RESUMO
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
Assuntos
COVID-19 , Vacinas Virais , Humanos , SARS-CoV-2/genética , Transdução de Sinais , RNA Mensageiro/genéticaRESUMO
Cytosolic recognition of microbial DNA in macrophages results in the activation of the interferon (IFN)-dependent antiviral innate immunity. Here, we examined whether activating DNA sensors in peripheral blood monocyte-derived macrophages (MDMs) can inhibit human immunodeficiency virus (HIV). We observed that the stimulation of MDMs with poly(dA:dT) or poly(dG:dC) (synthetic ligands for the DNA sensors) inhibited HIV infection and replication. MDMs treated with poly(dA:dT) or poly(dG:dC) expressed higher levels of both type I and type III IFNs than untreated cells. Activation of the DNA sensors in MDMs also induced the expression of the multiple intracellular anti-HIV factors, including IFN-stimulated genes (ISGs: ISG15, ISG56, Viperin, OAS2, GBP5, MxB, and Tetherin) and the HIV restriction microRNAs (miR-29c, miR-138, miR-146a, miR-155, miR-198, and miR-223). In addition, the DNA sensor activation of MDM upregulated the expression of the CC chemokines (RANTES, MIP-1α, MIP-1ß), the ligands for HIV entry coreceptor CCR5. These observations indicate that the cytosolic DNA sensors have a protective role in the macrophage intracellular immunity against HIV and that targeting the DNA sensors has therapeutic potential for immune activation-based anti-HIV treatment.
Assuntos
Infecções por HIV , HIV-1 , MicroRNAs , Humanos , Infecções por HIV/metabolismo , HIV-1/fisiologia , Células Cultivadas , Macrófagos , MicroRNAs/genética , MicroRNAs/metabolismo , DNA/metabolismo , Replicação ViralRESUMO
As a key immune cell in the brain, microglia are essential for protecting the central nervous system (CNS) from viral infections, including HIV. Microglia possess functional Toll-like receptor 3 (TLR3), a key viral sensor for activating interferon (IFN) signaling pathway-mediated antiviral immunity. We, therefore, studied the effect of poly (I:C), a synthetic ligand of TLR3, on the activation of the intracellular innate immunity against HIV in human iPSC-derived microglia (iMg). We found that poly (I:C) treatment of iMg effectively inhibits HIV infection/replication at both mRNA and protein levels. Investigations of the mechanisms revealed that TLR3 activation of iMg by poly (I:C) induced the expression of both type I and type III IFNs. Compared with untreated cells, the poly (I:C)-treated iMg expressed significantly higher levels of IFN-stimulated genes (ISGs) with known anti-HIV activities (ISG15, MxB, Viperin, MxA, and OAS-1). In addition, TLR3 activation elicited the expression of the HIV entry coreceptor CCR5 ligands (CC chemokines) in iMg. Furthermore, the transcriptional profile analysis showed that poly (I:C)-treated cells had the upregulated IFN signaling genes (ISG15, ISG20, IFITM1, IFITM2, IFITM3, IFITM10, APOBEC3A, OAS-2, MxA, and MxB) and the increased CC chemokine signaling genes (CCL1, CCL2, CCL3, CCL4, and CCL15). These observations indicate that TLR3 is a potential therapy target for activating the intracellular innate immunity against HIV infection/replication in human microglial cells. Therefore, further studies with animal models and clinical specimens are necessary to determine the role of TLR3 activation-driven antiviral response in the control and elimination of HIV in infected host cells.
Assuntos
Infecções por HIV , Células-Tronco Pluripotentes Induzidas , Microglia , Receptor 3 Toll-Like , Humanos , Células Cultivadas , Imunidade Inata , Microglia/virologia , Poli I-C/farmacologia , Receptor 3 Toll-Like/genéticaRESUMO
Patients with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) infection manifest mainly respiratory symptoms. However, clinical observations frequently identified neurological symptoms and neuropsychiatric disorders related to COVID-19 (Neuro-SARS2). Accumulated robust evidence indicates that Neuro-SARS2 may play an important role in aggravating the disease severity and mortality. Understanding the neuropathogenesis and cellular mechanisms underlying Neuro-SARS2 is crucial for both basic research and clinical practice to establish effective strategies for early detection/diagnosis, prevention, and treatment. In this review, we comprehensively examine current evidence of SARS-CoV-2 infection in various neural cells including neurons, microglia/macrophages, astrocytes, pericytes/endothelial cells, ependymocytes/choroid epithelial cells, and neural stem/progenitor cells. Although significant progress has been made in studying Neuro-SARS2, much remains to be learned about the neuroinvasive routes (transneuronal and hematogenous) of the virus and the cellular/molecular mechanisms underlying the development/progression of this disease. Future and ongoing studies require the establishment of more clinically relevant and suitable neural cell models using human induced pluripotent stem cells, brain organoids, and postmortem specimens.
