Round ligament management during minimally invasive groin hernia repair in women: a systematic review and meta-analysis.

BACKGROUND: Female sex has been associated with worse outcomes after groin hernia repair (GHR), including a higher rate of chronic pain and recurrence. Most of the studies in GHR are performed in males, and the recommendations for females extrapolate from these studies, even though females have anatomy intricacies. The round ligament of the uterus (RLU) is associated with pelvic stabilization and plays a role in sensory function. Transection of the RLU during GHR is controversial as it can allow easier mesh placement but can favor genitourinary complications and chronic pain. As no previous meta-analysis compared preserving versus transecting the RLU during minimally invasive (MIS) GHR, we aim to perform a systematic review and meta-analysis evaluating surgical outcomes comparing the approaches. METHODS: Cochrane Central, Embase, and PubMed databases were systematically searched for studies comparing transection versus preservation of the RLU in MIS groin hernia surgeries. Outcomes assessed were operative time, bleeding, surgical site events, hospital stay, chronic pain, paresthesia, recurrence rates, and genital prolapse rates. Statistical analysis was performed using RevMan 5.4.1. Heterogeneity was assessed with I2 statistics. A review protocol for this meta-analysis was registered at PROSPERO (CRD 42023467146). RESULTS: 1738 studies were screened. A total of six studies, comprising 1131 women, were included, of whom 652 (57.6%) had preservation of the RLU during MIS groin hernia repair. We found no statistical difference regarding chronic pain, paresthesia, recurrence rates, and postoperative complications. We found a longer operative time for the preservation group (MD 6.84 min; 95% CI 3.0-10.68; P = 0.0005; I2 = 74%). CONCLUSION: Transecting the RLU reduces the operative time during MIS GHR with no difference regarding postoperative complication rates. Although transection appears safe, further prospective randomized studies with long-term follow-up and patient-reported outcomes are necessary to define the optimal management of RLU during MIS GHR.

Genomic Analysis and Development of Infectious Clone of a Novel Carlavirus Infecting Blueberry.

A new blueberry virus was discovered using high-throughput sequencing. Using sequence identity values, phylogenetics, and serological and biological properties, we propose the virus, putatively named blueberry virus S (BluVS), to be a distinct species within the genus Carlavirus (family Betaflexiviridae). The genome was analyzed in depth, and an infectious clone was developed to initiate studies on virus pathogenicity. Agroinfiltration of the binary vector construct produced severe systemic symptoms in Nicotiana occidentalis. Back-inoculation using sap from agroinfiltrated N. occidentalis produced identical symptoms to the recipient plants (N. occidentalis), and virus purification yielded flexuous carlavirus-like particles. However, unlike blueberry scorch virus (BlScV), BluVS caused symptomless infection in Chenopodium quinoa and reacted weakly to BlScV antibodies in an enzyme-linked immunosorbent assay. Collectively, the results provide evidence for the distinct speciation of BluVS. The availability of an infectious clone provides tools for future studies on the biology of the virus.

Comparison of High Throughput Sequencing to Standard Protocols for Virus Detection in Berry Crops.

We completed a comprehensive study comparing virus detection between high throughput sequencing (HTS) and standard protocols in 30 berry selections (12 Fragaria, 10 Vaccinium, and eight Rubus) with known virus profiles. The study examined temporal detection of viruses at four sampling times encompassing two growing seasons. Within the standard protocols, reverse transcription (RT) PCR proved better than biological indexing. Detection of known viruses by HTS and RT-PCR nearly mirrored each other. HTS provided superior detection compared with RT-PCR on a wide spectrum of variants and discovery of novel viruses. More importantly, in most cases in which the two protocols showed parallel virus detection, 11 viruses in 16 selections were not consistently detected by both methods at all sampling points. Based on these data, we propose a testing requirement of four sampling times over two growing seasons for berry and potentially other crops, to ensure that no virus remains undetected independent of titer, distribution, or other virus-virus or virus-host interactions.

Economic Studies Reinforce Efforts to Safeguard Specialty Crops in the United States.

