Development of a New Binary Matrix for the Comprehensive Analysis of Lipids and Pigments in Micro- and Macroalgae Using MALDI-ToF/ToF Mass Spectrometry.

While edible algae might seem low in fat, the lipids they contain are crucial for good health and preventing chronic diseases. This study introduces a binary matrix to analyze all the polar lipids in both macroalgae (Wakame-Undaria pinnatifida, Dulse-Palmaria palmata, and Nori-Porphyra spp.) and microalgae (Spirulina-Arthrospira platensis, and Chlorella-Chlorella vulgaris) using matrix-assisted laser desorption ionization mass spectrometry (MALDI-MS). The key lies in a new dual matrix made by combining equimolar amounts of 1,5-diaminonaphthalene (DAN) and 9-aminoacridine (9AA). This combination solves the limitations of single matrices: 9AA is suitable for sulfur-containing lipids and acidic phospholipids, while DAN excels as an electron-transfer secondary reaction matrix for intact chlorophylls and their derivatives. By employing the equimolar binary matrix, a wider range of algal lipids, including free fatty acids, phospholipids, glycolipids, pigments, and even rare arsenosugarphospholipids were successfully detected, overcoming drawbacks related to ion suppression from readily ionizable lipids. The resulting mass spectra exhibited a good signal-to-noise ratio at a lower laser fluence and minimized background noise. This improvement stems from the binary matrix's ability to mitigate in-source decay effects, a phenomenon often encountered for certain matrices. Consequently, the data obtained are more reliable, facilitating a faster and more comprehensive exploration of algal lipidomes using high-throughput MALDI-MS/MS analysis.

Molecular dynamic simulations of diacridine binding to DNA: Indications that C6 diacridine can bisintercalate spanning two base pairs.

Dimers of 9-aminoacridine linked via the 9-amino group with polymethylene chains, termed diacridines, are known to bisintercalate into DNA when the linker comprises 6 or more methylene units. There are no literature reports of crystal or NMR solution structures for bisintercalated diacridine-DNA complexes, and the issue of the structure of the C6 ([CH2 ]n linker where n = 6) diacridine complex remains unresolved. Previously, based on simple geometric considerations, it was proposed that C6 diacridine could only span a single base pair, which requires that its bifunctional reaction violates the widely-observed "neighbor exclusion principle" where bound intercalators are separated by at least 2 base pairs. Here we have explored the structure of diacridine-DNA complexes using unrestrained molecular dynamics in explicit solvent using the parmbsc0 forcefield in AMBER14. We studied the C4 to C8 dimers, intercalated via both the minor and major DNA grooves, to a variety of nucleotide sequences. We find that C6, C7, and C8 diacridine are able to form 2 base pair bisintercalated complexes from either groove, whereas the C4 and C5 homologues cannot. We conclude that C6 diacridine does have the capacity to bisintercalate without violating neighbor exclusion, and that the previous proposed binding model needs revision.

A new 1-nitro-9-aminoacridine derivative targeting yeast topoisomerase II able to overcome fluconazole-resistance.

Fungal resistance remains a significant threat and a leading cause of death worldwide. Thus, overcoming microbial infections have again become a serious clinical problem. Although acridine derivatives are widely analyzed as anticancer agents, only a few reports have demonstrated their antifungal activity. In an effort to develop biologically active antifungals, twelve novel C-857 (9-(2'-hydroxyethylamino)-1-nitroacridine) and C-1748 (9-(2'-hydroxyethylamino)-4-methyl-1-nitroacridine) derivatives were synthesized. The evaluation of biological properties suggests that starting compounds: C-1748, C-857 and IE3 (2-[(4-methyl-1-nitroacridin-9-yl)amino]ethyl lysinate), IE4 (2-[(1-nitroacridin-9-yl)amino]ethyl lysinate) antifungal mode of action differ from that determined for IE5 (N'-{3-[(4-methyl-1-nitroacridin-9-yl)amino]propyl}lysinamide), IE6 (N'-{3-[(1-nitroacridin-9-yl)amino]propyl}lysinamide) and IE10 (3,3'-Bis-(1-nitroacridin-9-ylamino)-aminoethylaminoethylaminoethylamine). Although MIC values determined for the latter were higher, in contrast to C-857 and C-1748, newly synthesized IE5, IE6 and IE10 reduced C. albicans hyphal growth in different inducing media. Those compounds also exhibited antibiofilm activity, whereas IE10 was the most effective. Moreover, only IE6 exhibited antifungal activity against fluconazole resistant C. albicans strains with MICs values in the range of 16-64 µg mL-1. Our results also indicate that, in contrast to other analyzed derivatives, novel synthetized compounds IE6 and IE10 with antifungal activity target yeast topoisomerase II activity.