Assuntos
Encéfalo/virologia , COVID-19/patologia , Doenças do Sistema Nervoso/virologia , Neuroglia/virologia , Neurônios/virologia , Animais , Encéfalo/patologia , Linhagem Celular , Humanos , Doenças do Sistema Nervoso/patologia , Células-Tronco Neurais , Neuroglia/patologia , Neurônios/patologiaRESUMO
Monocytic-lineage cells in the central nervous system (CNS), including microglia and brain resident macrophages, are the key players in the CNS innate immunity against viral infections, including human immunodeficiency virus (HIV). However, these cells also serve as the major targets and reservoirs for HIV in the CNS. To address the question of how HIV can establish persistent infection in the target cells in the CNS, we examined whether HIV has the ability to counteract Toll-like receptor 3 (TLR3) activation-mediated antiviral immunity in microglia and macrophages. We observed that HIV latently infected microglial cells (HC69·5) expressed reduced levels of TLR3 and TLR3 activation-mediated interferons (IFN-α/ß and IFN-λ) as compared with the uninfected control cells (C20). In addition, HIV infection of primary human macrophages suppressed the expression of TLR3 and the IFNs. HIV infection also inhibited the expression of the antiviral IFN-stimulated genes (ISGs) and the HIV-restriction miRNAs. Mechanistically, HIV infection inhibited the phosphorylation of IFN regulatory factors (IRF3 and IRF7) and signal transducer and activator of transcription proteins (STAT1 and STAT3) in both HIV latently infected microglia and acutely infected macrophages. These findings provide previously unrecognized and sound mechanisms for HIV infection and persistence in the primary target and reservoir cells in the brain.
Assuntos
Infecções por HIV/imunologia , HIV-1/fisiologia , Macrófagos/imunologia , Microglia/imunologia , Linhagem Celular , Regulação da Expressão Gênica , Humanos , Tolerância Imunológica , Imunidade Inata , Fator Regulador 3 de Interferon/genética , Fator Regulador 3 de Interferon/metabolismo , Fator Regulador 7 de Interferon/genética , Fator Regulador 7 de Interferon/metabolismo , Interferons/genética , Interferons/metabolismo , Especificidade de Órgãos , Fator de Transcrição STAT1/genética , Fator de Transcrição STAT1/metabolismo , Fator de Transcrição STAT3/genética , Fator de Transcrição STAT3/metabolismo , Receptor 3 Toll-Like/metabolismoRESUMO
Although it has been shown that some mannose-binding lectins (MBLs) exhibit significant activity against HIV infection, little is known about whether N-acetylgalactosamine (GalNAc)-binding lectins have the ability to inhibit HIV infection. Here, we demonstrate that a soybean-derived lectin (SBL) with GalNAc-binding affinity could potently suppress HIV infection of macrophages in a dose-dependent fashion. Unlike the MBLs, which block HIV only through binding to the glycosylated envelope proteins (gp120 and gp41) of the virus, SBL inhibited HIV at multiple steps of the virus infection/replication cycle. SBL could activate the beta interferon (IFN-ß)-STAT signaling pathway, resulting in the upregulation of a number of antiviral interferon-stimulated genes (ISGs) in macrophages. In addition, SBL treatment of macrophages induced the production of C-C chemokines, which bind to HIV entry coreceptor CCR5. Deglycosylation of cell surface galactosyl moieties or presaturation of GalNAc-binding capacity could compromise SBL-mediated induction of the antiviral factors. Furthermore, SBL exerted its anti-HIV activity in the low nanomolar range with no mitogenic effect on CD4+ T cells, a major advantage in the development of SBL as a potential anti-HIV agent compared with MBLs. These data indicate a necessity to further investigate SBL as an alternative and cost-effective anti-HIV natural product.IMPORTANCE Mannose-binding lectins (MBLs) can block the attachment of HIV to target cells and have been suggested as anti-HIV microbicides. However, the mitogenic effect of MBLs on CD4+ T cells limits this potential in clinical settings. Lectins with galactose (Gal)- or N-acetylgalactosamine (GalNAc)-binding specificity are another important category of carbohydrate-binding proteins (CBP). Compared to high-mannose N-linked glycans, GalNAc-type glycans present much less in HIV gp120 or gp41 glycosylation. Here, we demonstrate that GalNAc-specific soybean lectin (SBL) triggers antiviral signaling via recognition of the cell surface galactosyl group of macrophages, which results in the suppression of HIV at multiple steps. More importantly, SBL has no mitogenic effect on the activation of CD4+ T cells, a major advantage in the development of Gal/GalNAc-specific lectins as naturopathic anti-HIV agents.
