First Report of Potato mop-top virus on Potato in Poland.

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5'GGTTTGTTTACCACCCTTGG3' (3) and PMTV2 5'AAAAGCCTGAGCGGTTAATTG3' (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Lódz County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

Molecular techniques for detection of Tribolium confusum infestations in stored products.

The confused flour beetle, Tribolium confusum Jacquelin du Val (Coleoptera: Tenebrionidae) is a stored-product pest that contaminates a wide range of food products, from flour and cereals to spices. The insect reduces food quality and is responsible for large economic losses every year. Although several methods for detection of stored-product pests are common and widely used, they are time-consuming and expensive. Therefore, establishing molecular methods of detection of stored-product pests could provide a useful alternative method. We have undertaken attempts to establish methods of detection of T. confusum based on molecular biology techniques of standard and real-time polymerase chain reaction (PCR). Total DNA of T. confusum and red flour beetle, Tribolium castaneum (Herbst) (Coleoptera: Tenebrionidae), used as a negative control, was isolated from insects and used as a template in standard and real-time PCR reactions. Specific primers have been designed on the basis of sequences of internal transcribed spacer (ITS) fragment of rDNA and subunit I of mitochondrial cytochrome oxidase of T. confusum available in the GenBank database. Standard PCR reactions with primers specific to the ITS fragment proved to be reliable and sensitive. Real-time PCR reactions with primers specific for mitochondrial DNA are considered to serve as a supplemental detection method for quantitative assessment of the infestation level.

Fluorescence lifetime imaging of calcium using Quin-2.

We describe the use of a new imaging technology, fluorescence lifetime imaging (FLIM), for the imaging of the calcium concentrations based on the fluorescence lifetime of a calcium indicator. The fluorescence lifetime of Quin-2 is shown to be highly sensitive to [Ca2+]. We create two-dimensional lifetime images using the phase shift and modulation of the Quin-2 in response to intensity-modulated light. The two-dimensional phase and modulation values are obtained using a gain-modulated image intensifier and a slow-scan CCD camera. The lifetime values in the 2D image were verified using standard frequency-domain measurements. Importantly, the FLIM method does not require the probe to display shifts in the excitation or emission spectra, which may allow Ca2+ imaging using other Ca2+ probes not in current widespread use due to the lack of spectral shifts. Fluorescence lifetime imaging can be superior to stationary (steady-state) imaging because lifetimes are independent of the local probe concentration and/or intensity, and should thus be widely applicable to chemical imaging using fluorescence microscopy.

Fluorescence lifetime imaging of intracellular calcium in COS cells using Quin-2.

We describe the first fluorescence lifetime images of cells. To demonstrate this new capability we measured intracellular images of Ca2+ in COS cells based on the Ca(2+)-dependent fluorescence lifetime of Quin-2. Apparent fluorescence lifetimes were measured by the phase-modulation method using a gain-modulated image intensifier and a slow-scan CCD camera. We describe methods to correct the images for photobleaching during acquisition of the data, and to correct for the position-dependent response of the image intensifier. The phase angle Quin-2 images were found to yield lower than expected Ca2+ concentrations, which appears to be the result of the formation of fluorescent photoproducts by Quin-2. Fluorescence lifetime imaging (FLIM) does not require wavelength-radiometric probes and appears to provide new opportunities for chemical imaging of cells.

Frequency domain imaging of absorbers obscured by scattering.

Multiple pixel, frequency domain measurements of phase shift, theta, and modulation, m, in a phantom containing an absorber obscured by a relatively non-absorbing scattering solution are presented in combination with a theory of photon migration imaging. Results employing a single point source show that two dimensional theta measurements made in the presence (theta presence) and in the absence (theta absence) of an absorber can be used to create delta theta images. delta theta (theta absence-theta presence) images can be used to detect as well as locate the three dimensional position of the absorber. Images of mpresence measured in the presence of the absorber normalized by mabsence also provided detection and two dimensional location of its position. Images of % mpresence/mabsence at higher modulation frequencies provided greater resolution as predicted by photon migration theory. Neither theta nor m images alone could be used to detect or locate the presence of the absorber.

Two-photon excitation of dioxane: time-resolved measurements of excited state complex formation with water.

We observed emission from the non-aromatic hydrocarbon 1,4-dioxane upon illumination with ps pulses at 380 nm. The emission intensity depended quadratically on incident power at 380 nm, indicating a two-photon process. In the absence of water the intensity decay was close to a single exponential, but displayed some evidence of an excited state process. In the presence of 1% water the emission spectra shifted dramatically to long wavelength. Water also resulted in wavelength-dependent intensity decays with negative pre-exponential factors on the long wavelength side of the emission, demonstrating the presence of an excited state reaction. At this water concentration the results are consistent with a two-state model due to emission from dioxane and a dioxane and a dioxane-water complex.