Efficient and Short Method for Conjugation of 1-Nitro-9-Aminoacridine to Important Peptidyl Fragments by a Solid Support Synthesis.

The efficient and short techniques for conjugation of 9-aminoacridine with different peptidyl fragments are necessary for the development of active pharmaceutical ingredients (API). They need to be adopted to generate a new branch of acridine conjugates, enhancing their bioavailability for the examination in biological systems. The branch of developing acridine conjugates, built via different linkers and synthesized in this study, are expected as potential effective chemotherapeutics with dual mechanism of action. Recently, the methodology based on a solid-phase technique has been successfully demonstrated in preparing a number of promising compounds. However, the reaction conditions for amide bond formation between 1-nitro-9-aminoacridine and peptidyl fragments need to be optimized. In this study, the optimization of amide bond formation was demonstrated with the use of the solid-phase synthesis to build a new promising group of 1-nitro-9-aminoacridines conjugated to lactoferrin fragments via especially carboxy linker length.

Liposomal 9-Aminoacridine for Treatment of Ischemic Stroke: From Drug Discovery to Drug Delivery.

Neuroinflammation plays a pivotal part in the pathogenesis of stroke. Orphan nuclear receptor NR4A1 is involved in the inflammatory response of microglia and macrophages. In this study, we discovered an old drug, 9-aminoacridine (9-AA), as a novel NR4A1 activator from our in-house FDA-approved drug library, which exhibited anti-inflammatory activities through an NR4A1/IL-10/SOCS3 signaling pathway and modulated the microglia activation. To improve the druggability of 9-AA, different liposomal formulations were screened and investigated. 9-AA-loaded liposome (9-AA/L) was prepared to reduce the adverse effect of 9-AA. Furthermore, 9-AA-loaded PEG/cRGD dual-modified liposome (9-AA/L-PEG-cRGD) was obtained, which displayed prolonged circulation, improved biodistribution, and increased brain accumulation. In the transient middle cerebral artery occlusion (tMCAO) rat model, 9-AA/L-PEG-cRGD significantly reduced brain infarct area, ameliorated ischemic brain injury, and promoted long-term neurological function recovery. This "from drug discovery to drug delivery" methodology provides a potential therapeutic strategy using the liposomal 9-AA, the NR4A1 activator to suppress neuroinflammation for treatment of ischemic stroke.

Novel tetrahydroacridine derivatives with iodobenzoic moieties induce G0/G1 cell cycle arrest and apoptosis in A549 non-small lung cancer and HT-29 colorectal cancer cells.