Assuntos
Fármacos Anti-HIV/farmacologia , Infecções por HIV/tratamento farmacológico , HIV-1/imunologia , Macrófagos/imunologia , Lectinas de Plantas/farmacologia , Proteínas de Soja/farmacologia , Internalização do Vírus/efeitos dos fármacos , Linfócitos T CD4-Positivos/imunologia , Linfócitos T CD4-Positivos/patologia , Proteína gp120 do Envelope de HIV/imunologia , Proteína gp41 do Envelope de HIV/imunologia , Infecções por HIV/imunologia , Infecções por HIV/patologia , HIV-1/patogenicidade , Humanos , Interferon beta/imunologia , Macrófagos/patologia , Macrófagos/virologia , Receptores CCR5/imunologia , Fatores de Transcrição STAT/imunologia , Transdução de Sinais/efeitos dos fármacos , Transdução de Sinais/imunologiaRESUMO
Interleukin (IL)-22, a member of the IL-10 family, plays a role in antiviral immune responses to a number of viral infections. However, it is unclear whether IL-22 is involved in the mucosal immunity against herpes simplex virus 2 (HSV-2) infection in the female reproductive tract (FRT). In this study, we studied whether IL-22 could inhibit HSV-2 infection of human cervical epithelial cells (End1/E6E7 cells). We showed that End1/E6E7 cells express the functional IL-22 receptor complex (IL-22R1 and IL-10R2). When treated with IL-22, End1/E6E7 cells expressed the higher levels of IFN-stimulated genes (ISGs: ISG15, ISG56, OAS-1, OAS-2, and Mx2) than untreated cells. In addition, IL-22-treated cells produced higher levels of the tight junction proteins (ZO-1 and Occludin) than untreated cells. Mechanistically, IL-22 could activate the JAK/STAT signaling pathway by inducing the phosphorylation of STAT1 and STAT3. These observations indicate the potential of IL-22 as an anti-HSV-2 agent in the FRT mucosal innate immunity against HSV-2 infection.
Assuntos
Colo do Útero/metabolismo , Células Epiteliais/metabolismo , Herpes Genital/metabolismo , Herpesvirus Humano 2/fisiologia , Interleucinas/metabolismo , Replicação Viral , Linhagem Celular , Colo do Útero/patologia , Colo do Útero/virologia , Células Epiteliais/patologia , Células Epiteliais/virologia , Feminino , Herpes Genital/patologia , Humanos , Subunidade beta de Receptor de Interleucina-10/metabolismo , Receptores de Interleucina/metabolismo , Interleucina 22RESUMO
Enterovirus 71 (EV71) possesses a single-stranded positive RNA genome that contains a single open reading frame (ORF) flanked by a 5' untranslated region (5'UTR) and a polyadenylated 3'UTR. Here, we demonstrated that EV71 activates the production of silent mating type information regulation 2 homolog 1 (SIRT1), a histone deacetylase (HDAC). EV71 further stimulates SIRT1 sumoylation and deacetylase activity, and enhances SIRT1 translocation from the nucleus to the cytoplasm. More interestingly, activated SIRT1 subsequently binds with the EV71 3Dpol protein (a viral RNA-dependent RNA polymerase, RdRp) to repress the acetylation and RdRp activity of 3Dpol, resulting in the attenuation of viral genome replication. Moreover, SIRT1 interacts with the cloverleaf structure of the EV71 RNA 5'UTR to inhibit viral RNA transcription, and binds to the internal ribosome entry site (IRES) of the EV71 5'UTR to attenuate viral RNA translation. Thus, EV71 stimulates SIRT1 production and activity, which in turn represses EV71 genome replication by inhibiting viral polymerase, and attenuates EV71 RNA transcription and translation by interfering with viral RNA. These results uncover a new function of SIRT1 and reveal a new mechanism underlying the regulation of EV71 replication.
