N6-Methyladenosine Guides mRNA Alternative Translation during Integrated Stress Response.

The integrated stress response (ISR) facilitates cellular adaptation to stress conditions via the common target eIF2α. During ISR, the selective translation of stress-related mRNAs often relies on alternative mechanisms, such as leaky scanning or reinitiation, but the underlying mechanism remains incompletely understood. Here we report that, in response to amino acid starvation, the reinitiation of ATF4 is not only governed by the eIF2α signaling pathway, but is also subjected to regulation by mRNA methylation in the form of N6-methyladenosine (m6A). While depleting m6A demethylases represses ATF4 reinitiation, knocking down m6A methyltransferases promotes ATF4 translation. We demonstrate that m6A in the 5' UTR controls ribosome scanning and subsequent start codon selection. Global profiling of initiating ribosomes reveals widespread alternative translation events influenced by dynamic mRNA methylation. Consistently, Fto transgenic mice manifest enhanced ATF4 expression, highlighting the critical role of m6A in translational regulation of ISR at cellular and organismal levels.

Determinant of m6A regional preference by transcriptional dynamics.

N6-Methyladenosine (m6A) is the most abundant chemical modification occurring on eukaryotic mRNAs, and has been reported to be involved in almost all stages of mRNA metabolism. The distribution of m6A sites is notably asymmetric along mRNAs, with a strong preference toward the 3' terminus of the transcript. How m6A regional preference is shaped remains incompletely understood. In this study, by performing m6A-seq on chromatin-associated RNAs, we found that m6A regional preference arises during transcription. Nucleosome occupancy is remarkedly increased in the region downstream of m6A sites, suggesting an intricate interplay between m6A methylation and nucleosome-mediated transcriptional dynamics. Notably, we found a remarkable slowdown of Pol-II movement around m6A sites. In addition, inhibiting Pol-II movement increases nearby m6A methylation levels. By analyzing massively parallel assays for m6A, we found that RNA secondary structures inhibit m6A methylation. Remarkably, the m6A sites associated with Pol-II pausing tend to be embedded within RNA secondary structures. These results suggest that Pol-II pausing could affect the accessibility of m6A motifs to the methyltransferase complex and subsequent m6A methylation by mediating RNA secondary structure. Overall, our study reveals a crucial role of transcriptional dynamics in the formation of m6A regional preference.

m6A Facilitates eIF4F-Independent mRNA Translation.

In eukaryotic cells, protein synthesis typically begins with the binding of eIF4F to the 7-methylguanylate (m7G) cap found on the 5' end of the majority of mRNAs. Surprisingly, overall translational output remains robust under eIF4F inhibition. The broad spectrum of eIF4F-resistant translatomes is incompatible with cap-independent translation mediated by internal ribosome entry sites (IRESs). Here, we report that N6-methyladenosine (m6A) facilitates mRNA translation that is resistant to eIF4F inactivation. Depletion of the methyltransferase METTL3 selectively inhibits translation of mRNAs bearing 5' UTR methylation, but not mRNAs with 5' terminal oligopyrimidine (TOP) elements. We identify ABCF1 as a critical mediator of m6A-promoted translation under both stress and physiological conditions. Supporting the role of ABCF1 in m6A-facilitated mRNA translation, ABCF1-sensitive transcripts largely overlap with METTL3-dependent mRNA targets. By illustrating the scope and mechanism of eIF4F-independent mRNA translation, these findings reshape our current perceptions of cellular translational pathways.

Interior and Exterior Surface Modification of Zr-Based Metal-Organic Frameworks for Trace Benzene Removal.

