The journey of antiphospholipid antibodies from cellular activation to antiphospholipid syndrome.

Pathogenic antiphospholipid antibodies (aPL) are the driving factors of recurrent pregnancy loss and thrombosis that characterize antiphospholipid syndrome (APS). Current evidence indicates that aPL induce a procoagulant phenotype in the vasculature and abnormal cellular proliferation and differentiation in placental tissues to cause the typical clinical features; however, the molecular mechanisms underlying these processes remain incompletely understood. Inflammation serves as a necessary link between the observed procoagulant phenotype and actual thrombus development and is an important mediator of the placental injury in APS patients. However, the underlying mechanisms for these events have also not been fully elucidated. In this review, we will outline the available data that give us our current understanding of the pathophysiology of APS, especially as it relates to the development of thromboembolic and obstetric pathological phenomena in these patients. We will also describe the intracellular signaling pathways activated by aPL in various cellular subtypes and outline the current evidence linking these pathways to clinical phenotypes. Finally, we will discuss the implications of distinct molecular patterns defining clinical phenotypes of APS patients.

Partial purification of presynaptic plasma membrane by immunoadsorption.

During transmitter release, synaptic vesicle membrane is specifically inserted into the nerve terminal plasma membrane only at specialized sites or "active zones." In an attempt to obtain a membrane fraction enriched in active zones, we have utilized the electric organ of the marine ray. From this organ, a fraction enriched in nerve terminals (synaptosomes) was prepared by conventional means. These synaptosomes were bound to microscopic beads by an antiserum to purified electric organ synaptic vesicles (anti-SV). The success of this immunoadsorption procedure was demonstrated by increased specific activities of bead-bound nerve terminal cytoplasmic markers and decreased specific activities of markers for contaminating membranes. To obtain a presynaptic plasma membrane (PSPM) fraction, we lysed the bead-bound synaptosomes by hypoosmotic shock and sonication, resulting in complete release of cytoplasmic markers. When the synaptosomal fraction was surface-labeled with iodine before immunoadsorption, 10% of this label remained bead-bound after lysis, compared with 2% of the total protein, indicating an approximately fivefold enrichment of bead-bound plasma membrane. Concomitantly, the specific activity of bead-bound anti-SV increased approximately 30-fold, indicating an enrichment of plasma membrane which contained inserted synaptic vesicle components. This PSPM preparation is not simply synaptic vesicle membrane since two-dimensional electrophoresis revealed that the polypeptides of the surface-iodinated PSPM preparation include both vesicle and numerous nonvesicle components. Secondly, antiserum to the PSPM fraction is markedly different from anti-SV and binds to external, nonvesicle, nerve terminal components.

Tumor necrosis factor-induced reversal of adipocytic phenotype of 3T3-L1 cells is preceded by a loss of nuclear CCAAT/enhancer binding protein (C/EBP).

Tumor necrosis factor (TNF)-treated 3T3-L1 adipocytes were used as a model for studying the effects of systemic inflammation on adipose tissue. Lipopolysaccharide-treated monocyte-conditioned medium or recombinant human TNF alpha induced morphological dedifferentiation of the adipocytes and led to loss of adipocyte specific gene expression. Gel shift, Southwestern and Western immunoblot analysis demonstrated that dedifferentiation was preceded by a decrease in the DNA binding activity and protein level of the transcription factor CCAAT/enhancer binding protein (C/EBP). Liver activating protein, a related protein that binds identical DNA sequences, increased during cytokine treatment. Both proteins activate specific enhancer elements located in the promoter region of many genes whose transcription is altered during systemic inflammation. Pulse-chase labeling followed by immunoprecipitation demonstrated that C/EBP is a rapidly turning over protein in adipocytes and that cytokine treatment led to a specific, time dependent decrease in its rate of synthesis. Because C/EBP binding sites have been shown to play an important role in regulating the expression of genes involved in adipocyte metabolism, we propose that the TNF-induced changes in the complement of transcription factors binding those sites may be important in the pathogenesis of inflammation-induced atrophy of adipose tissue.

