Control of the spider-like interference structure in photoelectron momentum distributions of a helium atom in a few-cycle nonlinear chirped laser pulse.

We investigate theoretically the photoelectron momentum distributions (PMDs) of the helium atom in the few-cycle nonlinear chirped laser pulse. The numerical results show that the direction of the spider-like interference structure in PMDs exhibits periodic variations with the increase of the chirp parameter. It is illustrated that the direction of the spider-like interference structure is related to the direction of the electron motion by tracking the trajectories of the electrons. We also demonstrate that the carrier-envelope phase can precisely control the opening of the ionization channel. In addition, we investigate the PMDs when a chirp-free second harmonic (SH) laser pulse is added to the chirped laser field, the numerical results show that the interference patterns can change from only spider-like interference structure to both spider-like and ring-like interference structures.

Establishment of a Systemic Inflammatory Response Syndrome Model and Evaluation of the Efficacy of Umbilical Cord Mesenchymal Stem Cell Transplantation.

Based on the characteristics of modern weapon injury, a repetitive model of traumatic systemic inflammatory response syndrome (SIRS) and an evaluation system were established. The models were treated with GFP-labeled tree shrew umbilical cord mesenchymal stem cells (UCMSCs). Forty out of 50 tree shrews were used to make a unilateral femoral comminuted fracture. Lipopolysaccharide was injected intravenously to create a traumatic SIRS model. The other 10 shrews were used as normal controls. After the model was established for 10 days, 20 tree shrews were injected intravenously with GFP-labeled UCMSCs, and 18 tree shrews were not injected as the model control group. The distribution of GFP-labeled cells in vivo was measured at 2 and 10 days after injection. Twenty days after treatment, the model group, the normal control group, and the treatment group were taken to observe the pathological changes in each tissue, and blood samples were taken for the changes in liver, renal, and heart function. Distribution of GFP-positive cells was observed in all tissues at 2 and 10 days after injection. After treatment, the HE staining results of the treatment group were close to those of the normal group, and the model group had a certain degree of lesions. The results of liver, renal, and heart function tests in the treatment group were returned to normal, and the results in the model group were abnormally increased. UCMSCs have a certain effect on the treatment of traumatic SIRS and provide a new technical solution for modern weapon trauma treatment.

SLC7A11 negatively associates with mismatch repair gene expression and endows glioblastoma cells sensitive to radiation under low glucose conditions.

The cystine/glutamate antiporter xCT (SLC7A11) is frequently upregulated in many cancers, including glioblastoma (GBM). SLC7A11-mediated cystine taken up is reduced to cysteine, a precursor amino acid for glutathione synthesis and antioxidant cellular defense. However, little is known about the biological functions of SLC7A11 and its effect on therapeutic response in GBM. Here, we report that the expression of SLC7A11 is higher in GBM compared with normal brain tissue, but is negatively associated with tumor grades and positively impacts survival in the bioinformatic analysis of TCGA and CGGA database. Additionally, a negative association between SLC7A11 and mismatch repair (MMR) gene expression was identified by Pearson correlation analysis. In the GBM cells with glucose-limited culture conditions, overexpression of SLC7A11 significantly decreased MMR gene expression, including MLH1, MSH6, and EXO1. SLC7A11-overexpressed GBM cells demonstrated elevated double-strand break (DSB) levels and increased sensitivity to radiation treatment. Taken together, our work indicates that SLC7A11 might be a potential biomarker for predicting a better response to radiotherapy in GBM.

Magnetic quantification of single-crystalline Fe and Co nanowires via off-axis electron holography.

Investigating the local micromagnetic structure of ferromagnetic nanowires (NWs) at the nanoscale is essential to study the structure-property relationships and can facilitate the design of nanostructures for technology applications. Herein, we synthesized high-quality iron and cobalt NWs and investigated the magnetic properties of these NWs using off-axis electron holography. The Fe NWs are about 100 nm in width and a few micrometers in length with a preferential growth direction of [100], while the Co NWs have a higher aspect-ratio with preferential crystal growth along the [110] direction. It is noted that compact passivation surface layers of oxides protect these NWs from further oxidation, even after nearly two years of exposure to ambient conditions; furthermore, these NWs display homogeneous ferromagnetism along their axial direction revealing the domination of shape anisotropy on magnetic behavior. Importantly, the average value of magnetic induction strengths of Fe NWs (2.07 {±} 0.10 T) and Co NWs (1.83 {±} 0.15 T) is measured to be very close to the respective theoretical value, and it shows that the surface oxide layers do not affect the magnetic moments in NWs. Our results provide a useful synthesis approach for the fabrication of single-crystalline, defect-free metal NWs and give insight into the micromagnetic properties in ferromagnetic NWs based on the transmission electron microscopy measurements.