The emission of volatile organic compounds (VOCs) significantly contributes to air pollution and poses a serious threat to human health. Benzene, one of the most toxic VOCs, is difficult for the human body to metabolize and is classified as a Group 1 carcinogen. The development of efficient adsorbents for removing trace amounts of benzene from ambient air is thus of great importance. In this work, we studied the benzene adsorption properties of four Zr-based metal-organic frameworks (Zr-MOFs) through static volumetric and dynamic breakthrough experiments. Two previously reported Zr-MOFs, BUT-12 and STA-26, were prepared with a tritopic carboxylic acid ligand (H3L1) functionalized with three methyl groups, and STA-26 is a 2-fold interpenetrated network of BUT-12. Two new isoreticular Zr-MOFs, BUT-12-Et and STA-26-Et, were synthesized using a similar ligand, H3L2, where the methyl groups are replaced with ethyl groups. There are mesopores in BUT-12 and BUT-12-Et and micropores in STA-26 and STA-26-Et. The four Zr-MOFs all showed high stability in liquid water and acidic aqueous solutions. The microporous STA-26 and STA-26-Et showed much higher benzene uptakes than mesoporous BUT-12 and BUT-12-Et at room temperature under low pressures. Particularly, the benzene adsorption capacity of STA-26-Et was high up to 2.21 mmol/g at P/P0 = 0.001 (P0 = 12.78 kPa), higher than those of the other three Zr-MOFs and most reported solid adsorbents. Breakthrough experiments confirmed that STA-26-Et could effectively capture trace benzene (10 ppm) from dry air; however, its benzene capture capacity was reduced by 90% under humid conditions (RH = 50%). Coating of the crystals of STA-26-Et with polydimethylsiloxane (PDMS) increased the hydrophobicity of the exterior MOF surfaces, leading to a more than 2-fold improvement in its benzene capture capacity in the breakthrough experiment under humid condition. PDMS coating of STA-26-Et likely slowed down the water adsorption process, and thus, the adsorbent afforded more efficient capture of benzene. This work demonstrates that modifying both the interior and exterior surfaces of MOFs can effectively enhance their performance in capturing trace benzene from ambient air, even under humid conditions. This finding is meaningful for the development of new adsorbents for effective air purification applications.

Serum YKL-40 and Serum Krebs von den Lungen-6 as Potential Predictive Biomarkers for Rheumatoid Arthritis-Associated Interstitial Lung Disease.

BACKGROUND: Interstitial lung disease (ILD) is a common pulmonary manifestation of rheumatoid arthritis (RA) and is associated with a poor prognosis. However, the role of blood biomarkers in RA-associated interstitial lung disease (RA-ILD) is ill-defined. We aim to evaluate the role of YKL-40 and Krebs von den Lungen-6 (KL-6) in the diagnosis and severity evaluation of RA-ILD. METHODS: 45 RA-non-ILD patients and 38 RA-ILD patients were included. The clinical data and the levels of YKL-40 and KL-6 were measured and collected for all patients. The risk factors for RA-ILD were analyzed and their correlation with relevant indicators and predictive value for RA-ILD was explored. RESULTS: The levels of YKL-40 and KL-6 in RA-ILD patients were higher than RA-non-ILD patients (p < .001). Both YKL-40 and KL-6 were correlated with the incidence of RA-ILD. The predictive power of combined KL-6 and YKL-40 for the presence of ILD was 0.789, with a sensitivity and specificity at 73.7% and 73.3%, respectively. In RA-ILD patients, both YKL-40 and KL-6 were positively correlated with the Scleroderma Lung Study (SLS) I score and negatively correlated with pulmonary function. CONCLUSIONS: KL-6 and YKL-40 might be a useful biomarker in the diagnosis and severity evaluation of RA-ILD.

Multifaceted regulation of translation by the epitranscriptomic modification N6-methyladenosine.

Translation occurring on cytoplasmic mRNA is precisely governed at three consecutive stages, including initiation, elongation and termination. A growing body of evidence has revealed that an emerging epitranscriptomic code N6-methyladenosine (m6A), asymmetrically present in a large subset of coding and non-coding transcripts, is crucially required for mediating the translatomic stability. Through recruiting translation machinery proteins, serving as a physical barrier, or directing RNA structural rearrangement and mRNA looping formation, m6A has been decoded to modulate translational dynamics through potentially influencing the progress of different stages, thereby forming an additional layer of complexity to the regulation of translation. In this review, we summarize the current understanding of how m6A guides mRNA translation under normal and stress conditions, highlighting the divergent molecular mechanisms of multifarious regulation of m6A-mediated translation.

METTL3 modulates chromatin and transcription dynamics during cell fate transition.

Transcriptional programming plays a key role in determining the cell state. Timely reconfiguration of chromatin structure and attenuation of pluripotent genes are required for efficient embryonic stem cell (ESC) differentiation. Here, we identify METTL3, a core N6-methyladenosine (m6A) catalyzing enzyme, as a crucial modulator of dynamic transcription and chromatin accessibility upon ESC-derived cardiac differentiation. Genome-wide analysis of chromatin-associated RNAs revealed that depletion of METTL3 failed to dramatically attenuate the transcription of pluripotent genes, as well as activate nascent cardiomyocyte-specific transcripts upon differentiation. Consistently, ATAC-seq analysis showed that loss of METTL3 markedly attenuated the dynamic alteration of chromatin accessibility at both promoters and gene bodies, resulting in reduced sensitivity of ESC chromatin structure to cardiac differentiation signal. Furthermore, we found that METTL3 negatively regulated the histone modifications H3K4me3 and H3K36me3, which are involved in METTL3-modulated dynamic chromatin architecture during cell state transition. Unexpectedly, using chromatin-associated m6A sequencing, we found that nuclear m6A underwent a dramatic increase upon differentiation, which correlates with the decrease of chromatin accessibility. Collectively, our findings reveal that METTL3 and nuclear m6A epitranscriptome couple with chromatin state to ensure transcriptional regulation of cell fate transition.

