Construction and Application of Copper Ion and Amino Acid Probe Based on Functionalized Metal-Organic Framework Probe.

The rapid development of fluorescence probe technology has promoted in-depth research in fields such as environment and life medicine. Traditional single channel fluorescent probes can achieve highly sensitive detection of targets, but they appear powerless in complex environments. In addition, in today's deteriorating resource environment, implementing multi target detection with one probe can effectively save preparation resources, which is in line with the development direction of fluorescent probes. To achieve this goal, designing and preparing multi-site probes is undoubtedly the first choice, but the complexity of their preparation is daunting. Herein, we propose the concept of cascade detection for the first time. After the probe completes the first target detection, the complex between the probe and the first target is achieved based on the characteristics of the first target to achieve subsequent target detection. Based on this, a metal-organic framework was used as a basic skeleton and the concept of serial reactions was applied. First, copper ions were detected through coordination. Then, the specificity of copper for sulfur-containing amino acids was utilized to detect the three types of amino acids, and the practical applications of the three probes were studied separately.

Multi-scene visual hydrazine hydrate detection based on a dibenzothiazole derivative.

Hydrazine (N2H4) produced by industries is distributed into different environments, and seriously threatens ecology and human security. Hence, it is important to develop probes that detect N2H4 in various environments. In this study, a novel N2H4 fluorescent probe was prepared based on a dibenzothiazole derivative (DBTD). The obtained DBTD probe demonstrated a strong ratio of colorimetric detection of N2H4, a rapid response, and good selectivity and sensitivity (detection limit 0.438 µM). Based on its good performance, the DBTD probe was successfully applied for the determination of trace N2H4 in water, cells, and zebrafish. In addition, the results of the fluorescence colocalization experiment demonstrated the lysosomal-targetable ability of DBTD.

Construction and Application of Multipurpose metal-organic frameworks -based Hydrogen Sulfide Probe.

Hydrogen sulfide (H2S) is a toxic gas derived from the sulfur industry and trace H2S in the environment can cause serious ecological damage while inhalation can cause serious damage and lead to disease. Therefore, the real-time and accurate detection of trace sulfur ions is of great significance for environmental protection and early disease detection. Considering the shortcoming of current H2S probes in terms of stability and sensitivity, the development of novel probes is necessary. Herein, a novel metal-organic frameworks (MOF)-based material, UiO-66-NH2@BDC, was designed and prepared for the visual detection of H2S with rapid response (< 6 s) and low detection limit of S2- (0.13 µM) by hydrogen bonding. Based on its good optical performance, the UiO-66-NH2@BDC probe can detect S2- in various water environments. More importantly, UiO-66-NH2@BDC probe realize imaging S2- in cells and live zebrafish.

Current radiotherapy for recurrent head and neck cancer in the modern era: a state-of-the-art review.

BACKGROUND: In the management of head and neck cancer (HNC) patients, local recurrence is a common cause of treatment failure. Only a few patients with recurrent HNC (rHNC) are eligible for salvage surgery and the majority of patients receive systemic therapy and radiotherapy. In recent years, with the development of irradiation technology, radiotherapy for rHNC patients has markedly attracted clinicians' attention and its therapeutic effects on patients with end-stage cancer are worthy of investigation as well. METHODS: Several studies have investigated the role of radiotherapy in the treatment of rHNC patients. We reviewed retrospective reports and prospective trials published in recent decades that concentrated on the management of rHNC. RESULTS: A growing body of evidence supported the application of irradiation to rHNC patients. According to the results of this review, current radiotherapy could achieve a better efficacy with a lower incidence of toxicity. CONCLUSION: Radiotherapy is a promising treatment for rHNC patients.

Preparation of novel fluorescent probe based on carbon dots for sensing and imaging Fe(III) and pyrophosphate in cells and zebrafish.

