First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 µm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 µm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

Serum vitamin C concentration is low in peripheral arterial disease and is associated with inflammation and severity of atherosclerosis.

BACKGROUND: Peripheral arterial disease (PAD) is a severe atherosclerotic condition frequently accompanied by inflammation and oxidative stress. We hypothesized that vitamin C antioxidant levels might be low in PAD and are related to inflammation and disease severity. METHODS AND RESULTS: We investigated vitamin C (L-ascorbic acid) levels in 85 PAD patients, 106 hypertensives without PAD, and 113 healthy subjects. Serum L-ascorbic acid concentrations were low among PAD patients (median, 27.8 micromol/L) despite comparable smoking status and dietary intake with the other groups (P<0.0001). Subclinical vitamin C deficiency (<11.4 micromol/L), confirmed by low serum alkaline phosphatase activity, was found in 14% of the PAD patients but not in the other groups. Serum C-reactive protein (CRP) concentrations were significantly higher in PAD patients (P<0.0001) and negatively correlated with L-ascorbic acid levels (r=-0.742, P<0.0001). In stepwise multivariate analysis, low L-ascorbic acid concentration in PAD patients was associated with high CRP level (P=0.0001), smoking (P=0.0009), and shorter absolute claudication distance on a standardized graded treadmill test (P=0.029). CONCLUSIONS: Vitamin C concentrations are lower in intermittent claudicant patients in association with higher CRP levels and severity of PAD. Future studies attempting to relate vitamin C levels to disease occurrence should include in their analysis an inflammatory marker such as CRP.

Assessment of myocardial ischemia by 12-lead electrocardiography and Frank vector system during coronary angioplasty: value of a new orthogonal lead system for quantitative ST segment monitoring.

The optimal number and placement of electrocardiographic (ECG) leads to detect myocardial ischemia induced by coronary balloon inflation was assessed by analyzing ST segment changes in the standard 12-lead ECG and Frank X, Y, Z leads at 90-s intervals during 34 consecutive coronary angioplasty procedures. Mean occlusion time during angioplasty was 218 +/- 65 s. Myocardial ischemia, defined as transient angina or ST segment deviation greater than or equal to 1 mm in at least one lead, occurred in 33 (97%) of the 34 procedures. The most sensitive single leads (V2 or V3) detected 17 (51%) of 33 ischemic episodes. The best dual-lead combinations (leads V2 and V5, leads a VF and V3 and leads V3 and Y) increased the sensitivity of 69% (23 of 33). The three-lead combination V2, V5, Y had the highest detecting power (78% [26 of 33]). The X, Y, Z leads by themselves had a sensitivity of only 60% (20 of 33). From this proposed orthogonal lead system (V2, V5, Y), which combines anteroposterior (V2), left to right (V5) and inferosuperior (Y) forces, the spatial ST vector magnitude was calculated and monitored during balloon inflations. A good correlation was observed between this ST vector magnitude and the sum of ST deviations on the standard ECG (r = 0.940, p less than 0.00001), and these data were reproducible over sequential balloon inflations. The results of the study suggest that this orthogonal lead system is of considerable value in the detection and quantification of acute myocardial ischemia and, in this respect, is more useful than the Frank orthogonal vector system.

Circulatory changes in muscle and skin arteries in primary hypertension.

This review deals with circulatory adjustments occurring in the limb arteries of hypertensive patients. Measurements of regional blood flow are mandatory, because conclusions drawn from calculated total peripheral resistance often are not applicable to local vascular beds. Limb arteries, which can be followed by easy and noninvasive methods, often are the first choice for study of regional circulation. In this discussion, a few historic studies are cited first; next, the data available on skeletal muscle (forearm and calf) and skin (finger) circulation are reviewed, to show that flow through both muscle and skin is increased in mild and moderate hypertension, while there is a trend to lower values in more severe hypertension. Our own data are derived from 51 untreated patients showing mild to moderate hypertension, matched to 23 normotensive subjects. Flow is measured simultaneously with an ECG-triggered venous occlusion plethysmograph at calf and finger. At rest, calf and finger blood flows are significantly higher and calculated resistance is lower in hypertensive subjects; during reactive hyperemia, blood flow remains higher in hypertensive subjects but calculated resistance increases up to values that are higher, compared to normotensive control subjects; these data are compatible with structural changes in the vascular wall.