The molecular chaperone Hsp90 regulates heterochromatin assembly through stabilizing multiple complexes in fission yeast.

In the fission yeast Schizosaccharomyces pombe, both RNAi machinery and RNAi-independent factors mediate transcriptional and posttranscriptional silencing and heterochromatin formation. Here, we show that the silencing of reporter genes at major native heterochromatic loci (centromeres, telomeres, mating-type locus and rDNA regions) and an artificially induced heterochromatin locus is alleviated in a fission yeast hsp90 mutant, hsp90-G84C Also, H3K9me2 enrichment at heterochromatin regions, especially at the mating-type locus and subtelomeres, is compromised, suggesting heterochromatin assembly defects. We further discovered that Hsp90 is required for stabilization or assembly of the RNA-induced transcriptional silencing (RITS) and Argonaute siRNA chaperone (ARC) RNAi effector complexes, the RNAi-independent factor Fft3, the shelterin complex subunit Poz1 and the Snf2/HDAC-containing repressor complex (SHREC). Our ChIP data suggest that Hsp90 regulates the efficient recruitment of the methyltransferase/ubiquitin ligase complex CLRC by shelterin to chromosome ends and targeting of the SHREC and Fft3 to mating type locus and/or rDNA region. Finally, our genetic analyses demonstrated that increased heterochromatin spreading restores silencing at subtelomeres in the hsp90-G84C mutant. Thus, this work uncovers a conserved factor critical for promoting RNAi-dependent and -independent heterochromatin assembly and gene silencing through stabilizing multiple effectors and effector complexes.

Linking m6 A to Wnt signaling.

N6 -methyladenosine (m6 A) has emerged as a crucial molecular code to influence pluripotency and differentiation of diverse stem cells. A study in this issue now shows that, in intestinal stem cells, the m6 A reader protein YTHDF1 directs translational control of stemness in both m6 A- and Wnt-dependent manner [1].

First report of maize yellow mosaic virus causing maize reddening in Henan,China.

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

Programmable RNA N6-methyladenosine editing by CRISPR-Cas9 conjugates.

RNA modification in the form of N6-methyladenosine (m6A) regulates nearly all the post-transcriptional processes. The asymmetric m6A deposition suggests that regional methylation may have distinct functional consequences. However, current RNA biology tools do not distinguish the contribution of individual m6A modifications. Here we report the development of 'm6A editing', a powerful approach that enables m6A installation and erasure from cellular RNAs without changing the primary sequence. We engineered fusions of CRISPR-Cas9 and a single-chain m6A methyltransferase that can be programmed with a guide RNA. The resultant m6A 'writers' allow functional comparison of single site methylation in different messenger RNA regions. We further engineered m6A 'erasers' by fusing CRISPR-Cas9 with ALKBH5 or FTO to achieve site-specific demethylation of RNAs. The development of programmable m6A editing not only expands the scope of RNA engineering, but also facilitates mechanistic understanding of epitranscriptome.

Differential roles of YTHDF1 and YTHDF3 in embryonic stem cell-derived cardiomyocyte differentiation.

N6-methyladenosine (m6A) has emerged as a crucial epitranscriptomic mark which regulates a broad spectrum of physiological processes including stem cell differentiation. m6A-binding YTHDF proteins have recently been proposed to mediate differentiation of leukemia cell in a redundant manner. However, whether these proteins play semblable roles in pluripotent stem cell remain largely unknown. Here, we showed the differential functions of YTHDF1 and YTHDF3 in controlling the differentiation of embryonic stem cells (ESCs). Depletion of YTHDF3 in ESCs resulted in loss of pluripotency with accelerated expressions of marker genes involved in formation of three germ layers. Phenotypic and transcriptomic analyses revealed that loss of YTHDF1 led to dramatic impairment of cardiomyocytes (CMs) differentiation, accompanied by downregulated CM-specific genes. While, knockdown of YTHDF3 accelerated differentiation through facilitating the expressions of CM-specific gene. Notably, YTHDF3 appears to modulate cellular differentiation partially through suppression of YTHDF1, supporting the distinguishable but interrelated roles of YTHDF1 and YTHDF3 in cell fate determination.