A series of nine tetrahydroacridine derivatives with iodobenzoic moiety were synthesized and evaluated for their cytotoxic activity against cancer cell lines-A549 (human lung adenocarcinoma), HT-29 (human colorectal adenocarcinoma) and somatic cell line-EA.hy926 (human umbilical vein cell line). All compounds displayed high cytotoxicity activity against A549 (IC50 59.12-14.87 µM) and HT-29 (IC50 17.32-5.90 µM) cell lines, higher than control agents-etoposide and 5-fluorouracil. Structure-activity relationship showed that the position of iodine in the substituent in the para position and longer linker most strongly enhanced the cytotoxic effect. Among derivatives, 1i turned out to be the most cytotoxic and displayed IC50 values of 14.87 µM against A549 and 5.90 µM against HT-29 cell lines. In hyaluronidase inhibition assay, all compounds presented anti-inflammatory activity, however, slightly lower than reference compound. ADMET prediction showed that almost all compounds had good pharmacokinetic profiles. 1b, 1c and 1f compounds turned out to act against chemoresistance in cisplatin-resistant 253J B-V cells. Compounds intercalated into DNA and inhibited cell cycle in G0/G1 phase-the strongest inhibition was observed for 1i in A549 and 1c in HT-29. Among compounds, the highest apoptotic effect in both cell lines was observed after treatment with 1i. Compounds caused DNA damage and H2AX phosphorylation, which was detected in A549 and HT-29 cells. All research confirmed anticancer properties of novel tetrahydroacridine derivatives and explained a few pathways of their mechanism of cytotoxic action.

9-Aminoacridine-based agents impair the bovine viral diarrhea virus (BVDV) replication targeting the RNA-dependent RNA polymerase (RdRp).

Bovine viral diarrhea virus (BVDV) infection is still a plague that causes important livestock pandemics. Despite the availability of vaccines against BVDV, and the implementation of massive eradication or control programs, this virus still constitutes a serious agronomic burden. Therefore, the alternative approach to combat Pestivirus infections, based on the development of antiviral agents that specifically inhibit the replication of these viruses, is of preeminent actuality and importance. Capitalizing from a long-standing experience in antiviral drug design and development, in this work we present and characterize a series of small molecules based on the 9-aminoacridine scaffold that exhibit potent anti-BVDV activity coupled with low cytotoxicity. The relevant viral protein target - the RNA-dependent RNA polymerase - the binding mode, and the mechanism of action of these new antivirals have been determined by a combination of in vitro (i.e., enzymatic inhibition, isothermal titration calorimetry and site-directed mutagenesis assays) and computational experiments. The overall results obtained confirm that these acridine-based derivatives are promising compounds in the treatment of BVDV infections and, based on the reported structure-activity relationship, can be selected as a starting point for the design of a new generation of improved, safe and selective anti-BVDV agents.

Homobivalent Conjugation Increases the Allosteric Effect of 9-aminoacridine at the α1-Adrenergic Receptors.

The α1-adrenergic receptors are targets for a number of cardiovascular and central nervous system conditions, but the current drugs for these receptors lack specificity to be of optimal clinical value. Allosteric modulators offer an alternative mechanism of action to traditional α1-adrenergic ligands, yet there is little information describing this drug class at the α1-adrenergic receptors. We have identified a series of 9-aminoacridine compounds that demonstrate allosteric modulation of the α1A- and α1B-adrenergic receptors. The 9-aminoacridines increase the rate of [3H]prazosin dissociation from the α1A- and α1B-adrenergic receptors and noncompetitively inhibit receptor activation by the endogenous agonist norepinephrine. The structurally similar compound, tacrine, which is a known allosteric modulator of the muscarinic receptors, is also shown to be a modulator of the α1-adrenergic receptors, which suggests a general lack of selectivity for allosteric binding sites across aminergic G protein-coupled receptor. Conjugation of two 9-aminoacridine pharmacophores, using linkers of varying length, increases the potency and efficacy of the allosteric effects of this ligand, likely through optimization of bitopic engagement of the allosteric and orthosteric binding sites of the receptor. Such a bivalent approach may provide a mechanism for fine tuning the efficacy of allosteric compounds in future drug design efforts.

Development of WNK signaling inhibitors as a new class of antihypertensive drugs.