Plasmon-controlled fluorescence towards high-sensitivity optical sensing.

Fluorescence spectroscopy is widely used in chemical and biological research. Until recently most of the fluorescence experiments have been performed in the far-field regime. By far-field we imply at least several wavelengths from the fluorescent probe molecule. In recent years there has been growing interest in the interactions of fluorophores with metallic surfaces or particles. Near-field interactions are those occurring within a wavelength distance of an excited fluorophore. The spectral properties of fluorophores can dramatically be altered by near-field interactions with the electron clouds present in metals. These interactions modify the emission in ways not seen in classical fluorescence experiments. Fluorophores in the excited state can create plasmons that radiate into the far-field and fluorophores in the ground state can interact with and be excited by surface plasmons. These reciprocal interactions suggest that the novel optical absorption and scattering properties of metallic nanostructures can be used to control the decay rates, location, and direction of fluorophore emission. We refer to these phenomena as plasmon-controlled fluorescence (PCF). An overview of the recent work on metal-fluorophore interactions is presented. Recent research combining plasmonics and fluorescence suggest that PCF could lead to new classes of experimental procedures, novel probes, bioassays, and devices.

Molecular techniques for the detection of granary weevil (Sitophilus granarius L.) in wheat and flour.

The granary weevil (Sitophilus granarius L.) is a stored grain pest that causes major economic losses. It reduces the quantity and quality of the grain by its feeding and excretion. Sequences of S. granarius mitochondrial cytochrome oxidase subunits genes mtCOI and mtCOII were analysed and compared with mtCOI/II sequences available in GenBank. The analysed genes displayed a high level of homology between corresponding subunits. Attempts were undertaken to develop detection methods for contamination by S. granarius in wheat and wheat flour based on the molecular biology techniques: standard and real-time polymerase chain reaction (PCR) with a TaqMan molecular probe. (TaqMan probes are dual-labelled hydrolysis probes) Specific primers designed based on available sequences for mtCOI and mtCOII genes were applied and optimal reaction conditions established. The specificity of both methods was studied by using a species closely related to S. granarius: S. oryzae and S. zeamais. It is shown that the sensitivity threshold was very high - we were able to detect the equivalent of one beetle per 100 kg of flour when the real-time PCR with TaqMan probe method was applied to model samples. The primer sets used turned out to be species specific, and the technique was rapid, reliable and very sensitive.

Absorption and luminescence spectroscopic analysis of tautomeric forms of protonatedN,N-dimethyl-N'-(1-nitro-9-acridinyl)-1,3-propanediamine (nitracrine) and its nitro isomers in poly(vinyl alcohol) films.

The electronic absorption, fluorescence, and phosphorescence excitation spectra, as well as the fluorescence and phosphorescence spectra, at either room or liquid nitrogen temperatures, were measured forN,N-dimethyl-N'-(1-nitro-9-acridinyl)-1,3-propanediamine and its three nitro isomers in acidified poly(vinyl alcohol) (PVA) film. The spectral characteristics obtained reveal the existence of the compounds studied in at least two structural forms. The results are interpreted in terms of the tautomeric phenomena which originate due to the migration of the hydrogen atom, which is bound to the nitrogen atom attached to the carbon atom (9), to the acridine ring nitrogen.

Fluorescence lifetime imaging.

We describe a new fluorescence imaging methodology in which the image contrast is derived from the fluorescence lifetime at each point in a two-dimensional image and not the local concentration and/or intensity of the fluorophore. In the present apparatus, lifetime images are created from a series of images obtained with a gain-modulated image intensifier. The frequency of gain modulation is at the light-modulation frequency (or a harmonic thereof), resulting in homodyne phase-sensitive images. These stationary phase-sensitive images are collected using a slow-scan CCD camera. A series of such images, obtained with various phase shifts of the gain-modulation signal, is used to determine the phase angle and/or modulation of the emission at each pixel, which is in essence the phase or modulation lifetime image. An advantage of this method is that pixel-to-pixel scanning is not required to obtain the images, as the information from all pixels is obtained at the same time. The method has been experimentally verified by creating lifetime images of standard fluorophores with known lifetimes, ranging from 1 to 10 ns. As an example of biochemical imaging we created life-time images of Yt-base when quenched by acrylamide, as a model for a fluorophore in distinct environments that affect its decay time. Additionally, we describe a faster imaging procedure that allows images in which a specific decay time is suppressed to be calculated, allowing rapid visualization of unique features and/or regions with distinct decay times. The concepts and methodologies of fluorescence lifetime imaging (FLIM) have numerous potential applications in the biosciences. Fluorescence lifetimes are known to be sensitive to numerous chemical and physical factors such as pH, oxygen, temperature, cations, polarity, and binding to macromolecules. Hence the FLIM method allows chemical or physical imaging of macroscopic and microscopic samples.