The automated processing algorithm to correct the test result of serum neuron-specific enolase affected by specimen hemolysis.

INTRODUCTION: Serum neuron-specific enolase (NSE) is an important tumor marker for small cell lung cancer and neuroblastoma. However, the test of serum NSE compromised by specimen hemolysis is presented as a falsely higher result, which seriously disturbs clinical decision. This study aimed to establish a solution integrated with laboratory information system to clear the bias from hemolysis on serum NSE test. METHODS: The reference range of serum hemolysis index (HI) was first established, and specimen hemolysis rate was compared between HI test and visual observation. NSE concentration in serum pool with normal HI was spiked with serial diluted lysates from red blood cells to deduce individual corrective equation. The agreement between individual corrective equation and original NSE test was assayed by Bland and Altman plots. RESULTS: The high HI existed in 32.6% of specimens from patients. The NSE median of hemolyzed specimens was significant higher than the baseline (p = 0.038), while the corrected NSE median had no difference compared with the baseline (p = 0.757). The mean difference of corrected NSE and initial NSE was 1.92%, the SD of difference was 5.23%, and furthermore, the difference was independent of tendency of HI (Spearman r = -0.069, p = 0.640). The 95% confidence interval of mean difference (from -8.33% to 12.17%) was less than the acceptable bias range (±20%). CONCLUSION: The agreement between individual correction equation and NSE assay was satisfied. Our automated processing algorithm for serum NSE could provide efficient management of posttest data and correct positive bias from specimen hemolysis.

Effect of gal/GalNAc regioisomerism in galactosylated liposomes on asialoglycoprotein receptor-mediated hepatocyte-selective targeting in vivo.

In this study, we describe a novel synthesis of galactosylated lipids by lipase catalysis. Lactitol (Lac), galactose (Gal), or N-acetyl galactosamine (GalNAc) was coupled with cholesterol (CHS) as target head groups by enzyme-catalyzed regioselective esterification to produce three kinds of lipids: CHS-1-Gal, CHS-6-Gal, or CHS-6-GalNAc1. The biological effects of galactosylated lipids carrying different constitutional isomers of the pendent sugar species were investigated. LP-1-Gal (liposomes containing 5.0 molar% of CHS-1-Gal) showed strong binding to tetrameric lectins of Ricinus communis agglutinin (RCA120) in vitro, while LP-6-Gal (liposomes containing 5.0 molar% of CHS-6-Gal) and LP-6-GalNAc (liposomes containing 5.0 molar% of CHS-6-GalNAc) did not. After intravenous injection, LP-6-GalNAc, LP-1-Gal and LP-6-Gal rapidly disappeared from the blood and accumulated rapidly in liver (up to 74.88 ± 4.11%, 58.67 ± 5.75%, and 47.66 ± 4.56% of injected dose/g organ within 4 h, respectively). This is significantly higher than the uptake of unmodified liposomes (Unmod-LP) (18.67 ± 6.07%). Pre-injection of asialofetuin significantly inhibits liver uptake of Gal-liposomes (P < 0.01), with the degree of inhibition appearing in the following order: LP-6-GalNAc (73.29%) > LP-1-Gal (67.06%) > LP-6-Gal (53.61%). More importantly, LP-6-GalNAc was preferentially taken up by hepatocytes and the uptake ratio by parenchymal cells (PC) and nonparenchymal cells (NPC) (PC/NPC ratio) was 11.03 higher than LP-1-Gal (7.32), LP-6-Gal (5.83) and Unmod-LP (2.39). We suggest that liposomes containing the novel galactosylated lipid CHS-6-GalNAc have potential as drug delivery carriers for hepatocyte-selective targeting.

Biological impacts of phosphomimic AtMYB75.