Ferric ions (Fe3+) and pyrophosphate anions (PPi) are involved in many physiological processes and play important roles in biological systems. The abnormal level of Fe3+ and PPi will cause serious damage to the environment and life. At present, the application of such probes in life, especially in vivo, is still very scarce. So, the development of a fluorescent probe to simultaneously detect Fe3+ and PPi has great significance to the health of the environment and organisms. Herein, nitrogen-doped carbon quantum dots (N-CDs) were synthesized via solvothermal treatment, using biuret and citric acid as precursors. The synthesized N-CDs showed highly selective and sensitive detection of Fe3+ through a photoluminescence quenching effect. The fluorescence of N-CDs quenched by Fe3+ could be restored with PPi, rendering the N-CDs/Fe3+ sensor promising for PPi detection ('OFF-ON'). The linear ranges of detection for Fe3+ and PPi were 3-30 and 2-12 µM, and the limits of detection were 2.71 and 1.12 µM, respectively. The practical applications of N-CDs were tested using tap water samples. Furthermore, N-CDs can be used for the detection and imaging of Fe3+ and PPi in HeLa cells and zebrafish owing to their excellent optical properties.

O-glycans on death receptors in cells modulate their sensitivity to TRAIL-induced apoptosis through affecting on their stability and oligomerization.

The TNF-related apoptosis-inducing ligand (TRAIL) triggers apoptosis in cells by signaling through the O-glycosylated death receptors (DR4 and DR5), but the sensitivity to TRAIL-induced apoptosis of cells varies, and the attributes of this phenomenon are complex. Human carcinoma cells often express truncated O-glycans, Tn (GalNAcα1-Ser/Thr), and Sialyl-Tn (Siaα2-6GalNAcα1-Ser/Thr, STn) on their surface glycoproteins, yet molecular mechanisms in terms of advantages for tumor cells to have these truncated O-glycans remain elusive. Normal extended O-glycan biosynthesis is regulated by a specific molecular chaperone Cosmc through assisting of the correct folding of Core 1 ß3 Galactosyltransferase (T-synthase). Here, we use tumor cell lines harboring mutations in Cosmc, and therefore expressing Tn and STn antigens to study the role of O-glycans in TRAIL-induced apoptosis. Expression of Tn and STn in tumor cells attenuates their sensitivity to TRAIL treatment; when transfected with wild-type Cosmc, these tumor cells thus express normal extended O-glycans and become more sensitive to TRAIL treatment. Mechanistically, Tn/STn antigens impair homo-oligomerization and stability of DR4 and DR5. These results represent the first mechanistic insight into how O-glycan structures on cell surface modulate their sensitivity to apoptotic stimuli, suggesting expression of Tn/STn may offer tumor cell survival advantages through altering DR4 and/or DR5 activity.

A Novel Coumarin-based Fluorescent Probe with Aggregation Induced Emission for Detecting CN- and its Applications in Bioimaging.

Although cyanogen ion (CN-) plays important role in industry which also bring acute environmental pollution. More serious, trace CN- enters the human body can cause serious consequences and even death. Therefore, it is of great significance to detect trace CN- with high sensitivity. Herein, a novel aggregation-induced emission (AIE) probe C-BH was synthesized based on coumarin matrix. Probe C-BH showed high selectivity and sensitivity toward CN- by dual channel response due to the excited state intramolecular proton transfer (ESIPT). The low detection limit was calculated to be 0.05 µM. Moreover, probe C-BH was successfully used for imaging CN- in living cells and zebrafish due to its low toxicity and excellent optical properties.

Disruption of Core 1-mediated O-glycosylation oppositely regulates CD44 expression in human colon cancer cells and tumor-derived exosomes.