Pseudohypoaldosteronism type II (PHAII) is characterized by hyperkalemia and hypertension despite a normal glomerular filtration rate. Abnormal activation of the signal cascade of with-no-lysine kinase (WNK) with OSR1 (oxidative stress-responsive kinase 1)/SPAK (STE20/SPS1-related proline/alanine-rich kinase) and NCC (NaCl cotransporter) results in characteristic salt-sensitive hypertension. Thus, inhibitors of the WNK-OSR1/SPAK-NCC cascade are candidates for a new class of antihypertensive drugs. In this study, we developed novel inhibitors of this signal cascade from the 9-aminoacridine lead compound 1, one of the hit compounds obtained by screening our chemical library for WNK-SPAK binding inhibitors. Among the synthesized acridine derivatives, several acridine-3-amide and 3-urea derivatives, such as 10 (IC50: 6.9µM), 13 (IC50: 2.6µM), and 20 (IC50: 4.8µM), showed more potent inhibitory activity than the lead compound 1 (IC50: 15.4µM). Compounds 10 and 20 were confirmed to inhibit phosphorylation of NCC in vivo.

Magnetic Field-Induced Accentuation of Drug Release from Core/Shell Magnetic Mesoporous Silica Nanoparticles for Anticancer Treatment.

Drug (9-aminoacridine) loaded core/shell magnetic iron oxide-containing mesoporous silica nanoparticles (MMSN) were treated with HeLa cells and the drug carriers were agitated by expo- sure to magnetic field. Viability studies show the applicability of drug loaded magnetic material for anticancer treatment, which is enhanced upon stimulation with magnetic field. Confocal micrographs of fluorescein grafted MMSN-treated HeLa cells confirmed the ability of magnetic field to concentrate the synthesized material in the exposed area of the cells. The synthesized material and the applied drug delivery method may find application in magnetic field-responsive targeted treatment of cancer.

COB231 targets amyloid plaques in post-mortem human brain tissue and in an Alzheimer mouse model.

Previous works have shown the interest of naturally fluorescent proflavine derivatives to label Abeta deposits in vitro. This study aimed to further characterize the properties of the proflavine 3-acetylamino-6-[3-(propargylamino)propanoyl]aminoacridine (COB231) derivative as a probe. This compound was therefore evaluated on human post-mortem and mice brain slices and in vivo in 18-month-old triple transgenic mice APPswe, PS1M146V and tauP301L (3xTgAD) mice presenting the main characteristics of Alzheimer's disease (AD). COB231 labelled amyloid plaques on brain slices of AD patients, and 3xTgAD mice at 10 and 0.1 µM respectively. However, no labelling of the neurofibrillary tangle-rich areas was observed either at high concentration or in the brain of fronto-temporal dementia patients. The specificity of this mapping was attested in mice using Thioflavin S and IMPY as positive controls of amyloid deposits. After intravenous injection of COB231 in old 3xTgAD mice, fluorescent amyloid plaques were detected in the cortex and hippocampus, demonstrating COB231 blood­brain barrier permeability. We also controlled the cellular localization of COB231 on primary neuronal cultures and showed that COB231 accumulates into the cytoplasm and not into the nucleus. Finally, using a viability assay, we only detected a slight cytotoxic effect of COB231 (< 10%) for the highest concentration (100 µM).

Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2).

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Rapid estimation of the energy charge from cell lysates using matrix-assisted laser desorption/ionization mass spectrometry: role of in-source fragmentation.

Nucleotides are key players in the central energy metabolism of cells. Here we show how to estimate the energy charge from cell lysates by direct negative ion matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) using 9-aminoacridine as matrix. We found a high level of in-source decay of all the phosphorylated nucleotides, with some of them producing considerable amounts of adenosine-5'-diphosphate (ADP) fragment ions. We investigated the behavior of adenosine-5'-monophosphate (AMP), ADP, and adenosine-5'-triphosphate (ATP) as well as the cofactors coenzyme A (CoA) and acetyl-coenzyme A (ACoA) and nicotinamide adenine dinucleotides (NAD⁺ and NADH) in detail. In-source decay of these compounds depends strongly on the applied laser power and on the extraction pulse delay. At standard instrument settings, the 9-aminoacridine (9-AA) matrix resulted in a much higher in-source decay compared with 2,4,6-trihydroxyacetophenone (2,4,6-THAP). By adding ¹³C-labeled ATP to a cell lysate, we were able to determine the degree of in-source decay during an experiment. Analyzing a cell extract of the monocytic cell line THP-1 with [¹³C]ATP as internal standard, we were able to obtain values for the energy charge that were similar to those determined by a reference liquid chromatography electrospray ionization coupled to mass spectrometry (LC-ESI-MS) method.

