First Report of Cucumber vein yellowing virus on Cucumber in Lebanon.

In a 2-year (2008 to 2009) wide-scale survey of viruses infecting cucurbits, a limited number of greenhouse-grown cucumber (Cucumis sativus) plants showed vein-yellowing symptoms. Greenhouses were infested with whiteflies and infection with Cucumber vein yellowing virus (CVYV) was suspected. CVYV is widely distributed in southern Europe in both open field and protected cucurbit crops (2). Total RNA was extracted from seven plants with vein yellowing symptoms using TRI Reagent (Sigma-Aldrich, St Louis, MO). RT-PCR tests using CVYV-specific primers (CV+/CV-) targeting the coat protein of CVYV (2) gave amplicons of the expected size from seven plants. The sequence of one representative isolate, CVYV-LB3 (GenBank Accession No. JF289167), showed 97, 95.6, and 95.2% pairwise nucleotide identity with isolates from Tunisia (EF538680), Israel (AF233429), and Jordan (JF460793), respectively. In 2012, CVYV like symptoms were not observed in greenhouses in the same areas. In early spring 2013, a total of 16 leaf samples with vein-yellowing symptoms were collected from the northern coastal areas (Jbeil, Amshit, Tabarja) and 11 samples showing only yellowing on older leaves from the southern coast (Jiyeh). CVYV was detected in all samples from the northern coast and in four samples from the southern coast. Four isolates from the North and two from the South were sequenced (KC990497 to KC990502) and showed high sequence variation. The pairwise nucleotide and amino acid identities between these isolates ranged from 95.1 to 100% and 98.5 to 100%, respectively. Pairwise nucleotide and amino acid identities of the isolates with CVYV-LB3 showed variable homology between 93.7 to 98.2% and 94.6 to 96.6%, respectively. The inter-population structure of CVYV in Lebanon showed high variability as compared to the homogenous Spanish population (4). For transmission tests, non-viruliferous whiteflies (Bemisia tabaci) were exposed for an 18-h acquisition access period on vein-yellowed leaves followed by a 24-h inoculation access period to healthy cucumber plants (5-leaf stage). In addition, leaves with vein-yellowing symptoms were ground in 0.1 M phosphate buffer (pH 7.0) and sap-inoculated on carborundum-dusted cucumber (cv. Delta) and squash (Cucurbita pepo cv. FarajF1) plants. Vein yellowing symptoms developed 9 to 11 days post-inoculation on all whitefly inoculated plants, while symptoms were delayed till 3 weeks post inoculation on seven out of eight sap-inoculated plants. All symptomatic plants were positive for CVYV by RT-PCR. Furthermore, surveyed plants were also tested for Cucurbit chlorotic yellows virus (CCYV) and Cucurbit yellow stunting disorder virus (CYSDV), two criniviruses reported previously in Lebanon, by RT-PCR (1). Double or triple infection of CCYV and CYSDV occurred in 18 out of 20 of the CVYV-infected plants. During the past 5 years, a limited number of cucumber plants showed CVYV symptoms. This indicates that CVYV occurrence is sporadic. However, its occurrence in mixed infection with criniviruses may have damaging economic implications to cucurbit production (3). To our knowledge, this is the first report of CVYV on cucurbits in Lebanon and its occurrence in co-infection with CCYV. References: (1) P. E. Abrahamian et al. Plant Dis. 96: 1704, 2012. (2) I. M. Cuadrado et al. Plant Dis. 85:336, 2001. (3) F. M. Gil-Salas et al. Plant Pathol. 61:468, 2011. (4) D. Janssen et al. Virus Genes 34:367, 2007.

First Report of Cucurbit chlorotic yellows virus on Cucumber in Lebanon.