Pathogen-tested foundation plant stocks are the cornerstone of sustainable specialty crop production. They provide the propagative units that are used to produce clean planting materials, which are essential as the first-line management option of diseases caused by graft-transmissible pathogens such as viruses, viroids, bacteria, and phytoplasmas. In the United States, efforts to produce, maintain, and distribute pathogen-tested propagative material of specialty crops are spearheaded by centers of the National Clean Plant Network (NCPN). Agricultural economists collaborated with plant pathologists, extension educators, specialty crop growers, and regulators to investigate the impacts of select diseases caused by graft-transmissible pathogens and to estimate the return on investments in NCPN centers. Economic studies have proven valuable to the NCPN in (i) incentivizing the use of clean planting material derived from pathogen-tested foundation plant stocks; (ii) documenting benefits of clean plant centers, which can outweigh operating costs by 10:1 to 150:1; (iii) aiding the development of disease management solutions that are not only ecologically driven but also profit maximizing; and (iv) disseminating integrated disease management recommendations that resonate with growers. Together, economic studies have reinforced efforts to safeguard specialty crops in the United States through the production and use of clean planting material.

Eyeing the past: synchrotron µ-XANES and XRF imaging of tarnish distribution on 19th century daguerreotypes.

Louis-Jacques-Mandé Daguerre introduced the first successful photographic process, the daguerreotype, in 1839. Tarnished regions on daguerreotypes supplied by the National Gallery of Canada were examined using scanning electron microscopy energy-dispersive X-ray spectroscopy and synchrotron-radiation analysis. Synchrotron X-ray fluorescence imaging visualized the distribution of sulfur and chlorine, two primary tarnish contributors, and showed that they were associated with the distribution of image particles on the surface. X-ray absorption near-edge structure spectroscopy determined the tarnish to be primarily composed of AgCl and Ag2S. Au2S, Au2SO4, HAuCl4 and HgSO4 were also observed to be minor contributors. Environmental contamination may be a source of these degradation compounds. Implications of these findings will be discussed.

High Throughput Sequencing For Plant Virus Detection and Discovery.

Over the last decade, virologists have discovered an unprecedented number of viruses using high throughput sequencing (HTS), which led to the advancement of our knowledge on the diversity of viruses in nature, particularly unraveling the virome of many agricultural crops. However, these new virus discoveries have often widened the gaps in our understanding of virus biology; the forefront of which is the actual role of a new virus in disease, if any. Yet, when used critically in etiological studies, HTS is a powerful tool to establish disease causality between the virus and its host. Conversely, with globalization, movement of plant material is increasingly more common and often a point of dispute between countries. HTS could potentially resolve these issues given its capacity to detect and discover. Although many pipelines are available for plant virus discovery, all share a common backbone. A description of the process of plant virus detection and discovery from HTS data are presented, providing a summary of the different pipelines available for scientists' utility in their research.

First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky.

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5'-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.

A raspberry bushy dwarf virus isolate from Ecuadorean Rubus glaucus contains an additional RNA that is a rearrangement of RNA-2.

Sequencing of the complete genome of a raspberry bushy dwarf virus isolate from Rubus glaucus in Ecuador revealed that its RNA-1 and RNA-2 were 5449 and 2231 nucleotides (nt) long, respectively, and phylogenetically closest to isolates from Sweden and Slovenia. In dsRNA analysis of infected plants, an additional band of 3 kbp was observed. Sequencing of this band revealed that it was 3279 nt long. BLAST searches revealed that this band contained a modified version of RNA-2, which consisted of RNA-2 (2231 nt) plus an additional 1048-nt fragment that was concatenated in a reverse-complement fashion to its 5' terminus.

First Report of Raspberry bushy dwarf virus in Andean Blackberry (Rubus glaucus) in Central Ecuador.

