muscle disorder featuring distal muscle atrophy and weakness. Rimmed vacuoles found in the muscle biopsies and gene mutations lead to the diagnosis of GNE myopathy. We collected clinical information, performed muscle biopsies and genetic testing on three patients. These cases developed typical disease presentations with distal muscle weakness at the ages of 26, 23, and 37 years. Their muscle pathologies revealed rimmed vacuoles. Genetic analysis led to the findings which included, c.1543-1544delGA (p.D515QfsX2)/c.38G>C (p.C13S) compound heterozygous mutation, c.733A>G (p.K245E) homozygous mutation and c.527A>T (p.D176V)/c.1634-1G>C (splicing) ; in which c.1543-1544 del GA (p.D515QfsX2), c.733A>G (p.K245E) and c.1634-1G>C (splicing) are three de novo mutations that have never been reported before. In conclusion, this study broadens the mutational spectrum of the GNE gene.