In the summer of 2011, whiteflies (Bemisia tabaci) were collected from cucumbers plants showing interveinal yellowing on the lower leaves growing in commercial greenhouses in Jiyye area, South Lebanon. About twenty whiteflies per seedling were placed on healthy cucumber (Cucumis sativus cv. Beit alpha) seedlings at the second-leaf stage and grown in insect-proof cages in the university glasshouse. After 4 days of feeding, the whiteflies were sprayed with an insecticide (Imidacloprid). Three weeks post inoculation, three out of eight inoculated plants developed typical yellowing symptoms on old leaves. Symptoms started with chlorotic spots that later coalesced into interveinal chlorosis similar to that induced by Cucurbit yellow stunting disorder virus (CYSDV), a widely occurring virus in Lebanon. Total RNA was extracted from the three symptomatic plants using TRI reagent (Sigma-Aldrich, St Louis, MO). The three symptomatic plants, however, tested negative for CYSDV by tissue blot immuno assay and reverse transcription (RT)-PCR (2). Another Crinivirus, Cucurbit chlorotic yellows virus (CCYV), was suspected (1). Analysis of the RNA extracts of the three symptomatic plants by RT-PCR using the CCYV heat shock protein (HSP70h) specific primer pair (CCYV-HSP-F1/CCYV-HSP-R1) (3) showed a band of the expected size (462 bp). A small scale survey from February to April 2012, covering the two major cucumber growing areas on the Lebanese coastal areas, Byblos (North) and Jiyye (South), was conducted. Eight out of 10 cucumber leaf samples collected from Jiyye and seven out of 38 from Byblos area tested positive for CCYV by RT-PCR. Therefore, RNA extracts from cucumber which were positive for CYSDV and stored at -80°C since spring 2011 were tested again for CCYV. Fourteen randomly selected RNA extracts out of 76 samples were all found to have mixed infections with CCYV. For partial molecular characterization of the Lebanese CCYV isolates collected during summer 2011, regions of the HSP70h and coat protein (CP) genes from CCYV were amplified using specific primers (CCYV-CPs/CCYV-CPas) (1, 3). Sequences of the purified amplicons of 462 and 725 bp respectively, were submitted to GenBank (Accession Nos. JX014262 and JX014263). The HSP70h and CP genes were highly homologous to the Japanese CCYV isolate (AB523789), sharing nucleotide sequence identities of 99.8% and 99.7%, respectively. The CCYV HSP70h gene of the Lebanese isolate is distantly related to other criniviruses sharing nucleotide sequence identities of 76.4, 75.8, and 74.7% with Lettuce chlorosis virus (FJ380119), Bean yellow disorder virus (EU191905), and CYSDV (AY242078), respectively, whereas the CCYV CP gene shares 77, 76, and 70% nucleotide sequence identities with the latter viruses, respectively. CCYV has been reported only in Japan, China, Taiwan, and Sudan (1). To our knowledge, this is the first report of CCYV in Lebanon and the Mediterranean basin. CCYV may have also spread to neighboring countries but has not been reported yet. The rapid outbreak of new whitefly-transmitted viruses poses a serious threat to cucurbit production in the Mediterranean region and Europe. References: (1) K. Hamed et al. Plant Dis. 95:1321, 2011. (2) H. Hourani and Y. Abou-Jawdah J. Plant Pathol. 85:1, 2003 (3) R. Zeng et al. Plant Dis. 95:354, 2011.

First Report of Squash leaf curl virus in Cucurbits in Lebanon.

During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5'AGCTGTATCTTGGGCAACAGA3' and SqA2F: 5'TATCTCCCATCTTGGCAAGG3'; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production. References: (1) Antignus et al. Phytoparasitica 31:415, 2003. (2) Guenoune-Gelbart et al. J. Virol. Methods 168:87, 2010. (3) Rojas et al. Plant Dis. 77:340, 1993. (4) Zhang et al. J. Virol. Methods 71:45, 1998.

First Report of Watermelon chlorotic stunt virus in Cucurbits in Lebanon.