MAIN CONCLUSION: The phosphorylation status of MYB75 at T-131 affects protein stability, flavonoid profiles, and patterns of gene expression. The Arabidopsis transcription factor Myeloblastosis protein 75 (MYB75, AT1G56650) is known to act as a positive transcriptional regulator of genes required for flavonoid and anthocyanin biosynthesis. MYB75 was also shown to negatively regulate lignin and other secondary cell wall biosynthetic genes (Bhargava et al. in Plant Physiol 154(3):1428-1438, 2010). While transcriptional regulation of MYB75 has been described in numerous publications, little is known about post-translational control of MYB75 protein function. In a recent publication, light-induced activation of a MAP kinase (MPK4, AT4G01370) in Arabidopsis was reported to lead to MYB75 phosphorylation at two canonical MPK target sites, threonines, T-126 and T-131. This double phosphorylation event positively influenced MYB75 protein stability (Li et al. in Plant Cell 28(11):2866-2883, 2016). We have examined this phenomenon through use of phosphomutant forms of MYB75 and found that MYB75 is phosphorylated primarily at T-131, and that the phosphorylation of MYB75 recombinant protein in vitro can be catalyzed by multiple MAP kinases, including MPK3 (AT3G45640), MPK6 (AT2G43790), MPK4 and MPK11 (AT1G01560). We also demonstrate that MYB75 can bind to a large number of Arabidopsis MPK's in vitro, suggesting it could be a target of multiple signalling pathways. The impact of MYB75 phosphorylation at T-131 on the function of this transcription factor, in terms of localization, stability, and protein-protein interactions with known binding partners was examined in transgenic lines expressing phosphomimic and phosphonull versions of MYB75, to capture the behaviour of permanently phosphorylated and unphosphorylated MYB75 protein, respectively. In addition, we describe how ectopic over-expression of different phosphovariant forms of MYB75 (MYB75WT, MYB75T131A, and MYB75T131E) affects flavonoid biochemical profiles and global changes of gene expression in the corresponding transgenic Arabidopsis plants.

Arabidopsis ETHYLENE RESPONSE FACTOR 8 (ERF8) has dual functions in ABA signaling and immunity.

BACKGROUND: ETHYLENE RESPONSE FACTOR (ERF) 8 is a member of one of the largest transcription factor families in plants, the APETALA2/ETHYLENE RESPONSIVE FACTOR (AP2/ERF) superfamily. Members of this superfamily have been implicated in a wide variety of processes such as development and environmental stress responses. RESULTS: In this study we demonstrated that ERF8 is involved in both ABA and immune signaling. ERF8 overexpression induced programmed cell death (PCD) in Arabidopsis and Nicotiana benthamiana. This PCD was salicylic acid (SA)-independent, suggesting that ERF8 acts downstream or independent of SA. ERF8-induced PCD was abolished by mutations within the ERF-associated amphiphilic repression (EAR) motif, indicating ERF8 induces cell death through its transcriptional repression activity. Two immunity-related mitogen-activated protein kinases, MITOGEN-ACTIVATED PROTEIN KINASE 4 (MPK4) and MPK11, were identified as ERF8-interacting proteins and directly phosphorylated ERF8 in vitro. Four putative MPK phosphorylation sites were identified in ERF8, one of which (Ser103) was determined to be the predominantly phosphorylated residue in vitro, while mutation of all four putative phosphorylation sites partially suppressed ERF8-induced cell death in N. benthamiana. Genome-wide transcriptomic analysis and pathogen growth assays confirmed a positive role of ERF8 in mediating immunity, as ERF8 knockdown or overexpression lines conferred compromised or enhanced resistance against the hemibiotrophic bacterial pathogen Pseudomonas syringae, respectively. CONCLUSIONS: Together these data reveal that the ABA-inducible transcriptional repressor ERF8 has dual roles in ABA signaling and pathogen defense, and further highlight the complex influence of ABA on plant-microbe interactions.

Construction of nursing-sensitive quality indicators for haemodialysis using Delphi method.

AIMS AND OBJECTIVES: To provide a set of nursing-sensitive quality indicators (NSQIs) for the evaluation of clinical nursing quality in haemodialysis unit. BACKGROUND: There are no established objective indicators for evaluation of the quality of nursing care in haemodialysis units in China. DESIGN AND METHODS: We performed a literature search for eligible studies published from 2006-2016. A total of six studies were screened out from which 13 potential NSQIs were identified. Two rounds of Delphi surveys were conducted with the purpose of collecting opinions from a panel of independent experts. At last, 11 NSQIs were selected by consensus after exclusion of 8 NSQIs and addition of another 6 NSQIs. RESULTS: Two rounds of expert inquiry were conducted; the questionnaire recovery rate was 100%. The average authoritative coefficients Cr for the two rounds were 0.79 and 0.90, respectively. The Kendall W values ranged from 0.273-0.388 (p < 0.001). Eleven NSQIs were identified: nurse-to-patient ratio, dialysis ultrafiltration rate compliance rate, KT/V compliance rate, incidence of emergency during haemodialysis, person-time incidence rate of haemodialysis catheter-related bloodstream infections, incidence of coagulation in extracorporeal circulation, incidence of blood loss in extracorporeal circulation, incidence of pseudoaneurysm induced by fistula puncture, incidence of falls among haemodialysis patients, emergency dialysis rate of outpatients and incidence of fistula complications. CONCLUSION: The identified NSQIs reflect three aspects of haemodialysis nursing quality: importance, rationality of calculation formula and applicability of data collection methods. RELEVANCE TO CLINICAL PRACTICE: The study provides a reference for the evaluation of clinical nursing quality in haemodialysis units.