Quantification of Magnetic Surface and Edge States in an FeGe Nanostripe by Off-Axis Electron Holography.

Whereas theoretical investigations have revealed the significant influence of magnetic surface and edge states on Skyrmonic spin texture in chiral magnets, experimental studies of such chiral states remain elusive. Here, we study chiral edge states in an FeGe nanostripe experimentally using off-axis electron holography. Our results reveal the magnetic-field-driven formation of chiral edge states and their penetration lengths at 95 and 240 K. We determine values of saturation magnetization M_{S} by analyzing the projected in-plane magnetization distributions of helices and Skyrmions. Values of M_{S} inferred for Skyrmions are lower by a few percent than those for helices. We attribute this difference to the presence of chiral surface states, which are predicted theoretically in a three-dimensional Skyrmion model. Our experiments provide direct quantitative measurements of magnetic chiral boundary states and highlight the applicability of state-of-the-art electron holography for the study of complex spin textures in nanostructures.

Selective Chemical Vapor Deposition Growth of Cubic FeGe Nanowires That Support Stabilized Magnetic Skyrmions.

Magnetic skyrmions are topologically stable vortex-like spin structures that are promising for next generation information storage applications. Materials that host magnetic skyrmions, such as MnSi and FeGe with the noncentrosymmetric cubic B20 crystal structure, have been shown to stabilize skyrmions upon nanostructuring. Here, we report a chemical vapor deposition method to selectively grow nanowires (NWs) of cubic FeGe out of three possible FeGe polymorphs for the first time using finely ground particles of cubic FeGe as seeds. X-ray diffraction and transmission electron microscopy (TEM) confirm that these micron-length NWs with ∼100 nm to 1 µm diameters have the cubic B20 crystal structure. Although Fe13Ge8 NWs are also formed, the two types of NWs can be readily differentiated by their faceting. Lorentz TEM imaging of the cubic FeGe NWs reveals a skyrmion lattice phase under small applied magnetic fields (∼0.1 T) at 233 K, a skyrmion chain state at lower temperatures (95 K) and under high magnetic fields (∼0.4 T), and a larger skyrmion stability window than bulk FeGe. This synthetic approach to cubic FeGe NWs that support stabilized skyrmions opens a route toward the exploration of new skyrmion physics and devices based on similar nanostructures.

Magnetic Skyrmion Formation at Lattice Defects and Grain Boundaries Studied by Quantitative Off-Axis Electron Holography.

We use in situ Lorentz microscopy and off-axis electron holography to investigate the formation and characteristics of skyrmion lattice defects and their relationship to the underlying crystallographic structure of a B20 FeGe thin film. We obtain experimental measurements of spin configurations at grain boundaries, which reveal inversions of crystallographic and magnetic chirality across adjacent grains, resulting in the formation of interface spin stripes at the grain boundaries. In the absence of material defects, we observe that skyrmions lattices possess dislocations and domain boundaries, in analogy to atomic crystals. Moreover, the distorted skyrmions can flexibly change their size and shape to accommodate local geometry, especially at sites of dislocations in the skyrmion lattice. Our findings provide a detailed understanding of the elasticity of topologically protected skyrmions and their correlation with underlying material defects.

Chronic Toxicity Test in Cynomolgus Monkeys For 98 Days with Repeated Intravenous Infusion of Cynomolgus Umbilical Cord Mesenchymal Stem Cells.