An acridinium-based sensor as a fluorescent photoinduced electron transfer probe for proton detection modulated by anionic micelles.

A water-soluble fluorescent pH sensor of 9-amino-10-methylacridinium chromophore with the 2-(diethylamine)ethyl chain as a receptor shows an "off-on" response going from basic to acidic solution. Photoinduced electron transfer has been directly demonstrated to be the quenching mechanism by the observation of the long-lived acridinyl radical. The interaction of the protonated sensor with anionic micelles causes a significant increase in the detection sensitivity of pH.

Pericyclic rearrangements of N-heterocyclic carbenes of indazole to substituted 9-aminoacridines.

On deprotonation, 1-arylindazolium salts form 1-arylindazol-3-ylidenes which rearrange spontaneously via ring cleavage, ring closure and subsequent proton transfer to substituted 9-aminoacridines. By contrast, the N-heterocyclic carbene of 2-phenylindazolium cannot rearrange similarly and was trapped by sulfur.

Modulation of acridine mutagen ICR191 intercalation to DNA by methylxanthines--analysis with mathematical models.

Caffeine (CAF) and other methylxanthines (MTX) may interact directly with several aromatic, intercalating ligands through mixed stacking aggregation. Formation of such stacking hetero-complexes may decrease their free form concentration and, in consequence, diminish their biological activity, which is often related to their direct interaction with DNA. In this paper interactions of acridine mutagen (ICR191) with DNA in the presence of three MTX: caffeine (CAF), pentoxifylline (PTX) and theophylline (TH) are investigated. Several mathematical models are used to calculate all association constant values and every component concentration in each analyzed mixture. Model McGhee-von Hippel is used to analyze ligand-DNA interaction, and model Zdunek et al.--to analyze ligand-MTX interactions. Finally, two distinct mathematical models are employed to analyze three-component mixture containing ligand, MTX and DNA molecules. The first model describes possible interactions of ligand with DNA and MTX, and rejects direct MTX interactions with DNA. The second model describes all interactions mentioned above and, additionally, allows MTX to interact directly with DNA. Results obtained using these models are similar. However, correspondence of theoretical results to experimental data is better for the first model than the second one. In this paper possible interactions of ICR191 with eukaryotic cell chromatin are also analyzed, showing that CAF reduces acridine mutagen potential to interact directly with cell chromatin. Additionally, it is demonstrated that MTX inhibit mutagenic activity of ICR191 in a dose-dependent manner. Furthermore, biological activity of ICR191-MTX mixtures corresponds with concentration of free mutagen form calculated using appropriate mathematical model.

MALDI imaging in human skin tissue sections: focus on various matrices and enzymes.

Matrix-assisted laser/desorption ionization (MALDI) mass-spectrometric imaging (MSI), also known as MALDI imaging, is a powerful technique for mapping biological molecules such as endogenous proteins and peptides in human skin tissue sections. A few groups have endeavored to apply MALDI-MSI to the field of skin research; however, a comprehensive article dealing with skin tissue sections and the application of various matrices and enzymes is not available. Our aim is to present a multiplex method, based on MALDI-MSI, to obtain the maximum information from skin tissue sections. Various matrices were applied to skin tissue sections: (1) 9-aminoacridine for imaging metabolites in negative ion mode; (2) sinapinic acid to obtain protein distributions; (3) α-cyano-4-hydroxycinnamic acid subsequent to on-tissue enzymatic digestion by trypsin, elastase, and pepsin, respectively, to localize the resulting peptides. Notably, substantial amounts of data were generated from the distributions retrieved for all matrices applied. Several primary metabolites, e.g. ATP, were localized and subsequently identified by on-tissue postsource decay measurements. Furthermore, maps of proteins and peptides derived from on-tissue digests were generated. Identification of peptides was achieved by elution with different solvents, mixing with α-cyano-4-hydroxycinnamic acid, and subsequent tandem mass spectrometry (MS/MS) measurements, thereby avoiding on-tissue MS/MS measurements. Highly abundant peptides were identified, allowing their use as internal calibrants in future MALDI-MSI analyses of human skin tissue sections. Elastin as an endogenous skin protein was identified only by use of elastase, showing the high potential of alternative enzymes. The results show the versatility of MALDI-MSI in the field of skin research. This article containing a methodological perspective depicts the basics for a comprehensive comparison of various skin states.