During the past two decades, several viruses have been identified from Rubus spp. in wild and commercial plantings around the world (2). In Ecuador, approximately 14 tons of blackberries are produced each year from an estimated area of 5,500 ha. In 2012, a preliminary survey was conducted to determine the presence of RNA viruses in Rubus glaucus, the most prevalent blackberry in Ecuador. Fifteen plants showing leaf mottling and severe mosaic were leaf-sampled from each of five different fields in Azuay Province. A total of 12 pooled samples of 20 g were obtained from the collected symptomatic tissue and used for dsRNA extraction using a cellulose-based protocol for detection of RNA viruses in plants (3). Three dsRNA segments of approximately 5 kbp, 2 kbp, and 900 bp were observed from all 12 dsRNA preparations. The dsRNA was heat-denatured and used as template for the generation of cDNA library using the universal random primer 5'-GCCGGAGCTCTGCAGAATTCNNNNNN-3', for reverse transcription (RT), and the anchor primer 5'-GCCGGAGCTCTGCAGAATTC-3'for PCR as described (1). The PCR products were cloned using a StrataClone Kit (Agilent, CA) and sequenced (Macrogen, Korea). Sequence analysis revealed the presence of Raspberry bushy dwarf virus (RBDV), a pollen-borne Idaeovirus naturally found in several Rubus spp. worldwide. Approximately 120 RBDV sequences obtained from the Ecuadorean isolate were assembled into two contigs belonging to RNA1 and RNA2. Both sequences were re-confirmed by RT-PCR using specific primers. Partial sequences were assigned GenBank Accessions KC315894, KC315893, and KC315892 for the replicase, MP and CP, respectively. Furthermore, BLAST searches showed that the nucleotide sequence corresponding to the replicase was 95% similar to an isolate from the resistance breaking R15 strain (S51557.1), whereas the MP and CP nucleotide sequences were up to 98% similar to a Slovenian isolate (EU796088.1). Primers designed to amplify a 427-bp portion of the CP were used to detect RBDV from four blackberry plantings in two distant production areas: Ambato in Tungurahua Province and Paute in Azuay Province. Leaf mottling and severe mosaic was observed in 90% of blackberry fields in those two locations. Leaf samples (n = 90) were randomly collected from both symptomatic and asymptomatic plants in each location. In Ambato, RBDV was detected in 50% and 40% of symptomatic and asymptomatic plants, respectively. In Paute, RBDV was present in 70% of symptomatic plants and 29% of asymptomatic plants. The presence of RBDV in asymptomatic plants suggests the virus might not be the sole causal agent of the disorder. Further studies are needed to determine the role of RBDV in the observed symptoms, since virus complexes responsible for increased severity of symptoms have been commonly reported in Rubus spp. (4). R. glaucus is native to the tropical highlands (from Ecuador to Mexico) and differs from blackberries commercially grown in the United States and Europe. Therefore, RBDV-induced symptoms reported in blackberry grown in the United States and Europe may not be extrapolated to the Andes berry. To the best of our knowledge, this is the first report of RBDV from blackberry in Ecuador. References: (1) P. Froussard. Nucleic Acids Res. 20:2900, 1992. (2) R. R. Martin et al. Plant Dis. 97:168, 2013. (3). T. J. Morris and J. A. Dodds. Phytopathology 69:854. 1979. (4) D. F. Quito-Avila et al. J. Virol. Methods 179:38, 2012.

Transinguinal preperitoneal (TIPP) versus Lichtenstein for inguinal hernia repair: a systematic review and meta-analysis.

PURPOSE: We aimed to perform a systematic review and meta-analysis comparing postoperative outcomes in inguinal hernia repair with TIPP versus Lichtenstein technique. METHODS: Cochrane Central, Scopus, and PubMed were systematically searched for studies comparing TIPP and Lichtenstein´s technique for inguinal hernia repair. Outcomes assessed were operative time, bleeding, surgical site events, hospital stay, the Visual Analogue Pain Score, chronic pain, paresthesia rates, and recurrence. Statistical analysis was performed using RevMan 5.4.1. Heterogeneity was assessed with I2 statistics and random-risk effect was used if I2 > 25%. RESULTS: 790 studies were screened and 44 were thoroughly reviewed. A total of nine studies, comprising 8428 patients were included, of whom 4185 (49.7%) received TIPP and 4243 (50.3%) received Lichtenstein. We found that TIPP presented less chronic pain (OR 0.43; 95% CI 0.20-0.93 P = 0.03; I2 = 84%) and paresthesia rates (OR 0.27; 95% CI 0.07-0.99; P = 0.05; I2 = 63%) than Lichtenstein group. In addition, TIPP was associated with a lower VAS pain score at 14 postoperative day (MD - 0.93; 95% CI - 1.48 to - 0.39; P = 0.0007; I2 = 99%). The data showed a lower operative time with the TIPP technique (MD - 7.18; 95% CI - 12.50, - 1.87; P = 0.008; I2 = 94%). We found no statistical difference between groups regarding the other outcomes analyzed. CONCLUSION: TIPP may be a valuable technique for inguinal hernias. It was associated with lower chronic pain, and paresthesia when compared to Lichtenstein technique. Further long-term randomized studies are necessary to confirm our findings. Study registration A review protocol for this meta-analysis was registered at PROSPERO (CRD42023434909).