Aberrant O-glycosylation truncates O-glycans and is known to be closely associated with colorectal cancer (CRC), a major gastrointestinal tumor. CD44 is one of the highly post-transcriptionally modified O-glycoproteins participating in a series of physiological and pathobiological processes. In this research, we aimed to investigate whether CD44 expression in cells and exosomes can be influenced by disruption of Core 1-mediated O-glycosylation. Exosomes derived from LS174T and LSC human colon cancer cell lines were isolated from cell culture supernatant and pulled down using tetraspanin-specific antibody CD63 immunoaffinity magnetic beads. Identifications have been performed via transmission electron microscopy (TEM) and flow cytometry. CD63 immunoaffinity-purified exosomes are examined for CD44 expression by flow cytometric analyses. The percentages of CD44 in exosomes derived from abnormally O-glycosylated cells are significantly higher compared with those derived from normal ones, however, which is surprisingly contrary to the cellular expression levels of CD44. The secretion of truncated glycoproteins to the extracellular environment via microvesicles may be most likely its underlying mechanism. CD44 in exosomes might be a potential biomarker of aberrant O-glycosylation. This is the first study indicating that aberrant O-glycosylation can affect expression or delivery of O-glycoproteins via exosomes, which provides us some new sights in therapeutic strategies for human colon cancer.

A mitochondria-targeted fluorescent probe for hypochlorite sensing and its application in bioimaging.

A coumarin-diaminomaleonitrile derivative (C-DAN) was designed and prepared. Upon addition of hypochlorite (OCl-), the fluorescence emission peak of C-DAN at 475 nm was gradually enhanced with a rapid response (within 5 s); meanwhile, the color of the solution changed from dark red to bright yellow which can be observed with the naked eye. Furthermore, owing to its advantages including high selectivity, sensitivity, and low toxicity, our C-DAN probe has been applied for detecting OCl- in living cells and zebrafish, indicating it is an ideal tool for biological applications.

The accuracy and safety of CT-guided iodine-125 seed implantation assisted by 3D non-coplanar template for retroperitoneal recurrent carcinoma.

PURPOSE: To investigate the accuracy, dosimetric parameters, and safety of 3D-printing non-coplanar template (3D-PNCT)-assisted CT guidance for radioactive iodine-125 (125I) seed implantation brachytherapy (RSI-BT) for retroperitoneal recurrent carcinomas METHODS AND MATERIALS: We enrolled 15 patients with 17 retroperitoneal recurrent carcinomas after external beam radiotherapy (EBRT). All patients received CT-guided 125I RSI-BT assisted by 3D-PNCT successfully. We compared the original needle insertion position, angular, and the needle tip distance deviations of preoperative plan with that of intraoperative in brachytherapy treatment planning system (B-TPS). The dosimetric parameters of RSI-BT were evaluated on preoperative plan, intraoperative real-time plan, and postoperative plan, including D90, D100 (the dose to 90% and 100% of the target volume), V100, V150, and V200 (the volume receives 100%, 150%, and 200% of the prescribed doses). The quality assurance of RSI-BT evaluated on conformal index (CI), external index (EI), and homogeneity index (HI) of the targets were compared among preoperative plan, intraoperative real-time plan, and postoperative plan. The perioperation complications and RSI-BT-related toxicity were assessed. RESULTS: The median follow-up was 8.2 months (range 1-18.5 months). One patient was lost to follow-up after RSI-BT. Fourteen patients were assessed for response rate and toxicity. The mean entrance point distance deviation for all 165 needles was 4.50 ± 4.10 mm (range, 0-30). The mean angular deviation was 2.70 ± 3.00° (range, 0-20). The needle tip distance deviation was 6.90 ± 6.00 mm (range, - 30-28). D90 for preoperative plan, intraoperative plan, and postoperative plan were 140.55 ± 23.93, 124.25 ± 28.04, and 128.98 ± 22.75, respectively. There was significant difference between D90 of preoperative plan with that of intraoperative plan (p = 0.036). Four lesions reached CR, six lesions reached PR, three lesions were SD, and three lesions were PD. Four patients with moderate pain became mild, and two with mild pain relieved completely after RSI-BT. The other parameters showed no differences among preoperative plan, intraoperative plan, and postoperative plan. The perioperative complications were observed in four patients, including three patients of grade 1 and one patient of grade 2. No ≥ grade 3 side effects were observed. CONCLUSION: CT-guided 125I RSI-BT assisted by 3D-PNCT was a safe, accurate, and feasible strategy for recurrent carcinomas located in the retroperitoneal regions.

Tn antigen promotes human colorectal cancer metastasis via H-Ras mediated epithelial-mesenchymal transition activation.