International study of ketanserin in Raynaud's phenomenon.

PURPOSE: The effects of ketanserin on primary or secondary Raynaud's phenomenon due to connective tissue disease were studied in a large, international group of patients. PATIENTS AND METHODS: The study population consisted of 222 patients from 10 countries. After a run-in period of one month of placebo therapy, patients were randomly assigned in a double-blind manner to receive ketanserin 40 mg three times daily (n = 113) or placebo (n = 109) for three months. Total finger blood flow was measured in 41 patients in a warm and cool room before and during treatment. Vasospastic episodes were assessed by diaries and global evaluations. RESULTS: A significant reduction of 34% in frequency of episodes occurred with ketanserin, compared to 18% with placebo (p = 0.011). There was a 1% reduction in duration of episodes with ketanserin therapy, compared to a 2% increase with placebo therapy, but this finding was not statistically significant (p = 0.29). No difference was observed in severity of attacks. Global evaluations by investigators (p = 0.03) and patients (p less than 0.01) showed an overall benefit with ketanserin compared to that seen with placebo. Patients with primary or secondary Raynaud's phenomenon responded similarly to treatment. No changes in total finger blood flow were found. CONCLUSION: Ketanserin significantly improves the subjective symptoms of patients with primary or secondary Raynaud's phenomenon and is an appropriate agent to use in this disease when conservative measures fail.

Impaired microcirculation in mild-to-moderate essential arterial hypertension.

OBJECTIVE: The aim of this study was to correlate capillary morphology and erythrocyte velocity to blood pressure in mild-to-moderate essential arterial hypertension. DESIGN: Ambulatory blood pressure measurement may provide more precise information about a patient's mean blood pressure than office measurements. METHODS: Fifteen patients with recently diagnosed, previously untreated mild-to-moderate essential hypertension underwent 24-h ambulatory blood pressure recording and a capillaroscopic examination of finger microcirculation. Erythrocyte velocity was determined by the flying spot technique. RESULTS: Both mean 24-h ambulatory systolic blood pressure (SBP) and mean 24-h ambulatory diastolic blood pressure (DBP) were significantly inversely correlated with capillary erythrocyte velocity. However, the correlation between erythrocyte velocity and office SBP and office DBP was less significant. Capillary length was related to 24-h ambulatory DBP but not to office DBP. Capillary number was not related to any blood pressure parameter. CONCLUSIONS: These results indicate that, in patients with mild-to-moderate essential hypertension, erythrocyte velocity is significantly lower than for matched controls. It is also inversely related to mean 24-h ambulatory SBP and 24-h ambulatory DBP.

Relationship between left ventricular mass index and 24-h urinary free cortisol and cortisone in essential arterial hypertension.