In August 2009 in the Marjyoun region in South Lebanon, severe yellowing symptoms on melon (Cucumis melo) and pronounced dwarfing and mosaics on watermelon (Citrullus lanatus) led to significant yield losses. Watermelon chlorotic stunt virus (WmCSV), genus Begomovirus, family Geminiviridae, was suspected. Symptomatic samples were collected close to the end of the growing season from several fields. The small scale CTAB protocol was followed for nucleic acid extraction. Samples were tested by PCR for WmCSV and Squash leaf curl virus (SLCV) using specific primers for SLCV (2) and newly designed WmCSV specific primers: (WMAR1: 5' TTTTCCGACACGATGAGTGAT 3'; WMAF3: 5' ACTGGACTTAGCGCTTTGTAT 3'; amplicon size 1,061 bp). Of 39 symptomatic samples, 90% were infected with WmCSV, 13/14 (93%) melon samples and 22/25 (88%) watermelon samples, while 64% were infected with SLCV, indicating a high incidence of mixed infections. In November 2009, no cucurbits were found in Marjyoun since farmers refrained from planting late crops after devastating losses in the previous year. Therefore, 92 samples were collected from other southern regions and 114 samples from northern regions. All squash samples had leaf curl symptoms, while 75 to 85% of cucumber and melon had yellowing symptoms. No WmCSV was detected in North Lebanon, even though 100% of squash samples and 79% of other cucurbit samples were positive for SLCV. However, in South Lebanon, WmCSV was detected 9/20 (45%) in melon, 12/32 (38%) in cucumber (Cucumis sativus), and 6/40 (15%) in squash; while the incidence of SLCV was high particularly on squash (39/40, 98%) and cucumber (30/32, 94%) followed by melon (7/20, 35%). The survey was repeated in 2010, and the previous year's results were confirmed: no WmCSV was detected in North Lebanon, while 39/40 (98%) melon samples tested in November were positive for SLCV. In southern Lebanon, WmCSV was not detected in melon or watermelon samples collected in June; however, in November it was detected in 11/23 (48%) squash and 9/33 (27%) melon. WmCSV genome was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare) The RCA product was sequenced using mostly locally designed primers, and the sequences were submitted to GenBank: WmCSV DNA A: HM368371.1; WmCSV DNA B: HM368372. Phylogenetic analysis showed that WmCSV DNA A was most closely related to isolates from Israel (EF201809.1) and Jordan (EU561237.1), sharing 99% nt identities with both isolates; WmCSV DNA B was found to be most closely related to an isolate from Israel (EF201810.1), with 98% nt identity. WmCSV was first detected in Yemen (4) but was detected quite recently in Israel and Jordan (1). Within a short period, Lebanon experienced the introduction of two new whitefly transmitted begomoviruses. WmCSV seems so far to be restricted only to South Lebanon, while SLCV is widespread. The synergistic interaction between a mixed infection by SLCV and WmCSV in melon resulted in significant symptom enhancement, plant shortening, and up to 54% yield reduction in summer (3). Hence, the development of resistant varieties coupled with the implementation of adapted integrated pest management strategies would be essential for successful production of cucurbit crops. References: (1) Al-Musa et al. J. Phytopathol. 156:311, 2008. (2) Sobh et al. Plant Dis. 26:1231, 2012. (3) Sufrin-Ringwald and Lapidot. Phytopathology 101:281, 2011. (4) Walkey et al. Tropical Pest Management 36:195, 1990.

First Report of Tomato spotted wilt virus on Tomatoes in Lebanon.

During the spring and summer of 2004, an epidemic of Tomato spotted wilt virus (TSWV) (genus Tospovirus, family Bunyaviridae) was observed in an isolated tomato field at an elevation of 1,000 m in Lebanon. Symptoms were characteristic of TSWV (2). Seedlings came from a nursery in the coastal area of Byblos. In the spring of 2005, TSWV-like symptoms (2) appeared on tomato in the same mountainous area, as well as on tomato, pepper, and lettuce crops in the Byblos coastal area. Initial diagnosis using TSWV ImmunoStrip Tests (Agdia, IN) gave positive results on tomato and lettuce samples. When these samples were analyzed using reverse transcription-polymerase chain reaction, a specific band (619 nt) was observed in symptomatic samples but not in healthy controls (1). Amplicons were cloned into the pGEM-T easy vector (Promega, Madison, WI) and three clones were sequenced in both directions (GenBank Accession No. DQ131804). Sequence analysis revealed more than 99% nucleotide identity (GenBank Accession Nos. AY744476, AJ297611, and AJ418781) and 99% amino acid identity and 100% amino acid similarity (GenBank Accession Nos. AAU95409, CAA85356, and CAD11452) to the nucleocapsid protein of several TSWV isolates. To our knowledge, this is the first report of TSWV in Lebanon. To prevent rapid spread, farmers were informed about the disease, its vector, and appropriate preventive control measures. References: (1) S. Adkins and E. N. Rosskopf. Plant Dis. 86:1310, 2002. (2) G. Marchoux et al. Plant Pathol. 40:347, 1991.

First Report of Tomato chlorosis virus in Lebanon.