Tn antigen is a truncated O-glycan, frequently detected in colorectal cancer (CRC), but its precise role in CRC metastasis is not well addressed. Here we investigated the effects of Core 1 ß3Gal-T specific molecular chaperone (Cosmc) deletion-mediated Tn antigen exposure on CRC metastasis and its underlying mechanism. We first used CRISPR/Cas9 technology to knockout Cosmc, which is required for normal O-glycosylation, and thereby obtained Tn-positive CRC cells. We then investigated the biological consequences of Tn antigen expression in CRC. The results showed that Tn-positive cells exhibited an enhanced metastatic capability both in vitro and in vivo. A further analysis indicated that Tn antigen expression induced typical activation of epithelial-mesenchymal transition (EMT). Mechanistically, we found that H-Ras, which is known to drive EMT, was markedly up-regulated in Tn-positive cells, whereas knockdown of H-Ras suppressed Tn antigen induced activation of EMT. Furthermore, we confirmed that LS174T cells (Tn-positive) transfected with wild-type Cosmc, thus expressing no Tn antigen, had down-regulation of H-Ras expression and subsequent inhibition of EMT process. In addition, analysis of 438 samples in TCGA cohort demonstrated that Cosmc expression was reversely correlated with H-Ras, underscoring the significance of Tn antigen-H-Ras signalling in CRC patients. These data demonstrated that Cosmc deletion-mediated Tn antigen exposure promotes CRC metastasis, which is possibly mediated by H-Ras-induced EMT activation.

Early screening the small bowel is key to protect Peutz-Jeghers syndrome patients from surgery: a novel mutation c.243delG in STK11 gene.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.

Diosmetin Suppresses Neuronal Apoptosis and Inflammation by Modulating the Phosphoinositide 3-Kinase (PI3K)/AKT/Nuclear Factor-κB (NF-κB) Signaling Pathway in a Rat Model of Pneumococcal Meningitis.

Bacterial meningitis has a high mortality rate and can be challenging to diagnose and manage. This study aimed to evaluate the effect of diosmetin in a rat model of Streptococcus pneumoniae meningitis and to investigate the mechanism of action. Forty rats included a treatment group (n=30) that underwent intracisternal injection with S. pneumoniae, and a sham group (n=10) that underwent intracisternal injection with normal saline. In the treatment group, four days before the inoculation of the bacteria, rats were pre-treated with oral diosmetin 100 mg/kg (n=10) and 200 mg/kg (n=10), and the negative control was pre-treated with normal saline (n=10). Bacterial meningitis was confirmed one day after inoculation by cerebrospinal fluid (CSF) bacterial titer and neurological score. In rat brain tissue, levels of inflammatory mediators were determined by enzyme-linked immunosorbent assay (ELISA) and western blot for protein kinase B (Akt), phosphoinositide 3-kinase (PI3K), myeloid differentiation primary response 88 (MyD88), and nuclear factor-kappaB (NF-kappaB), and the TUNEL assay for apoptosis was performed. In the diosmetin-treated group compared with negative control group, the CSF bacterial titer and the level of pro-inflammatory mediators, and the neurological score, were significantly reduced (p<0.01). In the rat hippocampal tissue, levels of Akt, PI3K, MyD88 and NF-kappaB, and the number of TUNEL-positive apoptotic cells were significantly reduced in the diosmetin-treated group compared with negative control group (p<0.01). In a rat model of bacterial meningitis due to S. pneumoniae, diosmetin reduced neuroinflammation, and neuronal apoptosis by modulating the PI3K/AKT/NF-kappaB signaling pathway.

[Analysis of STK11 gene variants among 64 patients with Peutz-Jeghers syndrome].