OBJECTIVE: Besides arterial blood pressure, nonhemodynamic factors are known to induce cardiac hypertrophy. In Cushing's syndrome, severe ventricular hypertrophy has been linked not only to increased aortic pressure, but also to elevated plasma cortisol. The aim of this study was to examine the relationship between the cortisol/cortisone levels and left ventricular mass index (LVMI) in essential arterial hypertension with and without echocardiographic left ventricular hypertrophy (LVH). DESIGN: Eighteen untreated Caucasian patients (nine men, nine women, mean age 48+/-6 years) with essential hypertension (163+/-26/100+/-14 mm Hg) were enrolled. An age-matched control group of 13 subjects (seven men, six women) with normotension (121+/-9/79+/-7 mm Hg) were enrolled also. Left ventricular dimensions were echocardiographically assessed and cortisol production evaluated by 24-h urinary free cortisol and cortisone concentrations. RESULTS: LVMI averaged 115+/-31 g/m2 and 24-h urinary free cortisol and cortisone were 23+/-14 microg per 24 h and 31+/-18 microg per 24 h. Prevalence of echocardiographic LVH was 56%. LVMI correlated significantly with 24-h urinary free cortisol (r = 0.61, P = 0.007) and cortisone (r = 0.60, P = 0.009). Patients with echocardiographic LVH were characterized by higher daytime ambulatory blood pressure, LVMI (particularly the posterior wall), and 24-h urinary cortisol, while office blood pressure, septal: posterior wall ratio and 24-h urinary cortisone were comparable in all patients. In control individuals, LVMI averaged 91+/-18 g/m2 and 24-h urinary free cortisol and cortisone, respectively, were 34.7+/-6.6 microg per 24 h and 64.3+/-10.8 microg per 24 h (P<0.05 versus patients). Neither LVMI nor the contributing ventricular dimensions showed significant correlation with 24-h urinary free cortisol or cortisone in the control group. CONCLUSIONS: Our data provide evidence for a significant relationship between LVMI and cortisol production independently of arterial blood pressure in untreated mild to moderate hypertension.

Haptoglobin polymorphism and complications in established essential arterial hypertension.

OBJECTIVE: Salt sensitivity and the magnitude of systolic blood pressure have been linked to haptoglobin (Hp) polymorphism in normotensives. The aim of the present study was to investigate the indices of hypertension, the severity of complications and the occurrence of coronary and peripheral artery disease for the various haptoglobin phenotypes and their relation to the therapeutic needs (number and class of drugs) of established arterial hypertensives. DESIGN: Haptoglobin polymorphism was studied in 302 Caucasians with established essential arterial hypertension who had been treated for at least 1 year. METHODS: Haptoglobin polymorphism was studied using starch-gel electrophoresis of haemoglobin-supplemented serum. RESULTS: The relative allele frequencies of Hp 1 and Hp 2 (0.036 and 0.640, respectively) in established hypertensives were comparable with those of the control population. Logistic regression analysis confirmed that Hp 2-2 contributes to the therapeutic needs in hypertension. The most important factors determining therapeutic needs were coronary artery disease, Hp 2-2 phenotype, body mass index (BMI) and left ventricular hypertrophy. Although no contributive effect of serum haptoglobin concentration could be derived from the logistic regression approach, analysis of serum haptoglobin concentration demonstrated a concentration-related effect on therapeutic needs for the Hp 2-2 phenotype only. CONCLUSIONS: The present study suggests that hypertensives with an Hp 2-2 phenotype need more complex combinations of antihypertensive drugs to reduce blood pressure to the same level. The hypertensive patient carrying Hp 2-2 is more likely to accumulate atherosclerotic lesions of the coronary or peripheral arteries, despite comparable lipid levels, smoking habits and BMI. Hp 1-1 patients are characterized by a younger age at diagnosis and a lower complication rate. In view of the greater therapeutic needs and the higher complication rate, Hp 2-2 hypertensives need more careful follow-up.

Twenty-four hour ambulatory blood pressure in the Hypertension Optimal Treatment (HOT) study.

BACKGROUND AND AIMS: The Hypertension Optimal Treatment (HOT) study showed that when antihypertensive treatment reduces diastolic blood pressure well below 90 mmHg, there can be a further reduction of cardiovascular events, particularly myocardial infarction, with no evidence of a J-shaped curve at lower pressures. Office measurement, however, gives no information about blood pressure outside the office. This paper describes a HOT substudy in which patients underwent both office measurement and 24 h ambulatory blood pressure monitoring. METHODS: The mean age of the substudy population was 62 +/- 7 years. Substudy patients were treated for a median period of 2 years. All received the dihydropyridine calcium antagonist felodipine, while some also received an ACE-inhibitor, a beta-blocker or a diuretic. Average 24 h, day and night ambulatory blood pressure values were computed at baseline (n = 277) and during treatment (n = 347): 112 patients had been randomized to a target office diastolic blood pressure

Peripheral action of spironolactone: plethysmographic studies.