Angiotensinogen gene-inducible enhancer-binding protein 1, a member of a new family of large nuclear proteins that recognize nuclear factor kappa B-binding sites through a zinc finger motif.

Transcriptional activation of the rat angiotensinogen gene during the acute-phase response is dependent on a previously characterized acute-phase response element (APRE) that binds at least two types of nuclear proteins: a cytokine-inducible activity indistinguishable from nuclear factor kappa-B (NF kappa B) and a family of C/EBP-like proteins. We screened a rat liver cDNA expression library with a labeled APRE DNA probe and isolated a single clone that encodes a sequence-specific APRE-binding protein. This new protein, the angiotensinogen gene-inducible enhancer-binding protein 1 (AGIE-BP1), is encoded by a large continuous open reading frame and contains a zinc finger motif virtually identical to the DNA-binding domain of a recently described human protein, MBP-1/PRDII-BF1, and a homologous mouse protein, alpha A-CRYBP1. Outside the binding domain, the sequences diverged considerably. Southern blot analysis indicated that AGIE-BP1 and alpha A-CRYBP1 are encoded by separate genes, thus defining a new family of DNA-binding proteins. Electrophoretic mobility shift assays, methylation interference, and DNase I footprint protection assays with the bacterially expressed DNA-binding domain of AGIE-BP1 demonstrated a binding specificity indistinguishable from that of purified NF kappa B. Antiserum raised against the bacterially expressed DNA-binding domain of AGIE-BP1 detected on immunoblots of cellular proteins a large (greater than 250-kDa) nuclear protein. Northern (RNA) blot analysis of RNAs from different rat tissues and cell lines indicated different levels of expression of the large (greater than 10-kb) AGIE-BP1 transcript in different tissues. The potential role of AGIE-BP1 in the regulation of gene expression is discussed.

The permissive role of glucocorticoids on interleukin-1 stimulation of angiotensinogen gene transcription is mediated by an interaction between inducible enhancers.

The acute-phase activation of the rat angiotensinogen (rAT) gene in liver cells is a transcriptional event mediated through an interleukin-1-inducible, NF kappa B-binding, cis-acting element (the acute-phase response element [APRE]). Using a cell culture model for the acute-phase response, we showed that the increase in angiotensionogen mRNA in H35 rat hepatoma cells requires costimulation with glucocorticoids and cytokines. Stably transfected rAT promoter-luciferase reporter genes were also activated by cytokines only in the presence of glucocorticoids. This permissive role of glucocorticoids is dependent on the expression of functional glucocorticoid receptors, because in HepG2 cells naturally deficient in such receptors, rAT gene-luciferase reporter constructs responded to interleukin-1 only when cotransfected with an expression vector for the glucocorticoid receptor. Point mutations in the two rAT gene glucocorticoid response elements located adjacent to the APRE led to loss of interleukin-1 inducibility. Induction of luciferase activity in transfected cells occurred even in the presence of cycloheximide, demonstrating that this synergistic response did not depend on new protein synthesis. Thus, a direct interaction between the interleukin-1-inducible NF kappa B-binding APRE and glucocorticoid response elements, located in cis, underlies the acute-phase activation of the rAT gene.

An inducible 50-kilodalton NF kappa B-like protein and a constitutive protein both bind the acute-phase response element of the angiotensinogen gene.