OBJECTIVE: To screen for pathogenic variants in the coding regions of STK11 gene among Chinese patients with Peutz-Jeghers syndrome (PJS). METHODS: Peripheral blood samples were collected from 64 patients. The coding regions of the STK11 gene were detected by PCR and Sanger sequencing. RESULTS: Fourty-eight patients were found to harbor STK11 gene variants, which included 39 types of variants consisting of missense, nonsense, insertional, deletional and splice site variants. Among 64 PJS patients, the detection rate of point variants was 75.00% (48/64), of which missense variants accounted for 29.17% (14/48), nonsense variants accounted for 29.17%(14/48), insertion variants accounted for 2.08% (1/48), deletional variants accounted for 10.42% (5/48), and splice site variants accounted for 29.17% (14/48). The detection rates of sporadic cases and those with a family history were 71.8% (28/39) and 80.0% (20/25), respectively. Two variants (c.250A>T, c.580G>A) occurred in 3 PJS probands. Thirteen variants were unreported previously and were considered to be pathogenic. CONCLUSION: The detection rate of variants among Chinese PJS patients is similar to that of other countries. A number of novel common variant sites were discovered, which enriched the spectrum of PJS-related variants.

Aberrant O-glycosylation contributes to tumorigenesis in human colorectal cancer.

Aberrant O-glycosylation is frequently observed in colorectal cancer (CRC) patients, but it is unclear if it contributes intrinsically to tumorigenesis. Here, we investigated the biological consequences of aberrant O-glycosylation in CRC. We first detected the expression profile of Tn antigen in a serial of human CRC tissues and then explored the genetic and biosynthetic mechanisms. Moreover, we used a human CRC cell line (LS174T), which express Tn antigen, to assess whether aberrant O-glycosylation can directly promote oncogenic properties. It showed that Tn antigen was detected in around 86% human primary and metastatic CRC tissues. Bio-functional investigations showed that T-synthase and Cosmc were both impaired in cancer tissues. A further analysis detected an occurrence of hypermethylation of Cosmc gene, which possibly caused its loss-of-function and a consequent inactive T-synthase. Transfection of LS174T cells with WT Cosmc restored mature O-glycosylation, which subsequently down-regulated cancer cell proliferation, migration and apoptotic-resistant ability. Significantly, the expression of MUC2, a heavily O-glycosylated glycoprotein that plays an essential role in intestinal function, was uniformly reduced in human CRC tissues as well as in LS174T cells. These data suggest that aberrant O-glycosylation contributes to the development of CRC through direct induction of oncogenic properties in cancer cells.

The altered activity of P53 signaling pathway by STK11 gene mutations and its cancer phenotype in Peutz-Jeghers syndrome.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.

Close and regular surveillance is key to prevent severe complications for Peutz-Jeghers syndrome patients without gastrointestinal polyps: case report of a novel STK11 mutation (c.471_472delCT) in a Chinese girl.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.

Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Hyperhomocysteinemia is associated with decreased apolipoprotein AI levels in normal healthy people.

BACKGROUND: Hyperhomocysteinemia (HHcy) is an independent risk factor for various cardiovascular diseases. Animal studies have shown that homocysteine (Hcy) inhibits hepatic expression of apolipoprotein AI (apoAI). Our recent clinical study showed that increased plasma Hcy levels were associated with decreased apoAI levels in patients with impaired glucose tolerance. In this study, we assessed a potential association between Hcy and apoAI levels in normal healthy people. METHODS: A total of 1768 normal healthy individuals were divided into two groups: the control group (subjects without HHcy) and the HHcy group (subjects with HHcy). RESULTS: HHcy subjects exhibited significantly lower high-density lipoprotein cholesterol (HDL-C) and apoAI levels than the control group (HDL-C: 1.18 ± 0.25 vs. 1.29 ± 0.32 mmol/L; apoAI: 1.38 ± 0.19 vs. 1.47 ± 0.25 g/L; all P < 0.01). Plasma Hcy levels were negatively associated with HDL-C and apoAI levels after adjustments for age, BMI and TG (HDL-C: r = -0.10; apoAI: r = -0.11; all P < 0.05). Multivariate regression analysis showed that the plasma Hcy levels were an independent influencing factor for apoAI (ß = -0.065, P < 0.05). CONCLUSIONS: Increased plasma Hcy levels were associated with decreased apoAI levels in normal healthy people, and the inhibition of apoAI synthesis might be a mechanism through which Hcy is linked with the development of atherosclerosis in HHcy subjects.