Synchrotron radiation analysis of possible correlations between metal status in human cementum and periodontal disease.

Periodontitis is a serious disease that affects up to 50% of an adult population. It is a chronic condition involving inflammation of the periodontal ligament and associated tissues leading to eventual tooth loss. Some evidence suggests that trace metals, especially zinc and copper, may be involved in the onset and severity of periodontitis. Thus we have used synchrotron X-ray fluorescence imaging on cross sections of diseased and healthy teeth using a microbeam to explore the distribution of trace metals in cementum and adhering plaque. The comparison between diseased and healthy teeth indicates that there are elevated levels of zinc, copper and nickel in diseased teeth as opposed to healthy teeth. This preliminary correlation between elevated levels of trace metals in the cementum and plaque of diseased teeth suggests that metals may play a role in the progress of periodontitis.

Genomic sequences of blackberry chlorotic ringspot virus and strawberry necrotic shock virus and the phylogeny of viruses in subgroup 1 of the genus Ilarvirus.

Three members of subgroup 1 of the genus Ilarvirus: blackberry chlorotic ringspot (BCRV), strawberry necrotic shock (SNSV), and tobacco streak viruses (TSV), may infect Rubus and Fragaria species. All cause symptoms similar to those previously attributed to infection by TSV alone. Although similarities exist among the genomic sequences of the three, phylogenetic analysis shows them to be distinct viruses. These viruses and Parietaria mottle virus, the other currently accepted member of subgroup 1, appear to have evolved from a common ancestral virus, share conserved motifs in the products of the genomic RNAs, and constitute a distinct subgroup within the genus.

First Report of "Candidatus Liberibacter psyllaurous" (synonym "Ca. L. solanacearum") Associated with 'Tomato Vein-Greening' and 'Tomato Psyllid Yellows' Diseases in Commercial Greenhouses in Arizona.

During the winter of 2006-2007, plants in commercial tomato greenhouses (GH-1 and GH-2; total 320 acres [129.5 ha]) in Arizona were infested with the potato psyllid Bactericera cockerelli (Sulc) and more than 60% and ~20% of the plants, respectively, exhibited leaf curling, chlorosis, and shortened internodes. In addition, some plants in GH-1 developed an unusual 'vein-greening' phenotype. Nucleic acids were isolated from 10 symptomatic and three asymptomatic plants from each greenhouse. PCR primers designed to amplify a phytoplasma-like 16S rDNA (850 bp) yielded the expected size product from GH-1 samples, whereas samples from GH-2 and the asymptomatic samples from both greenhouses did not. Several 16S rDNA PCR products (3 of 60) when cloned and sequenced, surprisingly shared 97% homology with 'Candidatus Liberibacter asiaticus' (GenBank No. GQ926917). PCR primers PSY680F 5'-GTTCGGAATAACTGGGCGTA-3' and PSY1R 5'-CCCATAAGGGCCATGAGGACT-3', based on the resultant 16S rDNA sequences, were used to amplify a 680-bp fragment from plant DNA extracts and psyllid lysates (1). A robust PCR product (~680 bp) was obtained from 10 of 10 GH-1 plant extracts (GQ926918) and from a GH-1-derived psyllid colony (28 of 35 adults) (GQ926919) and the tomato plants on which they were reared. In contrast, no 680-bp product was obtained from GH-1 asymptomatic plants (0 of 3), GH-2 plants (0 of 10 symptomatic; 0 of 3 asymptomatic), GH-2-derived psyllid colonies (0 of 35 adults), or psyllid colony tomato plants (data not shown). At least three 680-bp amplicons for each sample type were cloned and 8 to 10 inserts were sequenced for each. BLAST analysis revealed that all 680-bp sequences shared 99 to 100% nt identity with the analogous 16SrDNA from "Ca. Liberibacter psyllaurous" (2) and synonym "Ca. L. solanacearum" (3). A second molecular marker was obtained with the 1611F and 480R primers (2) to amplify the 16SrDNA-23S-ITS (980 bp) from >3 plant extracts and psyllid lysates that tested positive for liberibacter. Clustal W alignment of the 16S-23S-ITS sequences from GH-1 original tomato plants and psyllid colony plants (GQ926920) and psyllids (GQ926921) indicated they were 100% identical to each other and BLAST analysis indicated 99 to 100% shared identity with "Ca. L. psyllaurous" (EU812558) (synonym "Ca. L. solanacearum"). Transmission electron microscopy examination of GH-1 and GH-2 psyllids revealed rod and pleomorphic-shaped bacteria (0.5 to 2.0+ µm) at the brain-salivary gland interface in psyllids from the GH-1 liberibacter-positive colony. No such bacteria were observed in GH-2 liberibacter-negative psyllids. These results support an etiological role of a new liberibacter spp. in the development of the 'vein-greening' symptom phenotype. In contrast, the GH-2 'yellows' phenotype is reminiscent of 'psyllid toxicity' in tomato colonized by B. cockerelli (4). To our knowledge, this is the first report of distinct psyllid-associated diseases in greenhouse tomato in Arizona, one associated with a new 'Ca. Liberibacter' spp., manifest as 'vein-greening' disease, and the other associated with psyllid feeding, in which liberibacter is undetectable in plants and psyllids, and is manifest as the 'tomato psyllid yellows' disease. References: (1) D. R. Frohlich et al. Mol. Ecol. 8:1683, 1999. (2) A. K. Hansen et al. Appl. Environ. Microbiol. 74:5862, 2008. (3) L. W. Liefting et al. Plant Dis. 93:208, 2009. (4) H. J. Pack. Utah Agric. Exp. Stn. Bull. 209, 1929.