The rat angiotensinogen gene is induced in the course of the hepatic acute-phase response. We demonstrate that monocyte conditioned medium can stimulate transcription of a stably introduced reporter construct driven by 615 base pairs of the angiotensinogen 5'-flanking sequence, as well as the endogenous gene, in Reuber H35 cells. Point mutations of a cis-acting element, located 545 base pairs from the transcription start site and sharing sequence identity with known nuclear factor kappa B (NF kappa B)-binding sites, led to loss of cytokine inducibility. When cloned upstream of a minimal promoter, this cis-acting element imparted transcriptional inducibility by monocyte conditioned medium, interleukin-1, and tumor necrosis factor on a luciferase reporter gene in HepG2 cells. Two distinct proteins bound this element in vitro: a heat-stable, constitutively present, hepatic nuclear protein that gave rise to a DNase I-protected footprint covering the functionally defined element; and a binding protein of different mobility, induced by monocyte conditioned medium, which also recognized the NF kappa B-binding site of the murine kappa light-chain enhancer. UV cross-linking showed this inducible protein to have an apparent molecular mass of 50 kilodaltons, similar to that described for NF kappa B and distinct from the constitutively present protein that was shown by Southwestern (DNA-protein) blot to have a molecular mass of 32 kilodaltons. Methylation interference analysis showed that the induced species made contact points with guanine residues in the NF kappa B consensus sequence typical of NF kappa B. Induction of this binding activity did not require new protein synthesis, and 12-O-tetradecanoylphorbol-13-acetate could mimic the induction by cytokines. We thus provide direct evidence for involvement of NF kappa B or a similar factor in the hepatic acute-phase response and discuss the potential role of the presence of a constitutive nuclear factor binding the same cis element.

Targeting Chromatin Remodeling in Inflammation and Fibrosis.

Mucosal surfaces of the human body are lined by a contiguous epithelial cell surface that forms a barrier to aerosolized pathogens. Specialized pattern recognition receptors detect the presence of viral pathogens and initiate protective host responses by triggering activation of the nuclear factor κB (NFκB)/RelA transcription factor and formation of a complex with the positive transcription elongation factor (P-TEFb)/cyclin-dependent kinase (CDK)9 and Bromodomain-containing protein 4 (BRD4) epigenetic reader. The RelA·BRD4·P-TEFb complex produces acute inflammation by regulating transcriptional elongation, which produces a rapid genomic response by inactive genes maintained in an open chromatin configuration engaged with hypophosphorylated RNA polymerase II. We describe recent studies that have linked prolonged activation of the RelA-BRD4 pathway with the epithelial-mesenchymal transition (EMT) by inducing a core of EMT corepressors, stimulating secretion of growth factors promoting airway fibrosis. The mesenchymal state produces rewiring of the kinome and reprogramming of innate responses toward inflammation. In addition, the core regulator Zinc finger E-box homeodomain 1 (ZEB1) silences the expression of the interferon response factor 1 (IRF1), required for type III IFN expression. This epigenetic silencing is mediated by the Enhancer of Zeste 2 (EZH2) histone methyltransferase. Because of their potential applications in cancer and inflammation, small-molecule inhibitors of NFκB/RelA, CDK9, BRD4, and EZH2 have been the targets of medicinal chemistry efforts. We suggest that disruption of the RelA·BRD4·P-TEFb pathway and EZH2 methyltransferase has important implications for reversing fibrosis and restoring normal mucosal immunity in chronic inflammatory diseases.

NF-kappaB/RelA transactivation is required for atypical protein kinase C iota-mediated cell survival.

In chronic myelogenous leukemia (CML), the oncogene bcr-abl encodes a dysregulated tyrosine kinase that inhibits apoptosis. We showed previously that human erythroleukemia K562 cells are resistant to antineoplastic drug (taxol)-induced apoptosis through the atypical protein kinase C iota isozyme (PKC iota), a kinase downstream of Bcr-Abl. The mechanism(s) by which PKC iota mediates cell survival to taxol is unknown. Here we demonstrate that PKC iota requires the transcription factor nuclear factor-kappaB (NF-kappaB) to confer cell survival. At apoptosis-inducing concentrations, taxol weakly induces IkappaB(alpha) proteolysis and NF-kappaB translocation in K562 cells, but potently induces its transcriptional activity. Inhibition of NF-kappaB activity (by blocking IkappaB(alpha) degradation) significantly sensitizes cells to taxol-induced apoptosis. Likewise, K562 cells expressing antisense PKC iota mRNA or kinase dead PKC iota (PKC iota-KD) are sensitized to taxol; these cells are rescued from apoptosis by NF-kappaB overexpression. Expression of constitutively active PKC iota (PKC iota-CA) upregulates NF-kappaB transactivation and rescues cells from apoptosis in the absence of Bcr-Abl tyrosine kinase activity. Using a chimeric GAL4-RelA transactivator, we find that taxol potently activates GAL4-RelA-dependent transcription. This activation was further upregulated by expression of PKC iota-CA and inhibited by expression of PKC iota-KD. Our results indicate that RelA transactivation is an important downstream target of the PKC iota-mediated Bcr-Abl signaling pathway and is required for resistance to taxol-induced apoptosis.