Assuntos
Regiões 5' não Traduzidas/genética , Enterovirus Humano A/genética , Genoma Viral , Biossíntese de Proteínas , RNA Viral/metabolismo , RNA Polimerase Dependente de RNA/metabolismo , Sirtuína 1/metabolismo , Replicação Viral , Regiões 3' não Traduzidas/genética , Acetilação , Linhagem Celular , Núcleo Celular , Enterovirus Humano A/fisiologia , Humanos , Sítios Internos de Entrada Ribossomal , Modelos Biológicos , Conformação de Ácido Nucleico , Ligação Proteica , Proteínas Modificadoras Pequenas Relacionadas à Ubiquitina/metabolismo , SumoilaçãoRESUMO
Alcohol could compromise the anti-hepatitis C virus (HCV) function of interferon-alpha (IFN-α). However, little information is available about the effect of alcohol on interferon-lambda (IFN-λ, type III IFN), a novel candidate for development of therapy for HCV infection. Huh7 cells were infected with HCV JFH-1 virus, then treated with alcohol, and/or IFN-λ1. RT-PCR and Western blot were used to detect the levels of HCV and key cellular factors. Overexpression or silencing expression was performed to verify the role of key factors in alcohol-attenuated anti-HCV function of IFN-λ1. Alcohol treatment compromised anti-HCV effect of IFN-λ1 in HCV JFH-1-infected Huh7 cells, evidenced by the significantly increased levels of HCV RNA, and HCV core protein in alcohol-/IFN-λ1-treated cells compared to cells with IFN-λ1 treatment alone. Investigation of the mechanisms responsible for the alcohol action revealed that alcohol enhanced the expression of protein inhibitor of activated STAT (PIASy). Overexpression of PIASy compromised anti-HCV ability of IFN-λ1, whereas silencing expression of PIASy partly restored the alcohol-attenuated anti-HCV effect of IFN-λ1. More importantly, overexpression of PIASy significantly down-regulated the level of IFN-λ1-indcued phosphorylation of STAT1 (p-STAT1), an important adaptor in IFN-λ pathway, as well as reduced the expression of IFN-λ1-induced IFN-stimulated genes 56 (ISG56), and myxovirus resistance 1 (Mx1), two antiviral effectors in in IFN-λ pathway. These findings indicate that alcohol, through inducing the expression of negative regulator in IFN-λ pathway, inhibits IFN-λ-mediated anti-HCV action in human hepatic cells, which may lead to the poor efficacy of IFN-λ-based therapy against HCV infection.
Assuntos
Álcoois/metabolismo , Hepacivirus/imunologia , Hepatócitos/imunologia , Interleucinas/antagonistas & inibidores , Proteínas de Ligação a Poli-ADP-Ribose/biossíntese , Proteínas Inibidoras de STAT Ativados/biossíntese , Regulação para Cima , Western Blotting , Linhagem Celular , Perfilação da Expressão Gênica , Hepacivirus/crescimento & desenvolvimento , Hepatócitos/efeitos dos fármacos , Hepatócitos/virologia , Humanos , Interferons , RNA Viral/análise , Reação em Cadeia da Polimerase em Tempo Real , Proteínas do Core Viral/análiseRESUMO
The recently discovered IFN-λ4 has been found to have antiviral activity against several viruses. However, it's unknown whether IFN-λ4 can inhibit HIV infection. Here, we show that IFN-λ4 could suppress HIV infection of macrophages. This IFN-λ4-mediated HIV inhibition was compromised by the antibodies against IFN-λ receptor complex, IFN-λR1/IL-10R2. IFN-λ4 enhanced the phosphorylation of STAT1, and induced antiviral interferon-stimulated genes. These findings indicated that IFN-λ4 can inhibit HIV via JAK/STAT signalling pathway.
Assuntos
Fármacos Anti-HIV/farmacologia , Infecções por HIV/imunologia , Subunidade beta de Receptor de Interleucina-10/metabolismo , Interleucinas/metabolismo , Interleucinas/farmacologia , Macrófagos/imunologia , Macrófagos/virologia , Receptores de Citocinas/metabolismo , Infecções por HIV/metabolismo , Infecções por HIV/virologia , Humanos , Técnicas In Vitro , Macrófagos/metabolismo , Receptores de Interferon , Proteínas Recombinantes/farmacologia , Fator de Transcrição STAT1/metabolismo , Transdução de Sinais , Replicação Viral/imunologiaRESUMO
BACKGROUND: The CRISPR/Cas9 system has been widely used for genome editing in mammalian cells. CXCR4 is a co-receptor for human immunodeficiency virus type 1 (HIV-1) entry, and loss of CXCR4 function can protect cells from CXCR4 (X4)-tropic HIV-1 infection, making CXCR4 an important target for HIV-1 gene therapy. However, the large size of the CRISPR/SpCas9 system presents an obstacle to its efficient delivery into primary CD4+ T cells. Recently, a small Staphylococcus aureus Cas9 (SaCas9) has been developed as a genome editing tool can address this question. Therefore, it provides a promising strategy for HIV-1 gene therapy if it is used to target CXCR4. RESULTS: Here, we employed a short version of Cas9 from Staphylococcus aureus (SaCas9) for targeting CXCR4. We demonstrated that transduction of lenti-virus expressing SaCas9 and selected single-guided RNAs of CXCR4 in human CD4+ T cell lines efficiently induced the editing of the CXCR4 gene, making these cell lines resistant to X4-tropic HIV-1 infection. Moreover, we efficiently transduced primary human CD4+ T cells using adeno-associated virus-delivered CRISPR/SaCas9 and disrupted CXCR4 expression. We also showed that CXCR4-edited primary CD4+ T cells proliferated normally and were resistant to HIV-1 infection. CONCLUSIONS: Our study provides a basis for possible application of CXCR4-targeted genome editing by CRISPR/SaCas9 in HIV-1 gene therapy.