Tomato seedlings showing leaf curl and yellowing symptoms characteristic of Tomato yellow leaf curl virus (TYLCV) were brought to the university laboratory from a commercial tomato greenhouse located in the Damour coastal area, south of Beirut, Lebanon. They were first tested using polymerase chain reaction (PCR) to ascertain their infection by TYLCV and then they were used in a trial to evaluate resistance of three local accessions of tomato to TYLCV, the major limiting factor to tomato production in Lebanon. Whiteflies (Bemisia tabaci), reared on broccoli for several generations, were allowed an acquisition access period of 48 h on tomato seedlings putatively infected with TYLCV and then were transferred to test plants at an average of 40 to 60 whiteflies per tomato seedling at the first-true leaf stage for an inoculation feeding period of 3 days. All treatments were conducted in insect-proof cages. Clear TYLCV symptoms were observed on the three local tomato accessions approximately 3 weeks after inoculation. However, 7 to 8 weeks after inoculation, many plants showed yellowing symptoms on the lower leaves that were not observed in previous experiments. Infections by Tomato chlorosis virus (ToCV) and/or Tomato infectious chlorosis virus (TICV), two criniviruses belonging to the family Closteroviridae, were suspected. Diagnostic tests using PCR for TYLCV detection (1) and reverse transcription (RT)-PCR for detection of ToCV (2) or TICV (3) showed that some tomato plants had a mixed infection with TYLCV and ToCV. None of the tested samples was positive for TICV. The RT-PCR amplicons (434 nt) obtained with the ToCV specific primers were cloned into pGEM-T easy vector. Sequence analysis of one clone revealed more than 99% nucleotide identity with the heat shock protein homologue (HSP70h) of ToCV isolates from the United States (GenBank Accession Nos. AY903448, AF024630, and AY444872) and 100% amino acid identity to ToCV isolates from Italy and Portugal (GenBank Accession Nos. AY048854.1 and AF234029.1). The sequence was submitted to GenBank (Accession No. DQ234079). Twenty-two tomato samples were then collected from plants showing yellowing symptoms on their lower leaves. The samples were taken from two greenhouses at the same farm in the Damour area. Six samples tested positive for ToCV using RT-PCR. To our knowledge, this is the first report of ToCV in Lebanon, but its incidence and distribution was not monitored. However, on the basis of symptoms and preliminary RT-PCR results, the disease does not appear to be widely spread in the country. References: (1) G. H. Anfoka et al. J. Plant Pathol. 87:65, 2005. (2) D. Louro et al. Eur. J. Plant Pathol. 106:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002.

First Report of Cucurbit Aphid-borne Yellows Luteovirus in Lebanon.

Recently, Lecoq et al (1992) reported a new yellowing disease of cucurbits in France caused by cucurbit aphid-borne yellows luteovirus (CABYV) (1). Yellowing of older leaves of cucurbits has been observed in Lebanon for the past few years. Transmission tests showed that the disease incitant could be transmitted by Aphis gossypii in a persistent, circulative manner from muskmelon plants (Cucumis melo) to cucumber (C. sativus), muskmelon (C. melo), and squash (Cucurbita pepo) plants. Extracts from these plants reacted positively in enzyme-linked immunosorbent assays (ELISAs) with an antiserum prepared to a French isolate of CABYV. Surveys conducted in 1995 and 1996 showed that CABYV was widely distributed in the major cucurbit-growing areas along the Lebanese coast from north to south, and in the Beqaa plain. It was detected year round, alone or in mixed infections with mosaic-inducing viruses. The highest frequencies were recorded between May and October. CABYV and zucchini yellow mosaic potyvirus (ZYMV) were the most commonly detected viruses in outdoor cucurbits, including squash, cucumber, and melon. However, in protected cultivations (plastic tunnels), only a small proportion of cucumber plants showing similar yellowing symptoms reacted positively with CABYV antiserum in ELISAs, suggesting another cause to account for these symptoms. Reference: (1) H. Lecoq et al. Plant Pathol. 41:479, 1992.

Sensitivity of Venturia inaequalis Isolates to Fungicides Used in Lebanon.

Apple scab, caused by Venturia inaequalis (Cooke) G. Wint. is one of the major apple diseases worldwide. In 1994, the disease caused severe losses particularly in apple orchards of the Akkar mountainous areas of Lebanon, although more than 10 fungicide sprays were applied. A total of 230 isolates of V. inaequalis were collected from 23 orchards and single-spore colonies were prepared. The orchards were selected to represent the major apple-growing areas in Lebanon: Akkar in the north, Kfardibian in northeast Beirut, and Barouk in southeast Beirut. In vitro tests were conducted to evaluate the level of resistance to benzimidazoles and sterol biosynthesis inhibitors (SBI). All isolates tested except one were resistant to benomyl and thiophanate-methyl at 1 µg/ml. The majority of isolates were not inhibited at concentrations as high as 50 µg/ml in mycelial growth. Similarly, the majority of the isolates were not inhibited by benomyl at 1, 5, and 50 µg/ml in spore germination tests. Preliminary in vivo tests with benomyl concerning resistance to benzimidazoles correlated well with in vitro results. All the isolates were inhibited by fenari-mol at 0.25 µg/ml (1) indicating that all the isolates can be considered sensitive to this fungicide. However, the sensitivity levels varied among the various isolates with the ED50 for fenarimol ranging between 0.002 and 0.052 µg/ml. Two new SBIs, bromocunazol and fenbuconazol, not registered for use in Lebanon at the time this study was performed, were also tested. Their ED50 ranged from 0.0089 to 0.025 µg/ml for bromocunazol and from 0.008 to 0.039 µg/ml for fenbuconazol, both indicating a good level of in vitro activity. These results indicate that resistance to benzimidazol is widespread in Lebanon while resistance to SBIs has not yet been detected. Reference: (1) W. Köller et al. Plant Dis. 75:726, 1991.