Role of signal transducers and activators of transcription 1 and -3 in inducible regulation of the human angiotensinogen gene by interleukin-6.

The circulating level of angiotensinogen (AGT) is dynamically regulated as an important determinant of blood pressure and electrolyte homeostasis. Because the mechanisms controlling the regulated expression of human angiotensinogen (hAGT) are unknown, we investigated the inducible regulation of the hAGT gene in well differentiated HepG2 cells. Interleukin-6 (IL-6) stimulation produced a 3.2-fold increase in hAGT mRNA peaking at 96 h after stimulation. Deletional mutagenesis of the hAGT promoter in transient transfection assays identified an IL-6 response domain between nucleotides -350 and -122 containing three reiterated motifs, termed human acute phase response elements (hAPREs). Although mutation of each site individually caused a fall in IL-6-inducible luciferase activity, mutation of all three sites was required to block the IL-6 effect. Electrophoretic mobility shift assay (EMSA), supershift, and microaffinity DNA binding assays indicate IL-6-inducible high-affinity binding of signal transducers and activators of transcription 1 and -3 (STAT1 and -3) to hAPRE1 and -3 but only low-affinity binding to hAPRE2. Expression of a dominant-negative form of STAT3, but not STAT1, produced a concentration-dependent reduction in IL-6-induced hAGT transcription and endogenous mRNA expression. These data indicate that STAT3 plays a major role in hAGT gene induction through three functionally distinct hAPREs in its promoter and suggest a mechanism for its up-regulation during the acute-phase response.

Angiotensinogen gene activation by angiotensin II is mediated by the rel A (nuclear factor-kappaB p65) transcription factor: one mechanism for the renin angiotensin system positive feedback loop in hepatocytes.

The renin-angiotensin system controls blood pressure through the enzymatic production of the vasopressor angiotensin II (AII) from the angiotensinogen (AGT) precursor. Intravascular AII production stimulates de novo synthesis of its precursor in a positive feedback loop through increased gene expression. In this study, we investigate the effects of AII on AGT gene expression. At nanomolar concentrations, All activates transcription of the native AGT gene; this region is mapped to the AGT gene multihormone-inducible enhancer (-615 to -470). Within the multihormone-inducible enhancer, site-directed mutations of the acute-phase response element (APRE) that interfere with nuclear factor-kappa B (NF-kappa B) transcription factor binding also abolish All responsiveness. The APRE functions as a rapidly inducible All-inducible enhancer with peak reporter activity detected after a 4-h stimulation; this effect occurs only when the type 1 AII receptor is expressed. All induces sequence-specific NF-KB binding to the APRE in HepG2 nuclear extracts. Moreover, AII infusions of primary rat hepatocyte cultures produces a rapid 4-fold increase in sequence-specific NF-kappa B binding to the APRE. Antibodies against the transcriptional activator subunit, Rel A, quantitatively supershift the nucleoprotein complex, whereas antibodies to other NF-kappa B members do not, demonstrating that Rel A APRE-binding activity is AII-inducible. Transient overexpression of Rel A(1-551) activates the AGT multihormone-inducible enhancer. AII-inducible domains of Rel A were mapped by cotransfecting a chimeric GAL4-Rel A fusion protein with a reporter gene containing GAL4-binding sites. GAL4-Rel A(1-551) was an AII-inducible transactivator. Deletion of the NH(2)-terminal 254 amino acids of Rel A produces a constitutive transactivator, indicating that Rel A is activated by AII in a manner dependent on its NH(2) terminus. These studies define one mechanism for the renin-angiotensin system positive feedback loop in hepatocyctes.