Assuntos
Linfócitos T CD4-Positivos/virologia , Sistemas CRISPR-Cas/genética , Resistência à Doença/genética , Edição de Genes/métodos , Infecções por HIV/genética , Receptores CXCR4/genética , Staphylococcus aureus/enzimologia , Linfócitos T CD4-Positivos/metabolismo , Células Cultivadas , Endonucleases/metabolismo , Regulação da Expressão Gênica , Técnicas de Inativação de Genes , Células HEK293 , Infecções por HIV/metabolismo , Infecções por HIV/virologia , HIV-1 , Interações Hospedeiro-Patógeno/genética , Humanos , Células Jurkat , Receptores CXCR4/metabolismoRESUMO
Exosomes are a class of cell-released small vesicles that mediate intercellular communication by delivering functional factors to recipient cells. During hepatitis C virus (HCV) infection, the interaction between liver resident macrophages and hepatocytes is a key component in liver innate immunity. In this study, we explored the role of exosomes in the delivery of innate anti-HCV factors to hepatocytes from macrophages. We showed that supernatant from TLR3-activated macrophage cultures could efficiently inhibit HCV replication in Huh7 cells. This macrophage-mediated anti-HCV activity was through exosomes because inhibiting exosomes could abrogate the action of macrophages. Further analyses demonstrated that TLR3-activated macrophages release exosomes that contain anti-HCV microRNA (miRNA)-29 family members. Inhibiting miRNA29 could restore HCV replication. These findings suggest a novel antiviral mechanism in liver innate immunity against HCV infection and provide insights to support further studies on developing exosome-based delivery system for disease treatment.-Zhou, Y., Wang, X., Sun, L., Zhou, L., Ma, T.-C., Song, L., Wu, J.-G., Li, J.-L., Ho, W.-Z. Toll-like receptor 3-activated macrophages confer anti-HCV activity to hepatocytes through exosomes.
Assuntos
Comunicação Celular/imunologia , Exossomos/virologia , Hepacivirus/fisiologia , Hepatócitos/virologia , Macrófagos/metabolismo , Receptor 3 Toll-Like/metabolismo , Linhagem Celular Tumoral , Exossomos/metabolismo , Humanos , Imunidade Inata/imunologia , Fígado/virologia , Replicação Viral/fisiologiaRESUMO
Bluetongue virus (BTV), a nonenveloped double-stranded RNA virus, is a potent inducer of type Ι interferons in multiple cell systems. In this study, we report that BTV16 treatment of primary human macrophages induced both type I and III IFN expression, resulting in the production of multiple antiviral factors, including myxovirus resistance protein A, 2',5'-oligoadenylate synthetase, and the IFN-stimulated gene 56. Additionally, BTV-treated macrophages expressed increased HIV restriction factors (apolipoprotein B mRNA-editing enzyme catalytic polypeptide 3 G/F/H) and CC chemokines (macrophage inflammatory protein 1-α, macrophage inflammatory protein 1-ß, regulated on activation of normal T cell expressed and secreted), the ligands for HIV entry coreceptor CC chemokine receptor type 5. BTV16 also induced the expression of tetherin, which restricts HIV release from infected cells. Furthermore, TLR3 signaling of macrophages by BTV16 resulted in the induction of several anti-HIV microRNAs (miRNA-28, -29a, -125b, -150, -223, and -382). More importantly, the induction of antiviral responses by BTV resulted in significant suppression of HIV in macrophages. These findings demonstrate the potential of BTV-mediated TLR3 activation in macrophage innate immunity against HIV.