The relation between vasodilation and the blood pressure-reducing action of spironolactone was studied in a randomized, placebo-controlled, double-blind, crossover study using 9 patients with essential hypertension. Vasodilation was studied by measuring blood flow in finger and calf (representative of skin and muscle circulation) by an electrocardiographic-triggered venous-occlusion plethysmograph. Treatment with spironolactone (100 mg twice daily for 4 weeks) produced significant decreases in systolic and diastolic blood pressure without significantly affecting heart rate. Blood flow through finger and calf increased, sometimes markedly, in 6 of the 9 patients, while vascular resistance decreased. This study confirms that the antihypertensive action of spironolactone is associated with vasodilation in many patients.

Delayed restoration of atrial function after conversion of atrial flutter by pacing or electrical cardioversion.

It is often suggested but never proven that atrial function is not affected during atrial flutter, nor after its conversion to normal sinus rhythm. To evaluate this hypothesis, a prospective study was performed in 22 patients (age range 20 to 88 years) with atrial flutter. Diastolic transmitral flow was analyzed with echo-Doppler before and after conversion. After randomization, conversion was attempted with overdrive pacing or up to two 50 J shocks. If the initial method was unsuccessful, a 200 J shock was administered. All patients were converted to sinus rhythm with this protocol. Shortly after conversion (at 1 and 6 hours), atrial contribution to ventricular filling was absent in 4 of 22 patients. In the remaining 18 patients, atrial contribution to ventricular filling was small. Atrial contribution to transmitral flow improved from 20 to 27% within 24 hours (p < 0.01) and increased further to 38% at 6 weeks (p < 0.005). Peak velocity of late diastolic filling increased from 0.28 m/s after 1 hour to 0.39 m/s after 24 hours (p < 0.0001) and improved even further during later follow-up. In 1 patient, an effective atrial systole was not observed until the 14th day. Cardiac output did not change significantly during the study period. No differences were observed between the conversion modalities. In conclusion, atrial dysfunction is present immediately after conversion of atrial flutter to normal sinus rhythm. This dysfunction occurs also after overdrive pacing and can last > 1 week. The findings suggest that stasis in the atria can remain temporarily present after successful conversion of atrial flutter to sinus rhythm.

Comparison of athletes with life-threatening ventricular arrhythmias with two groups of healthy athletes and a group of normal control subjects.

Sudden cardiac death in well-trained athletes is most often superimposed on the presence of structural heart disease. However, some athletes die suddenly in the absence of overt heart disease. To improve identification of athletes at high risk for ventricular tachycardia (VT), ventricular repolarization, the signal-averaged electrocardiogram (ECG), and the echocardiogram from 13 male athletes with symptomatic VT and without evidence of manifest cardiac disease were compared with data obtained in 3 matched control groups (15 apparently healthy professional road cyclists, 10 professional basketball players, and 15 normal control subjects without any sports activity). All patients had apparently normal QRS duration on the routine ECG, and none were taking antiarrhythmic drugs. Echocardiography and signal-averaged electrocardiography were useful in distinguishing the group of athletes with tachyarrhythmias from the group of normal nonsporting controls, but not from both groups of normal athletes. The QT interval (V4) and the QT interval corrected with the cubic root were shorter for the nonsporting controls. Three parameters for QT dispersion showed significant differences (p < 0.003) between athletes with disease and all other groups. It is concluded that although significant differences were detected between normal subjects and the 3 groups of athletes by routine ECG, the signal-averaged ECG, and echocardiography, only an increased QT dispersion from the 12-lead ECG was helpful in distinguishing athletes with VT from other athletes.

Inverse relation between aldosterone and venous capacitance in chronically treated congestive heart failure.