Differentiation-specific element: a cis-acting developmental switch required for the sustained transcriptional expression of the angiotensinogen gene during hormonal-induced differentiation of 3T3-L1 fibroblasts to adipocytes.

The gene encoding angiotensinogen, the glycoprotein precursor for the vasopressor angiotensin II, is under coordinate tissue-specific, developmental, and hormonal regulation. We show here that the irreversible, developmentally regulated increase in angiotensinogen gene expression during the hormonal (dexamethasone, insulin, and isobutylmethylxanthine) differentiation of fibroblast-like 3T3-L1 cells into adipocytes is mediated by a 14-base pair cis-acting element located at -1000 in the 5'-flanking region of the gene. The sequence of this differentiation-specific element (DSE) is similar to sites that bind the homeotic and pou class of transcription factors found in the promoters of other genes known to be regulated during differentiation. Furthermore, we show that there are several high affinity DSE-specific binding proteins present in preadipocyte nuclear extracts that are competed with known homeotic and pou transcription factor DNA binding sequences. Thus the DSE appears to serve as a developmental switch for the expression of the angiotensinogen gene during the differentiation of fibroblasts to adipocytes and may be a binding site for one or more of the pou-homeodomain class of transcription factors.

Multiple cis-acting DNA regulatory elements mediate hepatic angiotensinogen gene expression.

Angiotensinogen is the glycoprotein precursor of angiotensin II, an octapeptide hormone important for the regulation of blood pressure and volume homeostasis. The gene encoding angiotensinogen is expressed in liver and several other tissues, providing a model gene for understanding the role of cis-acting DNA control elements and trans-acting factors in tissue-type specific gene expression. To identify DNA control elements in the rat angiotensinogen gene we prepared an array of fusion genes consisting of either 5' or 3'-deleted sequences of the 5'-flanking region of the gene linked to a firefly luciferase reporter gene and analyzed the relative cellular specificity of expression of these genes after their introduction into hepato-carcinoma cells (Hep G2) that do express and placental cells (JEG-3) that do not express the endogenous angiotensinogen gene. Six transcriptionally active elements were found within 688 base pairs of 5'-flanking DNA. The interactions of DNA binding proteins with these elements was demonstrated by their specific protection to digestion with DNase I in the presence of liver cell extracts. The orientation and spatial requirements for transcription of two of the elements were analyzed further by the construction and expression of synthetic oligonucleotide cassettes incorporating the sequences of these elements when linked to a homologous (angiotensinogen) or a heterologous Simian virus 40 promoter and enhancer. One element located between 60 and 108 base pairs from the start of gene transcription functioned either as a silencer or an enhancer of transcription (SOAP box element), depending upon the distance from the angiotensinogen and viral gene promoters. Moreover, the SOAP box element demonstrated enhancer activity in JEG-3 cells when linked to the Simian virus 40 early promoter. An oligonucleotide mutation of the SOAP box element interfered with protein binding in a gel mobility shift assay and this mutant was transcriptionally inactive in both homologous and heterologous promoters. These observations indicate that expression of the angiotensinogen gene in liver cells is coordinately regulated by multiple cis-acting elements that interact with DNA binding proteins.

Synergistic enhansons located within an acute phase responsive enhancer modulate glucocorticoid induction of angiotensinogen gene transcription.