Assuntos
Vírus Bluetongue/fisiologia , HIV/patogenicidade , Interferons/metabolismo , Macrófagos/virologia , Transdução de Sinais , Receptor 3 Toll-Like/metabolismo , Antígenos CD/genética , Células Cultivadas , Quimiocinas/genética , Proteínas Ligadas por GPI/genética , Expressão Gênica/fisiologia , Humanos , Imunidade Inata , Macrófagos/imunologiaRESUMO
The use of animal models has been invaluable for studying the pathogenesis of Mycobacterium tuberculosis infection, as well as for testing the efficacy of vaccines and drug regimens for tuberculosis. Among the applied animal models, nonhuman primates, particularly macaques, share the greatest anatomical and physiological similarities with humans. As such, macaque models have been used for investigating tuberculosis pathogenesis and preclinical testing of drugs and vaccines. This review focuses on published major studies which illustrate how the rhesus and cynomolgus macaques have enriched and may continue to advance the field of global tuberculosis research.
Assuntos
Tuberculose Latente/prevenção & controle , Tuberculose Latente/veterinária , Macaca fascicularis/imunologia , Macaca mulatta/imunologia , Tuberculose Pulmonar/prevenção & controle , Tuberculose Pulmonar/veterinária , Animais , Modelos Animais de Doenças , História do Século XX , História do Século XXI , Humanos , Tuberculose Latente/imunologia , Tuberculose Latente/fisiopatologia , Macaca fascicularis/virologia , Macaca mulatta/virologia , Mycobacterium tuberculosis/imunologia , Especificidade da Espécie , Vacinas contra a Tuberculose/administração & dosagem , Vacinas contra a Tuberculose/história , Tuberculose Pulmonar/imunologia , Tuberculose Pulmonar/fisiopatologiaRESUMO
STUDY HYPOTHESIS: Is it possible to immunologically activate human cervical epithelial cells to produce antiviral factors that inhibit herpes simplex virus type 2 (HSV-2) replication? STUDY FINDING: Our results indicate that human cervical epithelial cells possess a functional TLR3/RIG-I signaling system, the activation of which can mount an Interferon-λ (IFN-λ)-mediated anti-HSV-2 response. WHAT IS KNOWN ALREADY: There is limited information about the role of cervical epithelial cells in genital innate immunity against HSV-2 infection. STUDY DESIGN, SAMPLES/MATERIALS, METHODS: We examined the expression of toll-like receptors (TLRs) and retinoic acid-inducible I (RIG-I) in End1/E6E7 cells by real-time PCR. The IFN-λ induced by TLR3 and RIG-I activation of End1/E6E7 cells was also examined by real-time PCR and ELISA. HSV-2 infection of End1/E6E7 cells was evaluated by the real-time PCR detection of HSV-2 gD expression. The antibody to IL-10Rß was used to determine whether IFN-λ contributes to TLR3/RIG-I mediated HSV-2 inhibition. Expression of interferon regulatory factor 3 (IRF3), IRF7, IFN-stimulated gene 56 (ISG56), 2'-5'-oligoadenylate synthetase I (OAS-1) and myxovirus resistance A (MxA) were determined by the real-time PCR and western blot. End1/E6E7 cells were transfected with shRNA to knockdown the IRF3, IRF7 or RIG-I expression. Student's t-test and post Newman-Keuls test were used to analyze stabilized differences in the immunological parameters above between TLR3/RIG-I-activated cells and control cells. MAIN RESULTS AND THE ROLE OF CHANCE: Human cervical epithelial cells expressed functional TLR3 and RIG-I, which could be activated by poly I:C and 5'ppp double-strand RNAs (5'ppp dsRNA), resulting in the induction of endogenous interferon lambda (IFN-λ). The induced IFN-λ contributed to TLR3/RIG-I-mediated inhibition of HSV-2 replication in human cervical epithelial cells, as an antibody to IL-10Rß, an IFN-λ receptor subunit, could compromise TLR3/RIG-I-mediated inhibition of HSV-2. Further studies showed that TLR3/RIG-I signaling in the cervical epithelial cells by dsRNA induced the expression of the IFN-stimulated genes (ISGs), ISG56, 2'-5'-oligoadenylate synthetase I (OAS-1) and myxovirus resistance A (MxA), the key antiviral elements in the IFN signaling pathway. In addition, we observed that the topical treatment of genital mucosa with poly I:C could protect mice from genital HSV-2 infection. LIMITATIONS, REASONS FOR CAUTION: Future prospective studies with primary cells and suitable animal models are needed in order to confirm these outcomes. WIDER IMPLICATIONS OF THE FINDINGS: The findings provide direct and compelling evidence that there is intracellular expression and regulation of IFN-λ in human cervical epithelial cells, which may have a key role in the innate genital protection against viral infections. LARGE SCALE DATA: Not applicable. STUDY FUNDING AND COMPETING INTERESTS: This work was supported by the National Natural Science Foundation of China (81301428 to L.Z. and 81271334 to W.-Z.H.), the Fundamental Research Funds for the Central Universities (2042015kf0188 to L.Z.), the China Postdoctoral Science Foundation (2013M531745 to L.Z.), the Development Program of China ('973', 2012CB518900 to W.-Z.H.) from the Ministry of Science and Technology of the People's Republic of China, grants (DA12815 and DA022177 to W.-Z.H.) from the National Institute on Drug Abuse (NIDA) and the open project of Hubei Key Laboratory of Wudang Local Chinese Medicine Research (WDCM005 to M.S.). The authors declare no competing financial interests.