BACKGROUND/AIMS: Stem cell-based therapy is attractive in many clinical studies, but current data on the safety of stem cell applications remains inadequate. This study observed the safety, immunological effect of cynomolgus monkey umbilical cord mesenchymal stem cells (mUC-MSCs) injected into cynomolgus monkeys, in order to evaluate the safety of human umbilical cord mesenchymal stem cells (hUC-MSCs) prepared for human clinical application. METHODS: Eighteen cynomolgus monkeys were divided into three groups. Group 1 is control group, Group 2 is low-dose group, Group 3 is high-dose group. After repeated administrations of mUC-MSCs, cynomolgus monkeys were observed for possible toxic reactions. RESULTS: During the experiment, no animal died. There were no toxicological abnormalities in body weight, body temperature, electrocardiogram, coagulation and pathology. In the groups 2 and 3, AST and CK transiently increased, and serum inorganic P slightly decreased. All animals were able to recover at 28 days after the infusion was stopped. In the groups 2 and 3, CD3+ and IL-6 levels significantly increased, and recovery was after 28 days of infusion. There were no obvious pathological changes associated with the infusion of cells in the general and microscopic examinations. CONCLUSIONS: The safe dosage of repeated intravenous infusion of mUC-MSCs in cynomolgus monkeys is 1.0 × 107/kg, which is 10 times of that in clinical human use.

Room-temperature ferromagnetism in antiferromagnetic cobalt oxide nanooctahedra.

Cobalt oxide octahedra were synthesized by thermal decomposition. Each octahedron-shaped nanoparticle consists of an antiferromagnetic CoO core enclosed by eight {111} facets interfaced to a thin (∼ 4 nm) surface layer of strained Co3O4. The nearly perfectly octahedral shaped particles with 20, 40, and 85 nm edge length show a weak room-temperature ferromagnetism that can be attributed to ferromagnetic correlations appearing due to strained lattice configurations at the CoO/Co3O4 interface.

Hollow and yolk-shell iron oxide nanostructures on few-layer graphene in Li-ion batteries.

We report a simple and template-free strategy for the synthesis of hollow and yolk-shell iron oxide (FeOx) nanostructures sandwiched between few-layer graphene (FLG) sheets. The morphology and microstructure of this material are characterized in detail by X-ray diffraction, X-ray absorption near-edge structure, X-ray photoelectron spectroscopy, Raman spectroscopy, scanning and transmission electron microscopy. Its properties are evaluated as negative electrode material for Li-ion batteries and compared with those of solid FeOx/FLG and two commercial iron oxides. In all cases, the content of carbon in the electrode has a great influence on the performance. The use of pristine FLG improves the capacity retention and further enhancement is achieved with the hollow structure. For a low carbon loading of 18 wt. %, the presence of metallic iron in the hollow and yolk-shell FeOx/FLG composite significantly enhances the capacity retention, albeit with a relatively lower initial reversible capacity, retaining above 97% after 120 cycles at 1000 mA g(-1) in the voltage range of 0.1-3.0 V.

Effect of a side reaction involving structural changes of the surfactants on the shape control of cobalt nanoparticles.

Cobalt nanoparticles with different sizes and morphologies including spheres, rods, disks, and hexagonal prisms have been synthesized through the decomposition of the olefinic precursor [Co(η(3)-C8H13)(η(4)-C8H12)] under dihydrogen, in the presence of hexadecylamine and different rhodamine derivatives, or aromatic carboxylic acids. UV-vis spectroscopy, X-ray diffraction, low and high resolution transmission electron microscopy, and electron tomography have been used to characterize the nanomaterials. Especially, the Co nanodisks formed present characteristics that make them ideal nanocrystals for applications such as magnetic data storage. Focusing on their growth process, we have evidenced that a reaction between hexadecylamine and rhodamine B occurs during the formation of these Co nanodisks. This reaction limits the amount of free acid and amine, usually at the origin of the formation of single crystal Co rods and wires, in the growth medium of the nanocrystals. As a consequence, a growth mechanism based on the structure of the preformed seeds rather than oriented attachment or template assisted growth is postulated to explain the formation of the nanodisks.

Tunable emission properties by ferromagnetic coupling Mn(II) aggregates in Mn-doped CdS microbelts/nanowires.