The hepatic transcription of the angiotensinogen gene is regulated by both glucocorticoids and cytokines generated as products of the acute phase reaction. We have identified a multimodular enhancer in the 5'-flanking region of the rat angiotensinogen gene that mediates these responses and consists of an acute phase response element (APRE) flanked on both sides by adjacent glucocorticoid response element consensus motifs (GREs). Induction of transcription by the cytokine interleukin-1 (IL-1) is glucocorticoid dependent and mediated through the APRE. The APRE binds in a mutually exclusive manner a cytokine/phorbol ester-inducible protein (BPi), indistinguishable from nuclear factor kB, and a family of constitutive liver proteins (BPcs) related to the heat-stable transcription factor C/EBP. Using mutated 5'-flanking sequences of the angiotensinogen gene fused to a firefly luciferase reporter gene transfected into hepatoblastoma (HepG2) cells, we have mapped enhanson sequences required for the transcriptional response to glucocorticoids. Two functionally distinct GREs are identified by deletion and site-directed mutagenesis, both of which mediate glucocorticoid-stimulated transcription in vivo. Glucocorticoid-induced transcription mediated by the angiotensinogen gene enhancer is, furthermore, dependent on the occupancy of the APRE by either the BPi or a member of the BPc family because a mutant APRE that binds neither BPi nor BPc exhibits an attenuated glucocorticoid responsiveness. Mutant APREs that permit exclusive binding of either BPi or BPc synergistically transmit the glucocorticoid response mediated by one or the other of the adjacent GREs. Thus, the induction of angiotensinogen gene transcription involves interaction between the glucocorticoid receptor and either one of the APRE-binding proteins: either the cytokine-inducible NFkB or the constitutive family of C/EBP-like proteins, bound to adjacent enhansons in a mutually synergistic enhancer complex.

A novel glucocorticoid receptor binding element within the murine c-myc promoter.

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Angiotensin II induces nuclear factor (NF)-kappaB1 isoforms to bind the angiotensinogen gene acute-phase response element: a stimulus-specific pathway for NF-kappaB activation.

The vasopressor angiotensin II (AII) activates transcriptional expression of its precursor, angiotensinogen. This biological "positive feedback loop" occurs through an angiotensin receptor-coupled pathway that activates a multihormone-responsive enhancer of the angiotensinogen promoter, termed the acute-phase response element (APRE). Previously, we showed that the APRE is a cytokine [tumor necrosis factor-alpha (TNFalpha)]- inducible enhancer by binding the heterodimeric nuclear factor-kappaB (NF-kappaB) complex Rel A x NF-kappaB1. Here, we compare the mechanism for NF-kappaB activation by the AII agonist, Sar1 AII, with TNFalpha in HepG2 hepatocytes. Although Sar1 AII and TNFalpha both rapidly activate APRE-driven transcription within 3 h of treatment, the pattern of inducible NF-kappaB binding activity in electrophoretic mobility shift assay is distinct. In contrast to the TNFalpha mechanism, which strongly induces Rel A x NF-kappaB1 binding, Sar1 AII selectively activates a heterogenous pattern of NF-kappaB1 binding. Using a two-step microaffinity DNA binding assay, we observe that Sar1 AII recruits 50-, 56-, and 96-kDa NF-kappaB1 isoforms to bind the APRE. Binding of all three NF-kappaB1 isoforms occurs independently of changes in their nuclear abundance or proteolysis of cytoplasmic IkappaB inhibitors. Phorbol ester-sensitive protein kinase C (PKC) isoforms are required because PKC down-regulation completely blocks AII-inducible transcription and inducible NF-kappaB1 binding. We conclude that AII stimulates the NF-kappaB transcription factor pathway by activating latent DNA-binding activity of NF-kappaB subunits through a phorbol ester-sensitive (PKC-dependent) mechanism.

Tumor necrosis factor increases the rate of lipolysis in primary cultures of adipocytes without altering levels of hormone-sensitive lipase.