Bronchodilatation: noncholinergic, nonadrenergic mediation demonstrated in vivo in the cat.

The composite vagus nerve was stimulated during intravenous infusion of 5-hydroxytryptamine in cats subjected to pharmacologic autonomic blockade with atropine, propranolol, and phentolamine. Bronchial caliber, as assessed by changes in pulmonary resistance, demonstrated a marked dilatation, and dilatation could still be demonstrated after preliminary treatment with reserpine. By stimulating the component branches of the vagus nerve, it was determined that the parasympathetic branch is responsible for this phenomenon.

First Report of Grapevine leafroll-associated virus-3 in Six Wine Grape Cultivars in Idaho.

In recent years, wine grape (Vitis vinifera) acreage in Idaho has expanded because of favorable climatic conditions for premium wine production. Nearly 95% of the 491.7 ha (1,215 acres) of wine grapes are in the Snake River Valley with Canyon County accounting for 81% of the vines. Previous studies have shown that grapevine leafroll disease (GLD) is the most widespread and economically significant virus disease in wine grapes in Washington and Oregon (1,2). However, little is known about the incidence and economic impact of GLD on wine grapes in Idaho. During the 2008 growing season, leaf samples were collected from approximately 25 individual grapevines of red-berried cultivars (Cabernet Sauvignon, Merlot, Syrah, and Petit Syrah) showing GLD symptoms and white-berried (Chardonnay) cultivars with suspected GLD symptoms growing in 10 geographically separate vineyards in Canyon County. An additional five samples were collected from a Lemberger block in Elmore County. Petiole extracts from these samples were tested by single-tube reverse transcription (RT)-PCR with primers LC 1 (5'-CGC TAG GGC TGT GGA AGT ATT-3') and LC 2 (5'-GTT GTC CCG GGT ACC AGA TAT-3') specific for the heat shock protein 70 homologue (HSP-70 gene) of Grapevine leafroll-associated virus-3 (GLRaV-3) (3). All samples, except the Petit Syrah, produced a single band of the expected size of 546 bp. ELISA with GLRaV-3-specific antibodies (BIOREBA AG, Reinach, Switzerland) confirmed the presence of the virus in samples that were positive in RT-PCR. GLRaV-3-specific amplicons were cloned in pCR2.1 plasmid (Invitrogen Corp., Carlsbad, CA) and 2 to 3 independent clones per isolate were sequenced in both orientations. A pairwise comparison of 22 sequences, six from Chardonnay (GenBank Accessions GQ344810, GQ344811, GQ344823, GQ344824, GQ344825, and GQ344826), five from Cabernet Sauvignon (GQ344807, GQ344808, GQ344809, GQ344827, and GQ344828), four each from Merlot (GQ344815, GQ344816, GQ344817, and GQ344818) and Syrah (GQ344819, GQ344820, GQ344821, and GQ344822), and three from Lemberger (GQ344812, GQ344813, and GQ344814) showed 87 to 100% identity at the nucleotide level and 92 to 100% identity at the amino acid level. A pairwise comparison of HSP-70 sequences of GLRaV-3 isolates from Idaho with corresponding sequences of GLRaV-3 isolates from GenBank showed nucleotide sequence identities between 88% (AJ748519) and 100% (DQ780885). Phylogenetic analysis of HSP-70 sequences from Idaho and GenBank showed clustering of Idaho sequences into five groups, with 12 sequences clustering with a Washington isolate (DQ780885), six sequences in a second group clustering with an isolate from Tunisia (AJ748522), two sequences in a third group clustering with an isolate from Austria (AJ748513), and one sequence each in groups four and five clustering with isolates from Italy (AJ748520) and Washington (DQ780889), respectively. The clustering was not cultivar- or vineyard-specific, suggesting separate introductions of different GLRaV-3 isolates in planting materials. To our knowledge, this is the first report of GLRaV-3 in grapevines grown in Idaho. These and previous results (1,2), indicate the wide distribution of GLRaV-3 in several grapevine cultivars in the Pacific Northwest Region. References: (1) R. R. Martin et al. Plant Dis. 89:763, 2005. (2) R. A. Naidu et al. (Abstr.) Phytopathology 96(suppl.):S83, 2006. (3) M. J. Soule et al. Plant Dis. 90:1461, 2006.