Tunable optical emission properties from ferromagnetic semiconductors have not been well identified yet. In this work, high-quality Mn(II)-doped CdS nanowires and micrometer belts were prepared using a controlled chemical vapor deposition technique. The Mn doping could be controlled with time, precursor concentration and temperature. These wires or belts can produce both tunable redshifted emissions and ferromagnetic responses simultaneously upon doping. The strong emission bands at 572, 651, 693, 712, 745, 768, 787 and 803 nm, due to the Mn(II) (4)T1((4)G)  → (6)A1((6)s) d-d transition, can be detected and accounted for by the aggregation of Mn ions at Cd sites in the CdS lattice at high temperature. These aggregates with ferromagnetism and shifted luminescence are related to the excitonic magnetic polaron (EMP) and localized EMP formations; this is verified by ab initio calculations. The correlation between aggregation-dependent optical emissions and ferromagnetic responses not only presents a new size effect for diluted magnetic semiconductors (DMSs), but also supplies a possible way to study or modulate the ferromagnetic properties of a DMS and to fabricate spin-related photonic devices in the future.

Single-step synthesis of monolithic comb-like CdS nanostructures with tunable waveguide properties.

Using a simple in situ seeding chemical vapor deposition (CVD) process, comb-like (branched) monolithic CdS micro/nanostructures were grown. Efficient optical coupling between the backbone and the teeth of the branched architecture is demonstrated by distributing light from an UV-laser-excited spot at one end of the backbone to all branch tips. By varying the deposition conditions, the orientation of the branches with respect to the backbone, their size and density can be tuned as well as the size of the backbone. This in situ seeding CVD method has the potential for a low-cost single-step fabrication of high-quality, micro/nanointegrated photonic devices, with tunable complex waveguiding possibilities.

Application and challenges of stem cells in cardiovascular aging.

With the rapid development of society and the economy, population aging has become a common challenge faced by many countries in the world today. Structural and functional changes in the cardiovascular system can occur with age, increasing the incidence and severity of cardiovascular diseases in older adults. Due to the limited regenerative capacity of myocardial cells, myocardial infarction and its resulting heart failure and congenital heart disease have become the number one killer of human health. At present, the treatment of cardiovascular diseases includes drug therapy and nondrug therapy. Nondrug therapy mainly includes minimally invasive interventional therapy, surgical diagnosis and treatment, and cell therapy. Long-term drug treatment may cause headache due to vasodilation, lower blood pressure, digestive system dysfunction and other side effects. Surgical treatment is traumatic, difficult to treat, and expensive. In recent years, stem cell therapy has exhibited broad application prospects in basic and clinical research on cardiovascular disease because of its plasticity, self-renewal and multidirectional differentiation potential. Therefore, this paper looks at stem cell therapy for diseases, reviews recent advances in the mechanism and clinical transformation of cardiovascular aging and related diseases in China, and briefly discusses the development trend and future prospects of cardiovascular aging research.

Transplantation of bone marrow mesenchymal stem cells for the treatment of type 2 diabetes in a macaque model.

Bone marrow mesenchymal stem cells (BMSCs) are self-renewing, multipotent cells that can migrate to pathological sites and thereby provide a new treatment in diabetic animals. Superparamagnetic iron oxide/4',6-diamidino-2-phenylindole (DAPI) double-labeled BMSCs were transplanted into the pancreatic artery of macaques to treat type 2 diabetes mellitus (T2DM). The treatment efficiency of BMSCs was also evaluated. After successful induction of the T2DM model, the treatment group received double-labeled BMSCs via the pancreatic artery. Six weeks after BMSC transplantation, the fasting blood glucose and blood lipid levels measured in the treatment group were significantly lower (p < 0.05) than in the model group, although they were not reduced to normal levels (p < 0.05). Additionally, the serum C-peptide levels were significantly increased (p < 0.05). An intravenous glucose tolerance test and C-peptide release test had significant changes to the area under the curve. Within 14 days of the transplantation of labeled cells, the pancreatic and kidney tissue of the treatment group emitted a negative signal that was visible on magnetic resonance imaging (MRI). Six weeks after transplantation, DAPI signals appeared in the pancreatic and kidney tissue, which indicates that the BMSCs were mainly distributed in damaged tissue. Labeled stem cells can be used to track migration and distribution in vivo by MRI. In conclusion, the transplantation of BMSCs for the treatment of T2DM is safe and effective.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Comprehensive Analysis of Sterol O-Acyltransferase 1 as a Prognostic Biomarker and Its Association With Immune Infiltration in Glioma.