To investigate the effects of cytokines on adipocyte lipolysis, a macrophage cell line (RAW 264.7) was treated with Escherichia coli lipopolysaccharide (1 microgram/ml) for 18 h to induce cytokine release. Conditioned medium (5%, vol/vol) from these cells was added to rat epididymal adipocytes isolated and incubated under sterile conditions. After incubation, the adipocytes were washed, and the rate of lipolysis (glycerol release) was determined after a further 1-h incubation. The conditioned medium caused an approximately 2.7-fold increase in lipolysis, detectable after 6-12 h, maximal by 24 h, and reversible by 48 h after washing the cells. The effect of conditioned medium was reversed by a neutralizing antibody to mouse tumor necrosis factor-alpha (TNF alpha), and the direct addition of recombinant human TNF alpha (0.1-50 ng/ml) reproduced the effect, with a half-maximally effective concentration of approximately 3 ng/ml. The effect of TNF on the expression of hormone-sensitive lipase (HSL; the rate-limiting enzyme for lipolysis) was investigated by Western immunoblots using an antibody raised to a bacterially expressed 96-amino acid portion of the HSL enzyme. TNF treatment did not alter the concentration of immunoreactive HSL. From these data we conclude that 1) macrophages release a cytokine(s) in response to lipopolysaccharide that stimulates lipolysis in freshly isolated adipocytes; 2) TNF alpha can account for most, or perhaps all, of this effect; 3) TNF alpha increases the rate of lipolysis by a mechanism that does not involve increased expression of HSL. Based on the time-dependent aspects of TNF alpha stimulation and the lack of change in immunoreactive HSL, the findings suggest a TNF-induced posttranslational modification of the enzyme.

Inhibition of proteasome activity blocks the ability of TNF alpha to down-regulate G(i) proteins and stimulate lipolysis.

Prolonged treatment of rat adipocytes with TNF alpha increases lipolysis through a mechanism mediated, in part, by down-regulation of inhibitory G proteins (G(i)). Separately, down-regulation of G(i) by prolonged treatment with an A(1)-adenosine receptor agonist, N(6)-phenylisopropyl adenosine (PIA) increases lipolysis. To investigate the role of proteolysis in TNF alpha and PIA-mediated G(i) down-regulation and stimulation of lipolysis, we used the protease inhibitors lactacystin (proteasome inhibitor) and calpeptin (calpain inhibitor). Rat adipocytes were preincubated for 1 h with lactacystin (10 microM) or calpeptin (50 microM), before 30-h treatment with either TNF alpha (50 ng/ml) or PIA (300 nM). We then measured lipolysis (glycerol release), abundance of alpha-subunits of G(i)1 and G(i)2 in plasma membranes (Western blotting) and protease activities (in specific fluorogenic assays). TNF alpha and PIA stimulated lipolysis approximately 2-fold and caused G(i) down-regulation. Although neither lactacystin nor calpeptin affected basal lipolysis, lactacystin completely inhibited both TNF alpha and PIA-stimulated lipolysis (the 50% inhibitory concentration was approximately 2 microM), whereas calpeptin had no effect. Similarly, lactacystin but not calpeptin blocked both PIA and TNF alpha-induced G(i) down-regulation. These findings provide further evidence that the chronic lipolytic effect of TNF alpha and PIA is secondary to G(i) down-regulation and suggest that the mechanism involves proteolytic degradation mediated through the proteasome pathway.

Mechanisms for inducible control of angiotensinogen gene transcription.

