The role of host genetics in the immune response to SARS-CoV-2 and COVID-19 susceptibility and severity.

This article provides a review of studies evaluating the role of host (and viral) genetics (including variation in HLA genes) in the immune response to coronaviruses, as well as the clinical outcome of coronavirus-mediated disease. The initial sections focus on seasonal coronaviruses, SARS-CoV, and MERS-CoV. We then examine the state of the knowledge regarding genetic polymorphisms and SARS-CoV-2 and COVID-19. The article concludes by discussing research areas with current knowledge gaps and proposes several avenues for future scientific exploration in order to develop new insights into the immunology of SARS-CoV-2.

Distinct Homologous and Variant-Specific Memory B-Cell and Antibody Response Over Time After Severe Acute Respiratory Syndrome Coronavirus 2 Messenger RNA Vaccination.

The durability of protective humoral immunity after severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) vaccination and infection is largely dependent on the generation and persistence of antigen-specific isotype-switched memory B cells (MBCs) and long-lived plasma cells that reside in the bone marrow and secrete high-affinity neutralizing antibodies. The reactivity of vaccine-induced MBCs to emerging clinically significant SARS-CoV-2 variants of concern (VoCs) is largely unknown. In a longitudinal cohort study (up to 6 months following coronavirus disease 2019 messenger RNA vaccination), we measured MBCs in concert with other functional antibody measures. We found statistically significant differences between the frequencies of MBCs responding to homologous and VoC (Beta, Gamma, and Delta) receptor-binding domains after vaccination that persisted over time. In concert with a waning antibody response, the reduced MBC response to VoCs could translate to a weaker subsequent recall immune response and increased susceptibility to the emerging SARS-CoV-2 variant strains after vaccination.

The Influence of Sex, Body Mass Index, and Age on Cellular and Humoral Immune Responses Against Measles After a Third Dose of Measles-Mumps-Rubella Vaccine.

BACKGROUND: A third dose of measles-mumps-rubella vaccine (MMR3) is recommended in mumps outbreak scenarios, but the immune response and the need for widespread use of MMR3 remain uncertain. Herein, we characterized measles-specific immune responses to MMR3 in a cohort of 232 healthy subjects. METHODS: Serum and peripheral blood mononuclear cells (PBMCs) were sampled at day 0 and day 28 after MMR3. Measles-specific binding and neutralizing antibodies were quantified in sera by enzyme-linked immunosorbent assay and a microneutralization assay, respectively. PBMCs were stimulated with inactivated measles virus, and the release of cytokines/chemokines was assessed by a multiplex assay. Demographic variables of subjects were examined for potential correlations with immune outcomes. RESULTS: Of the study participants, 95.69% and 100% were seropositive at day 0 and day 28, respectively. Antibody avidity significantly increased from 38.08% at day 0 to 42.8% at day 28 (P = .00026). Neutralizing antibodies were significantly enhanced, from 928.7 at day 0 to 1289.64 mIU/mL at day 28 (P = .0001). Meanwhile, cytokine/chemokine responses remained largely unchanged. Body mass index was significantly correlated with the levels of inflammatory cytokines/chemokines. CONCLUSIONS: Measles-specific humoral immune responses, but not cellular responses, were enhanced after MMR3 receipt, extending current understanding of immune responses to MMR3 and supporting MMR3 administration to seronegative or high-risk individuals.

Mumps virus-specific immune response outcomes and sex-based differences in a cohort of healthy adolescents.

Despite high levels of MMR-II usage in the US, mumps outbreaks continue to occur. Evidence suggests that mumps vaccine-induced humoral immunity wanes over time. Relatively few studies have examined cell-mediated immunity or reported on sex-based differences. To better understand sex-based differences in the immune response to mumps vaccine, we measured neutralizing antibody titers and mumps-specific cytokine/chemokine responses in a cohort of 748 adolescents and young adults after two doses of MMR vaccine. We observed significantly higher neutralizing antibody titers in females than in males (120.8 IU/mL, 98.7 IU/mL, p = 0.038) but significantly higher secretion levels of MIP-1α, MIP-1ß, TNFα, IL-6, IFNγ, and IL-1ß in males compared to females. These data demonstrate that sex influences mumps-specific humoral and cell-mediated immune response outcomes, a phenomenon that should be considered during efforts to improve vaccines and prevent future outbreaks.