Metabolic reprogramming is a hallmark of glioma, and sterol O-acyltransferase 1 (SOAT1) is an essential target for metabolic therapy. However, the prognostic value of SOAT1 and its association with immune infiltration has not been fully elucidated. Using RNA-seq and clinical data of glioma patients from The Cancer Genome Atlas (TCGA), SOAT1 was found to be correlated with poor prognosis in glioma and the advanced malignancy of clinicopathological characteristics. Next, the correlation between SOAT1 expression and tumor-infiltrating immune cells was performed using the single-sample GSEA algorithm, gene expression profiling interactive analysis (GEPIA), and tumor immune estimation resource version 2 (TIMER2.0); it was found that SOAT1 expression was positively correlated with multiple tumor-infiltrating immune cells. To further verify these results, immunofluorescence was conducted on paraffin-embedded glioma specimens, and a positive trend of the correlation between SOAT1 expression and Treg infiltration was observed in this cohort. Finally, differentially expressed gene analysis, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were performed to explore the biological processes and signaling pathways that SOAT1 may be involved in during glioma pathogenesis. A protein-protein interaction network was established, and co-expression analysis was conducted to investigate the regulatory mechanism of SOAT1 in glioma. To the best of our knowledge, this is the first comprehensive study reporting that SOAT1 may serve as a novel prognostic biomarker associated with immune infiltrates, providing a novel perspective for glioma metabolic therapy.

Cholesterol metabolism and its implication in glioblastoma therapy.

Glioblastoma (GBM) is the most lethal malignant tumor in the central nervous system, with a median survival of only 14 months. Cholesterol, which is the main component of cell membrane and the precursor of many hormones, is one of the most important lipid components in human body. Since reprogramming of the cholesterol metabolic profile has been discovered in many cancers including GBM, cholesterol metabolism becomes a promising potential target for therapy. Since GBM cells rely on external cholesterol to survive and accumulate lipid droplets to meet their rapid growth needs, targeting the metabolism of cholesterol by different strategies including inhibition of cholesterol uptake and promotion of cholesterol efflux by activating LXRs and disruption of cellular cholesterol trafficking, inhibition of SREBP signaling, inhibition of cholesterol esterification, could potentially oppose the growth of glial tumors. In this review, we discussed the above findings and describe cholesterol synthesis and homeostatic feedback pathways in normal brain tissues and brain tumors, statin use in GBM and the role of lipid rafts and cholesterol precursors and oxysterols in the treatment and pathogenesis of GBM are also summarized.

UnitCell Tools, a package to determine unit-cell parameters from a single electron diffraction pattern.

Electron diffraction techniques in transmission electron microscopy (TEM) have been successfully employed for determining the unit-cell parameters of crystal phases, albeit they exhibit a limited accuracy compared with X-ray or neutron diffraction, and they often involve a tedious measurement procedure. Here, a new package for determining unit-cell parameters from a single electron diffraction pattern has been developed. The essence of the package is to reconstruct a 3D reciprocal primitive cell from a single electron diffraction pattern containing both zero-order Laue zone and high-order Laue zone reflections. Subsequently, the primitive cell can be reduced to the Niggli cell which, in turn, can be converted into the unit cell. Using both simulated and experimental patterns, we detail the working procedure and address some effects of experimental conditions (diffraction distortions, misorientation of the zone axis and the use of high-index zone axis) on the robustness and accuracy of the software developed. The feasibility of unit-cell determination of the TiO2 nanorod using this package is also demonstrated. Should the parallel-beam, nano-beam and convergent-beam modes of the TEM be used flexibly, the software can determine unit-cell parameters of unknown-structure crystallites (typically >50 nm).

Microstructure of quasi-one-dimensional superconductor KCr3As3prepared by K-ion deintercalation.

The microstructure of quasi-one-dimensional KCr3As3(133) superconductors, which were prepared by chemical cation deintercalation from their counterpart K2Cr3As3(233) compounds, are investigated using scanning transmission electron microscopy. The nominal KCr3As3crystals generally exhibit irregular nanoscale 133-phase domains accompanied by an amorphous As-deficient phase and cracks as a result of alkali cation deintercalation processes. Analysis of local defective structures reveals the existence of an intermediate state in the transformation from 233 to 133 phase and a possible K-deficient 233-type structure as a nanoscale cluster. Our microscopic investigations offer insight into the microstructure of KCr3As3and the alkali metal cation deintercalation processes.