The intravascular renin-angiotensin system is an endocrine system designed to maintain cardiovascular homeostasis in response to hypotension. Under normal conditions, angiotensinogen concentrations circulating in the plasma are rate limiting for the maximum velocity of angiotensin I formation. In the liver, the major site of circulating angiotensinogen synthesis, angiotensinogen expression is under exquisite hormonal control. We review the mechanisms by which hormones effect transcriptional control of angiotensinogen expression. Adrenal-derived glucocorticoids produce the translocation of the glucocorticoid receptor into the nucleus. It in turn binds to two glucocorticoid response elements and stimulates angiotensinogen gene transcription. Inflammation activates angiotensinogen transcription as a result of the macrophage-derived cytokines interleukin-1 and tumor necrosis factor-alpha. These cytokines change the abundance of two transcription factor families that bind a single regulatory site in the angiotensinogen promoter, the acute-phase response element. These proteins include the nuclear factor-kappaB complex and the CCAAT/enhancer binding protein family. Activation of the renin-angiotensin system, through production of angiotensin II, results in feedback stimulation of angiotensinogen synthesis (the "positive feedback loop"). We have discovered that the nuclear factor-kappaB transcription factor is regulated by angiotensin II, a finding that provides a mechanism for the transcriptional component of angiotensinogen gene synthesis in the positive feedback loop. These studies underscore the concept that induction of the angiotensinogen gene by diverse physiological stimuli is mediated through changes in the nuclear abundance of sequence-specific transcription factors. The intracellular convergence of cytokine- and angiotensin II-induced signaling pathways on the nuclear factor-kappaB transcription factor provides a point for "cross talk" between angiotensin- and cytokine-activated second messenger pathways.

Tumor necrosis factor activates angiotensinogen gene expression by the Rel A transactivator.

Angiotensinogen encodes the only known precursor of angiotensin II, a critical regulator of the cardiovascular system. Transcriptional control of angiotensinogen in hepatocytes is an important regulator of circulating angiotensinogen concentrations. Angiotensinogen transcription is increased by the inflammatory cytokine tumor necrosis factor (TNF)-alpha by a nuclear factor-kappaB-like protein binding to an inducible enhancer called the acute-phase response element. By gel mobility shift assays, we observe two specific acute-phase response element-binding complexes, C1 and C2. The abundance of C2 is not changed by TNF treatment. In contrast, C1 is faintly detected in untreated cells, and its abundance increases by fivefold after stimulation. We identify the nuclear factor-kappaB subunits in these complexes using subunit-specific antibodies in the gel mobility "supershift" assay. The transcriptionally inert nuclear factor-kappaB DNA-binding subunit NF-kappaB1 is present in both control and stimulated hepatocyte nuclei. Its abundance changes weakly upon TNF stimulation. In contrast, the potent transactivating protein Rel A is not found in unstimulated hepatocyte nuclei and is recruited by TNF-alpha into the C1 DNA-binding complex. Overexpression of Rel A results in acute-phase response element transcription. Cotransfection of a chimeric GAL4-Rel A protein with GAL4 DNA-binding sites is a strategy that allows for selective study of Rel A. The GAL4:Rel A chimera is a TNF-alpha-inducible transactivator. Deletion of the amino-terminal 254 amino acids of Rel A produces a constitutive activator (that is no longer TNF-alpha inducible). The cytokine induction of Rel A, then, is mediated through its amino-terminal 254 amino acids. We conclude that Rel A:NF-kappaB1 is a crucial cytokine-inducible transcription factor complex regulating angiotensinogen gene synthesis in hepatocytes and may be involved in controlling the activity of the renin-angiotensin system.

Recovery of parathyroid hormone secretion after parathyroid adenomectomy.

Using a sensitive two-site immunoradiometric assay which detects only intact human PTH-(1-84), we studied the kinetics of PTH secretion in 19 patients undergoing unilateral neck exploration and removal of a parathyroid adenoma. Preoperative serum PTH values averaged 116 ng/L (normal, 12-65 ng/L). In 8 patients in whom intraoperative sampling was performed, clearance of PTH-(1-84) was rapid, with virtual disappearance of PTH by 120 min after clamping the vascular pedicle to the adenoma. Analysis of the rate of disappearance of PTH-(1-84) indicated an exponential decay with a half-life of 21 min. Thirteen of 19 patients had serum PTH values less than 1 ng/L within 8 h after parathyroidectomy. Recovery of PTH secretion from the suppressed nonsurgically manipulated parathyroid tissue occurred during the nadir of postoperative hypocalcemia. Serum PTH was greater than 10 ng/L in 16 of 19 patients 30 h after removal of the PTH adenoma. Therefore, the functional recovery of atrophic parathyroid tissue is more rapid than that of other endocrine tissues studied to date.