The purpose of this study was to examine if there is a relation between the aldosterone escape phenomenon and venous capacitance of the upper and lower limbs in patients with long-term congestive heart failure (CHF) receiving chronic treatment with angiotensin-converting enzyme (ACE) inhibitors. The study group consisted of 16 subjects with ischemic CHF in New York Heart Association functional class II (age 59 +/-2 years, ejection fraction 24+/-4%), stabilized under a constant drug regimen comprising furosemide, captopril 50 mg 3 times daily, and digoxin for at least 3 months. Thirteen apparently healthy volunteers, aged 50+/-4 years acted as controls. Forearm and calf venous capacitances were measured simultaneously by venous occlusion plethysmography using mercury-in-silastic strain gauges. The equilibration technique was used to derive venous capacitance from the recorded pressure-volume curves. Active renin, angiotensin II, and aldosterone levels were determined on venous blood samples obtained in the supine position. Angiotensin II (p<0.05) and aldosterone (p<0.01) were statistically significantly higher in patients with CHF under long-term ACE inhibition than in controls (aldosterone escape phenomenon). In CHF, forearm venous capacitance was 2.19+/-0.18 ml/100 ml; calf venous capacitance was 2.83+/-0.27 ml/100 ml. Aldosterone significantly and inversely correlated with venous capacitance in both upper (r = -0.586; p = 0.017) and lower (r = -0.625; p = 0.01) limbs. No correlations were found between forearm or calf venous capacitance and renin or angiotensin II. In patients with heart failure chronically treated with diuretics and full ACE inhibition, venous capacitance is inversely correlated with aldosterone through the mechanism of aldosterone escape, creating the potential for further deterioration of the CHF process.

Variations of autonomic tone preceding onset of atrial fibrillation after coronary artery bypass grafting.

Assessment of autonomic tone preceding the onset of atrial fibrillation (AF) after coronary artery bypass grafting (CABG) with heart rate variability was examined in 64 patients scheduled for elective CABG (days 2 to 5). Ninety-six-hour Holter tapes were analyzed in each patient and all events labeled by an experienced technician. The hour preceding AF was divided into 4 quarters (heart rate variability calculated per quarter) and compared with similar time episodes from the group without AF. Twenty-six of 64 patients (40%) had a total of 35 episodes. Only increased age (68+/-5 vs 62+/-9 years) and lower ejection fraction (66+/-16% vs 73+/-8%) were associated with an increased risk for AF. Before onset, a greater number of atrial premature complexes was observed. The standard deviation of all RR intervals (SDNN) showed an increase in the group with AF in the last 15 minutes (significant vs controls and within the AF group). The low-frequency/high-frequency ratio was significantly lower in patients in the first 30 minutes, followed by an increase mainly because the high-frequency spectrum became less important. Thus, initiation of postoperative AF is influenced by autonomic tone variations. A shift in the autonomic balance with a loss of vagal tone and a moderate increase in sympathetic tone are observed before the onset of AF compared with those in controls.

Influence of the arterial blood pressure and nonhemodynamic factors on left ventricular hypertrophy in moderate essential hypertension.

In a group of 36 untreated patients with mild to moderate essential hypertension (office systolic and diastolic blood pressures (BPs) 160 +/- 3.4 and 102 +/- 1.5 mm Hg, respectively), a 24-hour ambulatory BP monitoring and determination of left ventricular (LV) mass index according to the formula of Devereux were performed. After an overnight fast, blood samples were taken for the determination of serum aldosterone, plasma renin activity and serum parathyroid hormone. Urinary catecholamines were sampled for 24 hours. LV mass index (143.7 +/- 8 g/m2) did not correlate significantly either with office systolic or diastolic BP. The correlation of LV mass index with mean 24-hour systolic BP (145 +/- 3 mm Hg) was statistically significant: r = 0.395, p = 0.026. However, the best correlation was obtained with mean 24-hour diastolic BP (90 +/- 3 mm Hg) with r = 0.500 (p = 0.004). Urinary catecholamines were not correlated with LV mass index. LV mass index correlated significantly with plasma renin activity (r = 0.346, p = 0.050), and aldosterone (r = 0.559, p = 0.001). There was a very significant correlation between LV mass index and parathyroid hormone (r = 0.719, p = 0.00001) even after adjustment for mean 24-hour systolic and diastolic BPs. These results clearly demonstrate that ambulatory BP determinants but not office BP parameters are well correlated with LV hypertrophy in essential hypertension. Nonhemodynamic factors are important determinants of LV mass as well. Besides the renin-angiotensin-aldosterone system, parathyroid hormone appears to play an important role in cardiac hypertrophy.