First Report of Impatiens necrotic spot virus in Blackberry in the Southeastern United States.

Blackberry yellow vein disease (BYVD) has emerged as an important disease of blackberry (Rubus spp.) in the south and southeastern United States (2,3). In an effort to characterize viruses that may be involved in the disease, double-stranded RNA extracted from a symptomatic 'Apache' blackberry from South Carolina was used for shotgun cDNA cloning (4). Sequence analysis showed that in addition to Blackberry yellow vein associated virus (BYVaV) (2), a constant component of BYVD, sequences of Impatiens necrotic spot virus (INSV) also were obtained. The 623-nt fragment of INSV (Genbank Accession No. EU287930) shared 98% nucleotide and amino acid sequence identity with GenBank Accession No. NC003616. Confirmation of the results of the initial shotgun cloning was done by reverse transcription-PCR with primers INSVF (5' GATCTGTCCTGGGATTGTTC 3') and INSVR (5' GTCTCCTTCTGGTTCTATAATCAT 3') that amplify a 460 base fragment of the M RNA of INSV. Amplicons obtained from single-stranded and dsRNA templates were sequenced and found to be identical with EU287930. The identity of INSV by PCR was also supported by positive results with a commercially available INSV-ELISA kit (AC Diagnostics, Fayetteville, AR). Earlier, more than 400 plants from North Carolina, South Carolina, and Virginia with BYVD and other virus-like symptoms were tested for INSV by ELISA and approximately 33% were found to be infected with the virus (1). Thus, INSV appears to be one of the major viruses infecting blackberry in the southeastern United States, and it remains to be seen if INSV acts synergistically with BYVaV and other viruses to contribute to the severity of BYDV. To our knowledge, this is the first report of INSV infecting Rubus spp. References: (1) T. L. Guzmán-Baeny. M.S. thesis. North Carolina State University, Raleigh, 2003. (2) J. Susaimuthu et al. Plant Pathol. 55:607, 2006. (3) J. Susaimuthu et al. Virus Res. 131:145, 2008. (4) I. E. Tzanetakis et al. J. Virol. Methods 124:73, 2005.

First Report of Rosa multiflora cryptic virus in Rosa multiflora in the Eastern United States.