Excimer of 9-aminoacridine hydrochloride hydrate in confined medium: an integrated experimental and theoretical study.

We aim to find out the extent of stability of the excimer of 9-aminoacridine hydrochloride hydrate (9AA), a prospective PDT drug, in different confined media with varying cavity size. When confined in cetyltrimethyl ammonium bromide micelles, although at low concentration of 9AA, only a single distinct peak (λ(max) at 460 nm) with a shoulder at 485 nm is observed in steady-state fluorescence spectrum, yet with increase in concentration the peak and the shoulder merge with simultaneous emergence of another peak at 535 nm, which is assigned to excimer. Similar behavior is also observed in Triton-X, crown ether, α-cyclodextrin, ß-cyclodextrin, and homogeneous aqueous medium. The formation of excimer, which reflects the extent of confinement of 9AA, is maximum in ß-cyclodextrin followed by others. Steady-state and time-resolved fluorescence studies along with TRES and TRANES analyses coupled with anisotropy data and transient absorption studies reveal the presence of monomer-dimer equilibrium of 9AA in the excited state. Molecular modeling indicates that the structure of excimer is stabilized by locking of the two monomeric species via four hydrogen bonds formed between the amino-H and imino-N of 9AA monomers, whereas the dimer in the ground state has only two such hydrogen bonds.

Matrix-assisted laser desorption/ionization matrices for negative mode metabolomics.

Matrix-assisted laser desorption/ionization (MALDI) has been shown to be highly sensitive for analyzing low-mass compounds such as metabolites if the right matrix is used. 9-aminoacridine (9AA) is the most commonly employed matrix for negative mode MALDI-MS in metabolomics. However, matrix interferences and the strongly varying sensitivity for different metabolites make a search for alternative matrices desirable, in order to identify compounds with a different chemical background and/or favoring a different range of analytes. We tested the performance of a series of potential negative mode MALDI matrices with a mix of 29 metabolites containing amino acids, nucleotide phosphates and Krebs cycle intermediates. While ethacridine lactate was found to provide limits of detection (LODs) in the low femtomole range for nucleotide phosphates, amino acids and Krebs cycle intermediates in the low picomole range, 4-amino-2-methylquinoline showed LODs in the picomole range for most metabolites, but is capable of ionizing a broader range of analytes than both 9AA and ethacridine.

MALDI imaging and structural analysis of rat brain lipid negative ions with 9-aminoacridine matrix.

Mass spectrometry imaging is of growing interest for chemical mapping of lipids at the surface of tissue sections. Many efforts have been devoted to optimize matrix choice and deposition technique for positive ion mode analyses. The identification of lipid species desorbed from tissue sections in the negative mode can be significantly improved by using 9-aminoacridine together with a robust deposition method, yielding a superior signal-to-noise ratio and thus a better contrast for the ion images in comparison to classical matrices such as α-cyano-4-hydroxycinnamic acid, 2,5-dihydroxybenzoic acid, or 2,4,6-trihydroxyacetophenone. Twenty-eight different lipid species (phosphatidic acids, phosphatidylethanolamines, phosphatidylserines, phosphatidylglycerols, phosphatidylinositols, phosphatidylinositol-phosphates, and sulfatides) were scrutinized on rat brain tissue sections, and systematic MS/MS studies were conducted. It was possible to identify isobaric species differing by their fatty acid chains thanks to the improved sensitivity.