Influence of arterial blood pressure and aldosterone on left ventricular hypertrophy in moderate essential hypertension.

In a group of 36 untreated patients with mild-to-moderate essential hypertension (office systolic blood pressure [SBP] 160 +/- 3.4 mm Hg, office diastolic blood pressure [DBP], 102 +/- 1.5 mm Hg), 24-hour ambulatory blood pressure monitoring, and determination of left ventricular (LV) mass index according to the formula of Devereux were performed. After an overnight fast, blood samples were taken for the determination of serum aldosterone levels and plasma renin activity. Urinary catecholamine concentrations were assayed from 24-hour urine collections. Left ventricular mass index (143.7 +/- 8 g/m2) did not correlate significantly with either office SBP or office DBP. The correlation of LV mass index with mean 24-hour SBP (145 +/- 3 mm Hg) was statistically significant: r = 0.395, p = 0.026. However, the best correlation was obtained with mean 24-hour DBP (90 +/- 3 mm Hg) with r = 0.499 (p = 0.004). Urinary catecholamine levels did not correlate with LV mass index. In addition, LV mass index correlated significantly with plasma renin activity (r = 0.346, p = 0.050) and serum aldosterone levels (r = 0.559, p = 0.0009). There was a strongly significant correlation between LV mass index and serum aldosterone levels even after adjustment for mean 24-hour SBP (r = 0.496, p = 0.005) and DBP (r = 0.514, p = 0.004). These results demonstrate that ambulatory blood pressure determinations but not office blood pressure parameters correlate well with left ventricular hypertrophy in essential hypertension. Nonhemodynamic factors are important determinants of left ventricular mass as well.(ABSTRACT TRUNCATED AT 250 WORDS)

Hemodynamic and renal effects of atrial natriuretic peptide in congestive heart failure.

The hemodynamic and renal effects of anaritide (human atrial natriuretic peptide 102-126), a synthetic analog of atrial natriuretic peptide, were evaluated in 35 patients with chronic New York Heart Association class II to IV heart failure. There were 32 men and 3 women, aged 33 to 75 (mean +/- standard error of the mean 56 +/- 2) years. In the first phase of the study, right-sided heart catheterization was performed, and anaritide was administered as 1-hour infusions. The rate of the infusion varied among patients from 0.03 to 0.3 micrograms/kg/min. In response to anaritide, there were decreases in mean systemic arterial (94 +/- 2 to 87 +/- 2 mm Hg), right atrial (10 +/- 1 to 8 +/- 1 mm Hg), mean pulmonary arterial (33 +/- 2 to 28 +/- 2 mm Hg) and pulmonary artery wedge (22 +/- 2 to 15 +/- 2 mm Hg) pressures (all p less than 0.05). Cardiac index increased (2.39 +/- 0.15 to 2.62 +/- 0.15 liters/min/m2, p less than 0.05) and heart rate was unchanged. Systemic vascular resistance decreased significantly, but pulmonary vascular resistance was unchanged. There were increases in urine volume (1.6 +/- 0.2 to 2.3 +/- 0.4 ml/min), sodium excretion (47 +/- 13 to 74 +/- 20 muEq/min) and fractional excretion of sodium (0.41 +/- 0.11 to 0.59 +/- 0.14%, all p less than 0.05), while potassium excretion and creatinine clearance did not change. In the second phase of the study, patients received 2-hour infusions of anaritide (0.03 to 0.6 micrograms/kg/min) and placebo with noninvasive monitoring.(ABSTRACT TRUNCATED AT 250 WORDS)

[Current pharmaco-therapeutic strategies in the treatment of arterial hypertension]. / Stratégies pharmaco-thérapeutiques actuelles dans le traitement de l'hypertension artérielle.