[Progress in innate immunity-related genes in insects].

Insects have evolved a strong innate immune system to defense pathogens and adverse conditions. Insect innate immune system comprises of humoral immunity and cellular immunity. Humoral immunity mainly includes three signaling pathways, i.e., Toll, IMD and JAK/STAT, by which signal transduction and immune pathways regulate expression of immune-related genes and activate antimicrobial peptides and other effectors. Cellular immunity contains phagocytosis, encapsulation and nodulation of pathogens, which is mediated by hemolymph cells. In recent years, with the rapid development of insect genomics, a large number of immune-related genes have been characterized from insect genome data using bioinformatic methods. Studies on these genes have significantly deepened the understanding of molecular mechanisms of insect innate immune system. Insect immune-related genes can be divided into seven categories by gene functions: recognition, signaling transduction, modulator, effectors, melanization, RNA interference and other genes. The humoral immunity and cellular immunity are regulated by the interactions among these immune-related genes. In this review, we summarize the classification, function and evolution of insect immune-related genes, and propose future research directions of insect innate immunity, which will be helpful for understanding molecular mechanisms of insect innate immune system and developing new strategies for controlling pest insects.

Functionalized Base-Stable Metal-Organic Frameworks for Selective CO2 Adsorption and Proton Conduction.

Metal-organic frameworks (MOFs) have shown great potential for application in various fields, including CO2 capture and proton conduction. For promoting their practical applications, both optimization of a given property and enhancement of chemical stability are crucial. In this work, three base-stable isostructural MOFs, [Ni8 (OH)4 (H2 O)2 (BDP-X)6 ] (Ni-BDP-X; H2 BDP=1,4-bis(4-pyrazolyl)benzene, X=CHO, CN, COOH) with different functional groups, are designed, synthesized, and used in CO2 capture and proton conduction experiments. They possess face-centered cubic topological structures with functional nanoscale cavities. Importantly, these MOFs are fairly stable to maintain their structures in boiling water and 4 M sodium hydroxide solution at room temperature. Functionalization endows them with tunable properties. In gas adsorption studies, these MOFs exhibit selective adsorption of CO2 over CH4 and N2 , and in particular the introduction of COOH groups provides the highest selectivity. In addition, the COOH-functionalized Ni-BDP exhibits a high proton conductivity of 2.22×10-3  S cm-1 at 80 °C and approximately 97 % relative humidity.

Improvement of Orbitofrontal Cortex Function Associated with Blephrospasm Symptom Remission.

OBJECTIVE: To determine whether orbitofrontal cortex (OFC) function improves with blepharospasm (BSP) symptom remission using a verbal fluency task and near-infrared spectroscopy (NIRS). METHODS: Nineteen BSP patients and 9 healthy controls (HCs) matched by gender and education were examined using NIRS. The BSP patients were divided into 2 groups based on the onset or remission of BSP symptoms. A covariance analysis was conducted to analyze the differences among the 3 groups to avoid the influence of different ages. The least significant difference was used to process the post hoc test. RESULTS: The hemoglobin concentration and cerebral blood flow of the bilateral orbitofrontal area (channels 27, 31, 34, 37, and 39) were not significantly different between the BSP remission and HC groups (p > 0.05); however, both groups were significantly increased compared with the BSP onset group (BSP remission group vs. BSP onset group: p = 0.003, p = 0.018, p = 0.013, p = 0.001, and p = 0.011, respectively; BSP remission group vs. BSP onset group: p = 0.037, p = 0.044, p = 0.023, p = 0.016, and p = 0.025, respectively). CONCLUSION: This is the first investigation to control for symptom stages in BSP patients examined via NIRS. Cognitive ability and OFC function improve with BSP symptom remission. Thus, the OFC may be inter-connected with motor and cognitive symptoms in BSP.