Detection of exonuclease activities in restriction endonuclease preparations using an enforcement plasmid for kanamycin-resistance selection.

A new enforcement (kyosei-) cloning plasmid vector, designated pKF4, was constructed which confers kanamycin resistance (KmR) and enforces streptomycin sensitivity (SmS). Since it is important to employ restriction endonuclease (ENase) preparations free of exonuclease (Exo) activities for effective use of the kyosei-cloning procedure [Hashimoto-Gotoh et al., Gene 137 (1993) 211-216], ENases such as HpaI and SmaI purchased from four different suppliers were examined for possible contamination by exonucleases using pKF4. The plasmid DNA was digested with either ENase, ligated and transformed into Escherichia coli mutants, rpsL, supE, trpR. With pKF4 intact DNA (approx. 8 ng), 2.3 x 10(5) KmR transformant and four KmRSmR transformant colonies were obtained; the efficiency of transformation plating (ETP) of the intact DNA was approx. 2 x 10(-5). On the other hand, the ETP values were significantly higher by one to three orders of magnitude when cut and re-joined DNAs were used under the same conditions in six out of eight ENase samples examined. The results indicate that even commercially supplied ENases, that should have passed their quality control test, could have been contaminated with Exo sufficient to interfere with effective use of the kyosei-cloning method. Therefore, it is advisable to examine ENase samples for possible contamination with Exo activities, in order to choose the right preparations for this method at the beginning of the experiments.

An oligodeoxyribonucleotide-directed dual amber method for site-directed mutagenesis.

A simple procedure for in vitro site-directed mutagenesis (SDM) was developed using two oligodeoxyribonucleotide (oligo) primers, one serving as selection primer and the other for mutagenesis in the target DNA (mutagenic primer). The mutant clones can be selected by reversion mutations of dual amber (am) to dual Gln codons in the cat gene, resulting in a chloramphenicol-resistant phenotype in sup(O) host cells. Unlike previously reported procedures, the new method requires neither special chemical reagents, nor single-stranded DNA purification, nor any additional biochemical treatments such as multiple PCRs, restriction digestion and so on, but utilises one of the oligo-directed dual am (ODA) plasmids, i.e., pKF16c, pKF17c, pKF18c or pKF19c. The two amber (am) mutations located two codons apart from each other in cat (catam2) can be simultaneously reverted with a 20-nucleotide primer (CQ, pAACCAGACCGTTCAGCTGGA) during primer extension. In a model experiment using the lacZ' gene, an am mutation or a single-bp deletion (sbd) mutation was frequently co-introduced in lacZ' using a mixture of am- or sbd-encoding mutagenic primer for lacZ', and the CQ primer for catam2. Applying this procedure to the human AT cDNA (encoding antithrombin), a missense mutation (Arg406-->Met) in one of the human AT variants, AT-Kyoto, involved in congenital thrombosis disease, was introduced efficiently into the wild-type cDNA (> 85%).

Identification of the antithrombin III Kyoto mutation by restriction fragment length polymorphism analysis.

Clarification of the molecular biologic abnormality underlying antithrombin III (AT III) deficiency is important to a complete understanding of the coagulation system. We have reported previously the deficiency of AT III Kyoto in which there has been a single substitution of thymine for guanine at codon 406 of exon VI. This results in the amino acid substitution of methionine for arginine. The nucleotide substitution at codon 406 in the mutant allele eliminates a Hae III restriction site. Accordingly, Hae III restriction analysis of the PCR fragments in this family could segregate the deficient members from the normal members, enabling the detection of the existence of Hae III restriction fragment length polymorphism of the PCR product (PCR-RFLP). Moreover, we confirmed by direct DNA sequencing with the polymerase chain reaction that the tested deficient members in an AT III Kyoto family inherit the same type of mutation in their genes. In conclusion, Hae III PCR-RFLP can be a useful method for screening of this mutant gene in the family.

Protein C deficiency found in a patient with acute myocardial infarction: a single base mutation 157 Arg (CGA) to stop codon (TGA).

Protein C has an important role in the regulatory mechanisms of coagulation and fibrinolysis. In patients with heterozygous protein C deficiency, there is an increased risk for thromboembolic disease, especially in the venous system. We describe a patient with protein C deficiency presenting with an acute myocardial infarction (AMI). Direct sequence analysis of the whole protein C gene detected a single base mutation at exon 7; 157 [Arg(CGA) to stop codon (TGA): 6182 C to T]. Thus, the patient was suspected to have a deficiency of the protein C heavy chain molecule, resulting in both a low protein C antigen and activity level. The mutation was also found in the propositus' son and was confirmed by differential termination of the primer extension (DTPE).

[Bathing in bed accelerates the recovery of skin temperature after ethanol-loading].

Bathing in bed (BB) is an essential nursing technique applied to patients with restricted physical abilities. The aim of this technique is to keep the functions of the skin as an external barrier and to prevent the patients from infection and decubitus. However, the effect of BB on the blood circulation of the skin has not yet been identified, and the data observed are controversial. We have evaluated the effects of BB on the blood circulation of the skin by use of thermography. BB was applied on the right side of the back (RB) in 6 healthy female subjects who exposed both sides of their back (RB and LB) at room temperature. Ethanol was applied on the 5 x 5 cm area of RB and LB after BB, and recovery of the skin temperature was observed. After BB, the average temperature of RB was significantly lower than that of LB. This shows that BB decreases temperature of the skin exposed in the air probably due to the supply of water by washcloth. Recovery of the skin temperature after the ethanol-loading was accelerated on RB. This indicates that BB facilitates the response of the blood vessels in the skin.