Time-resolved spectral observations of cadmium-enriched cadmium sulfide nanoparticles and the effects of DNA oligomer binding.

We measured the steady-state and time-resolved fluorescence spectral properties of cadmium-enriched nanoparticles (CdS-Cd2+). These particles displayed two emission maxima, at 460 and 580 nm. The emission spectra were independent of excitation wavelength. Surprisingly, the intensity decays were strongly dependent on the observation wavelength, with longer decay times being observed at longer wavelengths. The mean lifetime increased from 150 to 370 ns as the emission wavelength was increased from 460 to 650 nm. The wavelength-dependent lifetimes were used to construct the time-resolved emission spectra, which showed a growth of the long-wavelength emission at longer times, and decay-associated spectra, which showed the longer wavelength emission associated with the longer decay time. These nanoparticles displayed anisotropy values as high as 0.35, depending on the excitation and emission wavelengths. Such high anisotropies are unexpected for presumably spherical nanoparticles. The anisotropy decayed with two correlation times near 5 and 370 ns, with the larger value probably due to overall rotational diffusion of the nanoparticles. Addition of a 32-base pair oligomer selectively quenched the 460-nm emission, with less quenching being observed at longer wavelengths. The time-resolved intensity decays were minimally affected by the DNA, suggesting a static quenching mechanism. The wavelength-selected quenching shown by the nanoparticles may make them useful for DNA analysis.

Fluorescence lifetime imaging of intracellular calcium.

Fluorescence lifetime imaging microscopy (FLIM) is a new methodology for studying the spatial and temporal dynamics of macromolecule, molecules, and ions in living cells. In FLIM image contrast is derived from the mean fluorescence lifetime at each point in a two-dimensional image. In our case the lifetime was measured by the phase-modulation method. We describe our FLIM apparatus, which consists of a fluorescence microscope, high-speed gated proximity focused MCP image intensifier, and slow-scan CCD camera. To accomplish subnanosecond time-resolved imaging, the gain of the image intensifier is modulated with a high-frequency signal, resulting in stationary phase-sensitive intensity images on the image intensifier. These images are recorded using a cooled slow-scan CCD camera and stored in an image processor. The lifetime images are created from a series of phase-sensitive images at various phase shift of the gain-modulation signal. We demonstrate calcium concentration imaging in living COS cells based on Ca(2+)-induced lifetime changes of Quin-2. The phase-angle image is mapped to the Ca(2+) concentration image using anin vitro-determined calibration curve. The Ca(2+) concentration was found to be uniform throughout the cell. In contrast, the intensity image shows significant spatial differences, which likely reflect variations in the thickness and distribution of probe within the cell.

Fluorescence lifetime imaging of free and protein-bound NADH.

We introduce a methodology, fluorescence lifetime imaging (FLIM), in which the contrast depends on the fluorescence lifetime at each point in a two-dimensional image and not on the local concentration and/or intensity of the fluorophore. We used FLIM to create lifetime images of NADH when free in solution and when bound to malate dehydrogenase. This represents a challenging case for lifetime imaging because the NADH decay times are just 0.4 and 1.0 ns in the free and bound states, respectively. In the present apparatus, lifetime images are created from a series of phase-sensitive images obtained with a gain-modulated image intensifier and recorded with a charge-coupled device (CCD) camera. The intensifier gain is modulated at the light-modulation frequency or a harmonic thereof. A series of stationary phase-sensitive images each obtained with various phase shifts of the gain-modulation signal, is used to determine the phase angle or modulation of the emission at each pixel, which is in essence the lifetime image. We also describe am imaging procedure that allows specific decay times to be suppressed, allowing in this case suppression of the emission from either free or bound NADH. Since the fluorescence lifetimes of probes are known to be sensitive to numerous chemical and physical factors such as pH, oxygen, temperature, cations, polarity, and binding to macromolecules, this method allows imaging of the chemical or property of interest in macroscopic and microscopic samples. The concept of FLIM appears to have numerous potential applications in the biosciences.