In the process of attempting to identify the rose rosette agent, double-stranded RNA was isolated from several symptomatic Rosa multiflora plants from northwestern Arkansas. The pattern of the dsRNA bands differed among the five samples used in this study, suggesting the presence of several viruses. Four of the five plants tested had two predominant bands of approximately 1.8 and 1.5 kbp, a pattern similar to that observed in plants infected with Fragaria chiloensis cryptic virus (FCCV; 3), and further steps were taken for the identification of the putative virus. One plant that only had the two predominant bands was chosen for further characterization using degenerate oligonucleotide primed (DOP)-PCR (4). Twenty clones were sequenced and all were found to be part of two contigs of 937 and 1,087 nucleotides that have been deposited in GenBank (Accession nos. EU350962 and EU350963). The two contigs had 82 and 72% nucleotide and 85 and 69% amino acid sequence identities with RNA 1 and 2 of FCCV, respectively; 98 and 99% amino acid sequence identities with Rose multiflora cryptic virus (RMCV; 2) RNA 1 and 3, respectively. Oligonucleotide primers F (5' gaatgggaactacgctttgc 3') and R (5' cgatgcttccaatgatgttg 3') designed to amplify a 196-bp region of RNA 1 of the virus were tested using ss and dsRNA templates and were shown to be virus specific after sequencing of multiple PCR amplicons. Just before submission of this manuscript, the complete sequence of RMCV, a virus isolated from R. multiflora showing rose spring dwarf symptoms was published (2). RMCV and the dsRNAs isolated from R. multiflora in Arkansas are the same species because they share 99% nucleotide sequence identity. Cryptic viruses are expected to be symptomless though mild symptoms have been associated with several cryptic viruses (1). The presence of RMCV has been verified in both symptomless and plants infected with two severe diseases of rose, thus, the virus could play a role in the phenotype of these diseases as part of a virus complex. To our knowledge, this is the first report of RMCV in the eastern United States, which is closley related to RMCV from California (2). In the review process of this note, it was brought to our attention that a similar virus named Rose cryptic virus 1 was being investigated in Mississippi (Genbank Accession Nos. EU413666-68), supporting the statement that this virus is probably widespread in Rosa germplasm. References: (1) L. Chen et al. Arch. Virol. 151:849, 2006. (2) N. M. Salem et al. Arch. Virol. 153:455, 2008. (3) I. E. Tzanetakis et al. Virus Genes 36:267, 2008. (4) I. E. Tzanetakis and R. R. Martin. J. Virol. Methods 149:167, 2008.

First Report of the Occurrence of Grapevine fanleaf virus in Washington State Vineyards.

Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5'-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231-2250) and reverse primer (5'-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533-2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.

Epidemiology of Xiphinema americanum and Tomato ringspot virus on Red Raspberry, Rubus idaeus.

Population dynamics of Xiphinema americanum and transmission of Tomato ringspot virus (ToRSV) were studied in a red raspberry field in Washington State. Population densities of X. americanum were highest in the winter, lowest in the summer, and were correlated with precipitation (R2 = 0.42). All nematode stages were present throughout the year. Gravid females were observed only in the spring, indicating one generation per year. The sequence of the coat protein of the ToRSV from this field was similar to those of other raspberry isolates from the Pacific Northwest. Cucumber seedlings were planted in soil collected monthly from the field and were evaluated for nematode transmission of ToRSV by enzyme-linked immunosorbent assay (ELISA). The proportion of assay plants infected with ToRSV was negatively correlated with nematode densities (R2 = 0.31). In another study, ToRSV was detected by ELISA in fine roots of raspberry plants 5 months after planting in field soil infested with viruliferous nematodes, in all subterranean portions of plants after 12 months, and in all aerial portions the second year. The rate of spread of ToRSV in a raspberry field was 70 cm per year. These results suggest that the rate of ToRSV spread is limited by systemic spread of virus in plants when nematode-infested soil is not transported in the field.

Mediators of histamine release from human platelets, lymphocytes, and granulocytes.

Lysates of mixed human leukocyte suspensions released histamine from intact human leukocytes in vitro. Microgram quantities of leukocyte lysate protein released up to 90% of the total available histamine. The mixed leukocyte lysates were separated by differential centrifugation into nuclear (800 g pellet), lysosomal (25,000 g pellet), and postlysosomal supernatant (25,000 g supernatant) fractions. The degree of separation of the lysosomal from the other two fractions was assessed by measuring the relative activities of four lysosomal enzymes. The average distribution of enzyme activity was 11 +/-2% (mean +/-1 SD), 72 +/-10%, and 17 +/-8% for the nuclear, lysosomal, and supernatant fractions respectively. The histamine-releasing activity was equally distributed between the lysosomal and supernatant fractions, each of which had 5-fold greater activity than the nuclear fraction. Purified suspensions of platelets, lymphocytes, and granulocytes were prepared, and the lysates of these suspensions all had histamine-releasing activity. Centrifugation at 100,000 g for 18 hr sedimented the histamine-releasing activity from all three types of lysate. After 20% ethanol fractionation for the preparation of cationic protein, only the activity from the platelet lysates was found in the 20% ethanol insoluble fraction. These mediators of histamine release from human platelets, lymphocytes, and granulocytes may play a role in the development of the vasodilation and increased vascular permeability which characterize the acute inflammatory response.