Transcriptional signatures associated with rubella virus-specific humoral immunity after a third dose of MMR vaccine in women of childbearing age.

Multiple factors linked to host genetics/inherent biology play a role in interindividual variability in immune response outcomes after rubella vaccination. In order to identify these factors, we conducted a study of rubella-specific humoral immunity before (Baseline) and after (Day 28) a third dose of MMR-II vaccine in a cohort of 109 women of childbearing age. We performed mRNA-Seq profiling of PBMCs after rubella virus in vitro stimulation to delineate genes associated with post-vaccination rubella humoral immunity and to define genes mediating the association between prior immune response status (high or low antibody) and subsequent immune response outcome. Our study identified novel genes that mediated the association between prior immune response and neutralizing antibody titer after a third MMR vaccine dose. These genes included the following: CDC34; CSNK1D; APOBEC3F; RAD18; AAAS; SLC37A1; FAS; and JAK2. The encoded proteins are involved in innate antiviral response, IFN/cytokine signaling, B cell repertoire generation, the clonal selection of B lymphocytes in germinal centers, and somatic hypermutation/antibody affinity maturation to promote optimal antigen-specific B cell immune function. These data advance our understanding of how subjects' prior immune status and/or genetic propensity to respond to rubella/MMR vaccination ultimately affects innate immunity and humoral immune outcomes after vaccination.

Senescent cell clearance by the immune system: Emerging therapeutic opportunities.

Senescent cells (SCs) arise from normal cells in multiple organs due to inflammatory, metabolic, DNA damage, or tissue damage signals. SCs are non-proliferating but metabolically active cells that can secrete a range of pro-inflammatory and proteolytic factors as part of the senescence-associated secretory phenotype (SASP). Senescent cell anti-apoptotic pathways (SCAPs) protect SCs from their own pro-apoptotic SASP. SCs can chemo-attract immune cells and are usually cleared by these immune cells. During aging and in multiple chronic diseases, SCs can accumulate in dysfunctional tissues. SCs can impede innate and adaptive immune responses. Whether immune system loss of capacity to clear SCs promotes immune system dysfunction, or conversely whether immune dysfunction permits SC accumulation, are important issues that are not yet fully resolved. SCs may be able to assume distinct states that interact differentially with immune cells, thereby promoting or inhibiting SC clearance, establishing a chronically pro-senescent and pro-inflammatory environment, leading to modulation of the SASP by the immune cells recruited and activated by the SASP. Therapies that enhance immune cell-mediated clearance of SCs could provide a lever for reducing SC burden. Such therapies could include vaccines, small molecule immunomodulators, or other approaches. Senolytics, drugs that selectively eliminate SCs by transiently disabling their SCAPs, may prove to alleviate immune dysfunction in older individuals and thereby accelerate immune-mediated clearance of SCs. The more that can be understood about the interplay between SCs and the immune system, the faster new interventions may be developed to delay, prevent, or treat age-related dysfunction and the multiple senescence-associated chronic diseases and disorders.

SARS-CoV-2 immunity: review and applications to phase 3 vaccine candidates.

Understanding immune responses to severe acute respiratory syndrome coronavirus 2 is crucial to understanding disease pathogenesis and the usefulness of bridge therapies, such as hyperimmune globulin and convalescent human plasma, and to developing vaccines, antivirals, and monoclonal antibodies. A mere 11 months ago, the canvas we call COVID-19 was blank. Scientists around the world have worked collaboratively to fill in this blank canvas. In this Review, we discuss what is currently known about human humoral and cellular immune responses to severe acute respiratory syndrome coronavirus 2 and relate this knowledge to the COVID-19 vaccines currently in phase 3 clinical trials.

Immunosenescence and human vaccine immune responses.