Assuntos
RNA Helicases DEAD-box/metabolismo , Células Epiteliais/virologia , Herpesvirus Humano 2/fisiologia , Receptor 3 Toll-Like/metabolismo , Replicação Viral/genética , Proteína DEAD-box 58 , RNA Helicases DEAD-box/genética , Células Epiteliais/metabolismo , Herpesvirus Humano 2/genética , Humanos , Poli I-C/genética , Estudos Prospectivos , Receptores Imunológicos , Transdução de Sinais/genética , Transdução de Sinais/fisiologia , Receptor 3 Toll-Like/genética , Replicação Viral/fisiologiaRESUMO
There is limited information about the role of blood-brain barrier (BBB) endothelial cells (ECs) in the central nervous system (CNS) and their innate immunity against HIV. We examined whether brain ECs can be immunologically activated to produce antiviral factors that inhibit HIV replication in macrophages. Human brain microvascular ECs expressed functional toll-like receptor 3 (TLR3) that could be activated by polyinosinic-polycytidylic acid (PolyI:C), resulting in the induction of endogenous interferon-ß (IFN-ß) and IFN-λ. The TLR3 activation of ECs also induced the phosphorylation of interferon regulatory transcription factor 3 (IRF3) and IRF7, the key regulators of IFN signaling pathway. When supernatant (SN) of PolyI:C-activated EC cultures was applied to infected macrophage cultures, HIV replication was significantly suppressed. This SN action of ECs on HIV was mediated through both IFN-ß and IFN-λ because antibodies to their receptors could neutralize the SN-mediated anti-HIV effect. The role of IFNs in EC-mediated anti-HIV activity is further supported by the observation that treatment with SN from EC cultures induced the expression of IFN-stimulated genes (ISGs: ISG56, OAS-1, and MxA) in macrophages. These observations indicate that brain microvascular ECs may be a key regulatory bystander, playing a crucial role in the BBB innate immunity against HIV infection.
Assuntos
Células Endoteliais/imunologia , HIV-1/imunologia , Interferon beta/imunologia , Interferon gama/imunologia , Macrófagos/imunologia , Replicação Viral/imunologia , Transporte Ativo do Núcleo Celular/efeitos dos fármacos , Transporte Ativo do Núcleo Celular/imunologia , Barreira Hematoencefálica/citologia , Barreira Hematoencefálica/imunologia , Barreira Hematoencefálica/metabolismo , Western Blotting , Encéfalo/irrigação sanguínea , Encéfalo/imunologia , Núcleo Celular/efeitos dos fármacos , Núcleo Celular/imunologia , Núcleo Celular/metabolismo , Células Cultivadas , Meios de Cultivo Condicionados/metabolismo , Meios de Cultivo Condicionados/farmacologia , Proteína DEAD-box 58 , RNA Helicases DEAD-box/genética , RNA Helicases DEAD-box/imunologia , RNA Helicases DEAD-box/metabolismo , Células Endoteliais/efeitos dos fármacos , Células Endoteliais/metabolismo , Humanos , Fator Regulador 3 de Interferon/imunologia , Fator Regulador 3 de Interferon/metabolismo , Fator Regulador 7 de Interferon/imunologia , Fator Regulador 7 de Interferon/metabolismo , Interferon beta/metabolismo , Interferon beta/farmacologia , Interferon gama/metabolismo , Interferon gama/farmacologia , Macrófagos/efeitos dos fármacos , Macrófagos/virologia , Microscopia de Fluorescência , Modelos Imunológicos , Poli I-C/imunologia , Poli I-C/farmacologia , Interferência de RNA , Receptores Imunológicos , Receptor 3 Toll-Like/imunologia , Receptor 3 Toll-Like/metabolismo , Replicação Viral/efeitos dos fármacosRESUMO
In recent years, many mumps outbreaks have occurred in vaccinated populations worldwide. The reasons for these outbreaks are not clear. Animal models are needed to investigate the causes of outbreaks and to understand the pathogenesis of mumps virus (MuV). In this study, we have examined the infection of three animal models with an isolate of mumps virus from a recent outbreak (MuV-IA). We have found that while both ferrets and mice generated humoral and cellular immune responses to MuV-IA infection, no obvious signs of illness were observed in these animals; rhesus macaques were the most susceptible to MuV-IA infection. Infection of rhesus macaques via both intranasal and intratracheal routes with MuV-IA led to the typical clinical signs of mumps 2 weeks to 4 weeks postinfection. However, none of the infected macaques showed any fever or neurologic signs during the experimental period. Mumps viral antigen was detected in parotid glands by immunohistochemistry (IHC). Rhesus macaques represent the best animal model for the study of mumps virus pathogenesis.