The aim of the treatment of hypertensive disease is to reduce its associated cardiovascular morbidity and mortality. Simply reducing blood pressure levels is clearly not adequate since its impact on coronary heart disease is particularly unsatisfactory. Moreover, the beneficial effects of antihypertensive treatment seem to plateau for several years, and the incidence of cardiac and renal failure is even increasing. Therefore, recommendations by groups of national or international experts are periodically updated on the basis of current epidemiological data. Two such recommendations appeared in 1997, one from the Agence Nationale d'Accréditation et d'Evaluation en Santé (ANAES) in France and the other from the Joint National Committee (JNC) on Prevention, Detection, Evaluation and Treatment of High Blood Pressure, in the United States. Both advocate the use of lifestyle modifications in all patients. The threshold blood pressure level at which pharmacological therapy is introduced largely depends on associated cardiovascular risk factors and/or involvement of target organs. The JNC recommends a particularly low threshold in patients with diabetes. Pharmacological treatment is usually initiated with a single drug. The choice of any one drug depends on the patient profile and takes into consideration such characteristics as age and associated risk factors or comorbidity. Some represent a contraindication for certain therapeutic classes (for example, asthma for beta-blockers, renovascular hypertension for ACE inhibitors), while others are a specific or even 'compelling' indication (heart failure, angina, renal disease, peripheral vascular disease etc.). This patient profiling is very precisely described in the new recommendations. However, any such single drug therapy provides adequate blood pressure control in no more than about 50 to 60% of patients. When the patient does not respond to the drug used or experiences side effects, substitution of a drug from another pharmacological class is recommended. In contrast, if the patient is a responder but blood pressure remains above the target level, it is preferable to add a second drug from a class offering complementary action. The use of a combination therapy allows blood pressure control in more than 80% of patients. More authors are suggesting that combination therapy as first-line treatment may increase the number of responders and reduce the impact of counter-regulatory effects occurring with single drug therapy (e.g. sodium retention, or sympathetic activation). This alternative strategy is now acknowledged in the recommendations.

Effect of felodipine and metoprolol on muscle and skin arteries in hypertensive patients.

The antihypertensive and vasodilator effects of felodipine, a new calcium antagonist of the dihydropyridine group, were examined in 15 patients with moderate to severe hypertension. Flow was measured simultaneously at the calf and finger using a venous occlusion ECG-triggered plethysmograph. Measurements were made at rest, during handgrip and during reactive hyperaemia. Felodipine (12.5 mg, orally) was given after placebo treatment and after 3 weeks' treatment with metoprolol. It was also given for 3 weeks in combination with metoprolol. Felodipine caused a significant decrease in blood pressure which was similar in the supine, sitting and standing positions without causing any orthostatic reaction. The antihypertensive effect was accompanied by an increase in heart rate, dilatation of calf arteries and, to a lesser degree, dilatation of finger arteries. However, the degree of vasodilatation diminished with long term treatment. Metoprolol prevented the increase in heart rate but not vasodilatation. Felodipine decreased the potential for further dilatation in certain situations, as shown during reactive hyperaemia, although vasoconstrictor responses during the handgrip test remained unimpaired.

Anti-myosin humoral immune response following cardiac injury.

A sensitive and highly specific ELISA assay was developed to determine the anti-myosin humoral immune response (AMA) in various heart diseases: acute viral myocarditis, infective endocarditis, acute myocardial infarction, and valve and coronary bypass surgery. The mean study entry AMA titer of each patient group was already significantly increased compared with age matched controls. During further follow-up (90 d) all the groups except for endocarditis showed a significant increase of AMA titer compared with their entry titer. Anti-myosin antibody titer were higher after cardiac surgery than after myocardial infarction or inflammatory heart disease. These results suggest that anti-myosin immune response is not limited to infectious processes in which the pathogen induces antibodies which cross-react with heart constituents but is merely caused by direct cardiac injury. Myosin as a major compound of heart cellular proteins turned out to be a good candidate to trigger immune response after cardiac injury.