The age-related dysregulation and decline of the immune system-collectively termed "immunosenescence"-has been generally associated with an increased susceptibility to infectious pathogens and poor vaccine responses in older adults. While numerous studies have reported on the clinical outcomes of infected or vaccinated individuals, our understanding of the mechanisms governing the onset of immunosenescence and its effects on adaptive immunity remains incomplete. Age-dependent differences in T and B lymphocyte populations and functions have been well-defined, yet studies that demonstrate direct associations between immune cell function and clinical outcomes in older individuals are lacking. Despite these knowledge gaps, research has progressed in the development of vaccine and adjuvant formulations tailored for older adults in order to boost protective immunity and overcome immunosenescence. In this review, we will discuss the development of vaccines for older adults in light of our current understanding-or lack thereof-of the aging immune system. We highlight the functional changes that are known to occur in the adaptive immune system with age, followed by a discussion of current, clinically relevant pathogens that disproportionately affect older adults and are the central focus of vaccine research efforts for the aging population. We conclude with an outlook on personalized vaccine development for older adults and areas in need of further study in order to improve our fundamental understanding of adaptive immunosenescence.

Polymorphisms in the Wilms Tumor Gene Are Associated With Interindividual Variations in Rubella Virus-Specific Cellular Immunity After Measles-Mumps-Rubella II Vaccination.

Rubella vaccination induces widely variable immune responses in vaccine recipients. While rubella vaccination is effective at inducing immunity to rubella infection in most subjects, up to 5% of individuals do not achieve or maintain long-term protective immunity. To expand upon our previous work identifying genetic polymorphisms that are associated with these interindividual differences in humoral immunity to rubella virus, we performed a genome-wide association study in a large cohort of 1843 subjects to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific cellular immune responses. We identified SNPs in the Wilms tumor protein gene (WT1) that were significantly associated (P < 5 × 10-8) with interindividual variations in rubella-specific interleukin 6 secretion from subjects' peripheral blood mononuclear cells postvaccination. No SNPs were found to be significantly associated with variations in rubella-specific interferon-γ secretion. Our findings demonstrate that genetic polymorphisms in the WT1 gene in subjects of European ancestry are associated with interindividual differences in rubella virus-specific cellular immunity after measles-mumps-rubella II vaccination.

Prevalence and Morbidity of Undiagnosed Celiac Disease From a Community-Based Study.

BACKGROUND & AIMS: Little is known about the prevalence and burden of undiagnosed celiac disease in individuals younger than age 50. We determined the prevalence and morbidity of undiagnosed celiac disease in individuals younger than age 50 in a community. METHODS: We tested sera from 31,255 residents of Olmsted County, Minnesota (<50 y), without a prior diagnosis of celiac disease assay using an assay for IgA against tissue transglutaminase; in subjects with positive test results, celiac disease was confirmed using an assay for endomysial IgA. We performed a nested case-control study to compare the proportion of comorbidities between undiagnosed cases of celiac disease and age- and sex-matched seronegative controls (1:2). Medical records were abstracted to identify potential comorbidities. RESULTS: We identified 338 of 30,425 adults with positive results from both serologic tests. Based on this finding, we estimated the prevalence of celiac disease to be 1.1% (95% confidence interval, 1.0%-1.2%); 8 of 830 children tested positive for IgA against tissue transglutaminase (1.0%; 95% confidence interval, 0.4%-1.9%). No typical symptoms or classic consequences of diagnosed celiac disease (diarrhea, anemia, or fracture) were associated with undiagnosed celiac disease. Undiagnosed celiac disease was associated with increased rates of hypothyroidism (odds ratio, 2.2; P < .01) and a lower than average cholesterol level (P = .03) and ferritin level (P = .01). During a median follow-up period of 6.3 years, the cumulative incidence of a subsequent diagnosis with celiac disease at 5 years after testing was 10.8% in persons with undiagnosed celiac disease vs 0.1% in seronegative persons (P < .01). Celiac disease status was not associated with overall survival. CONCLUSIONS: Based on serologic tests of a community population for celiac disease, we estimated the prevalence of undiagnosed celiac disease to be 1.1%. Undiagnosed celiac disease appeared to be clinically silent and remained undetected, but long-term outcomes have not been determined.