Assuntos
Modelos Animais de Doenças , Macaca mulatta , Vírus da Caxumba/patogenicidade , Caxumba/imunologia , Caxumba/fisiopatologia , Animais , Chlorocebus aethiops , Ensaio de Imunoadsorção Enzimática , Furões , Imuno-Histoquímica , Camundongos , Camundongos Endogâmicos BALB C , Caxumba/virologia , Testes de Neutralização , Glândula Parótida/virologia , Reação em Cadeia da Polimerase em Tempo Real , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Especificidade da Espécie , Células VeroRESUMO
Both bacteria product flagellin and macrophages are implicated in HIV-1 infection/disease progression. However, the impact of their interaction on HIV-1 infection and the associated mechanisms remain to be determined. We thus examined the effect of the flagellins on HIV-1 infection of primary human macrophages. We observed that the pretreatment of macrophages with the flagellins from the different bacteria significantly inhibited HIV-1 infection. The mechanistic investigation showed that the flagellin treatment of macrophages downregulated the major HIV-1 entry receptors (CD4 and CCR5) and upregulated the CC chemokines (MIP-1α, MIP-1ß and RANTES), the ligands of CCR5. These effects of the flagellin could be compromised by a toll-like receptor 5 (TLR5) antagonist. Given the important role of flagellin as a vaccine adjuvant in TLR5 activation-mediated immune regulation and in HIV-1 infection of macrophages, future investigations are necessary to determine the in vivo impact of flagellin-TLR5 interaction on macrophage-mediated innate immunity against HIV-1 infection and the effectiveness of flagellin adjuvant-based vaccines studies.
Assuntos
Flagelina , Infecções por HIV , HIV-1 , Macrófagos , Internalização do Vírus , Flagelina/imunologia , Humanos , Macrófagos/imunologia , Macrófagos/virologia , HIV-1/imunologia , HIV-1/fisiologia , Infecções por HIV/imunologia , Infecções por HIV/virologia , Internalização do Vírus/efeitos dos fármacos , Receptores CCR5/metabolismo , Receptor 5 Toll-Like/metabolismo , Quimiocinas CC/metabolismo , Quimiocinas CC/imunologia , Antígenos CD4/metabolismo , Células Cultivadas , Quimiocina CCL3/metabolismo , Quimiocina CCL5/metabolismo , Quimiocina CCL5/imunologia , Quimiocina CCL4/metabolismoRESUMO
Introduction: While astrocytes participate in the CNS innate immunity against herpes simplex virus type 1 (HSV-1) infection, they are the major target for the virus. Therefore, it is of importance to understand the interplay between the astrocyte-mediated immunity and HSV-1 infection. Methods: Both primary human astrocytes and the astrocyte line (U373) were used in this study. RT-qPCR and Western blot assay were used to measure IFNs, the antiviral IFN-stimulated genes (ISGs), IFN regulatory factors (IRFs) and HSV-1 DNA. IRF1 knockout or knockdown was performed with CRISPR/Cas9 and siRNA transfection techniques. Results: Poly(dA:dT) could inhibit HSV-1 replication and induce IFN-ß/IFN-λs production in human astrocytes. Poly(dA:dT) treatment of astrocytes also induced the expression of the antiviral ISGs (Viperin, ISG56 and MxA). Among IRFs members examined, poly(dA:dT) selectively unregulated IRF1 and IRF9, particularly IRF1 in human astrocytes. The inductive effects of poly(dA:dT) on IFNs and ISGs were diminished in the IRF1 knockout cells. In addition, IRF1 knockout attenuated poly(dA:dT)-mediated HSV-1 inhibition in the cells. Conclusion: The DNA sensors activation induces astrocyte intracellular innate immunity against HSV-1. Therefore, targeting the DNA sensors has potential for immune activation-based HSV-1 therapy.