Genome-wide associations of CD46 and IFI44L genetic variants with neutralizing antibody response to measles vaccine.

Population-based studies have revealed 2-10% measles vaccine failure rate even after two vaccine doses. While the mechanisms behind this remain unknown, we hypothesized that host genetic factors are likely to be involved. We performed a genome-wide association study of measles specific neutralizing antibody and IFNγ ELISPOT response in a combined sample of 2872 subjects. We identified two distinct chromosome 1 regions (previously associated with MMR-related febrile seizures), associated with vaccine-induced measles neutralizing antibody titers. The 1q32 region contained 20 significant SNPs in/around the measles virus receptor-encoding CD46 gene, including the intronic rs2724384 (p value = 2.64 × 10-09) and rs2724374 (p value = 3.16 × 10-09) SNPs. The 1q31.1 region contained nine significant SNPs in/around IFI44L, including the intronic rs1333973 (p value = 1.41 × 10-10) and the missense rs273259 (His73Arg, p value = 2.87 × 10-10) SNPs. Analysis of differential exon usage with mRNA-Seq data and RT-PCR suggests the involvement of rs2724374 minor G allele in the CD46 STP region exon B skipping, resulting in shorter CD46 isoforms. Our study reveals common CD46 and IFI44L SNPs associated with measles-specific humoral immunity, and highlights the importance of alternative splicing/virus cellular receptor isoform usage as a mechanism explaining inter-individual variation in immune response after live measles vaccine.

Vaccinomics, adversomics, and the immune response network theory: individualized vaccinology in the 21st century.

Vaccines, like drugs and medical procedures, are increasingly amenable to individualization or personalization, often based on novel data resulting from high throughput "omics" technologies. As a result of these technologies, 21st century vaccinology will increasingly see the abandonment of a "one size fits all" approach to vaccine dosing and delivery, as well as the abandonment of the empiric "isolate-inactivate-inject" paradigm for vaccine development. In this review, we discuss the immune response network theory and its application to the new field of vaccinomics and adversomics, and illustrate how vaccinomics can lead to new vaccine candidates, new understandings of how vaccines stimulate immune responses, new biomarkers for vaccine response, and facilitate the understanding of what genetic and other factors might be responsible for rare side effects due to vaccines. Perhaps most exciting will be the ability, at a systems biology level, to integrate increasingly complex high throughput data into descriptive and predictive equations for immune responses to vaccines. Herein, we discuss the above with a view toward the future of vaccinology.

Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work.

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

HLA alleles associated with the adaptive immune response to smallpox vaccine: a replication study.

We previously reported HLA allelic associations with vaccinia virus (VACV)-induced adaptive immune responses in a cohort of healthy individuals (n = 1,071 subjects) after a single dose of the licensed smallpox (Dryvax) vaccine. This study demonstrated that specific HLA alleles were significantly associated with VACV-induced neutralizing antibody (NA) titers (HLA-B*13:02, *38:02, *44:03, *48:01, and HLA-DQB1*03:02, *06:04) and cytokine (HLA-DRB1*01:03, *03:01, *10:01, *13:01, *15:01) immune responses. We undertook an independent study of 1,053 healthy individuals and examined associations between HLA alleles and measures of adaptive immunity after a single dose of Dryvax-derived ACAM2000 vaccine to evaluate previously discovered HLA allelic associations from the Dryvax study and determine if these associations are replicated with ACAM2000. Females had significantly higher NA titers than male subjects in both study cohorts [median ID50 discovery cohort 159 (93, 256) vs. 125 (75, 186), p < 0.001; replication cohort 144 (82, 204) vs. 110 (61, 189), p = 0.024]. The association between the DQB1*03:02 allele (median ID50 discovery cohort 152, p = 0.015; replication cohort 134, p = 0.010) and higher NA titers was replicated. Two HLA associations of comparable magnitudes were consistently found between DRB1*04:03 and DRB1*08:01 alleles and IFN-γ ELISPOT responses. The association between the DRB1*15:01 allele with IFN-γ secretion was also replicated (median pg/mL discovery cohort 182, p = 0.052; replication cohort 203, p = 0.014). Our results suggest that smallpox vaccine-induced adaptive immune responses are significantly influenced by HLA gene polymorphisms. These data provide information for functional studies and design of novel candidate smallpox vaccines.

Genetic polymorphisms associated with rubella virus-specific cellular immunity following MMR vaccination.

Rubella virus causes a relatively benign disease in most cases, although infection during pregnancy can result in serious birth defects. An effective vaccine has been available since the early 1970s and outbreaks typically do not occur among highly vaccinated (≥2 doses) populations. Nevertheless, considerable inter-individual variation in immune response to rubella immunization does exist, with single-dose seroconversion rates ~95 %. Understanding the mechanisms behind this variability may provide important insights into rubella immunity. In the current study, we examined associations between single nucleotide polymorphisms (SNPs) in selected cytokine, cytokine receptor, and innate/antiviral genes and immune responses following rubella vaccination in order to understand genetic influences on vaccine response. Our approach consisted of a discovery cohort of 887 subjects aged 11-22 at the time of enrollment and a replication cohort of 542 older adolescents and young adults (age 18-40). Our data indicate that SNPs near the butyrophilin genes (BTN3A3/BTN2A1) and cytokine receptors (IL10RB/IFNAR1) are associated with variations in IFNγ secretion and that multiple SNPs in the PVR gene, as well as SNPs located in the ADAR gene, exhibit significant associations with rubella virus-specific IL-6 secretion. This information may be useful, not only in furthering our understanding immune responses to rubella vaccine, but also in identifying key pathways for targeted adjuvant use to boost immunity in those with weak or absent immunity following vaccination.

Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines.

Single-nucleotide polymorphisms (SNPs) in candidate immune response genes were evaluated for associations with measles- and rubella-specific neutralizing antibodies, interferon (IFN)-γ, and interleukin (IL)-6 secretion in two separate association analyses in a cohort of healthy immunized subjects. We identified six SNP associations shared between the measles-specific and rubella-specific immune responses, specifically neutralizing antibody titers (DDX58), secreted IL-6 (IL10RB, IL12B), and secreted IFN-γ (IFNAR2, TLR4). An intronic SNP (rs669260) in the antiviral innate immune receptor gene, DDX58, was significantly associated with increased neutralizing antibody titers for both measles and rubella viral antigens post-MMR vaccination (p values 0.02 and 0.0002, respectively). Significant associations were also found between IL10RB (rs2284552; measles study p value 0.006, rubella study p value 0.00008) and IL12B (rs2546893; measles study p value 0.005, rubella study p value 0.03) gene polymorphisms and variations in both measles- and rubella virus-specific IL-6 responses. We also identified associations between individual SNPs in the IFNAR2 and TLR4 genes that were associated with IFN-γ secretion for both measles and rubella vaccine-specific immune responses. These results are the first to indicate that there are SNP associations in common across measles and rubella vaccine immune responses and that SNPs from multiple genes involved in innate and adaptive immune response regulation may contribute to the overall human antiviral response.

Genome-wide SNP associations with rubella-specific cytokine responses in measles-mumps-rubella vaccine recipients.

Genetic polymorphisms are known to affect responses to both viral infection and vaccination. Our previous work has described genetic polymorphisms significantly associated with variations in immune response to rubella vaccine from multiple gene families with known immune function, including HLA, cytokine and cytokine receptor genes, and in genes controlling innate and adaptive immunity. In this study, we assessed cellular immune responses (IFNγ and IL-6) in a cohort of healthy younger individuals and performed genome-wide SNP analysis on these same individuals. Here, we report the first genome-wide association study focused on immune responses following rubella vaccination. Our results indicate that rs16928280 in protein tyrosine phosphatase delta (PTPRD) and a collection of SNPs in ACO1 (encoding an iron regulatory protein) are associated with interindividual variations in IFNγ response to rubella virus stimulation. In contrast, we did not identify any significant genetic associations with rubella-specific IL-6 response. These genetic regions may influence rubella vaccine-induced IFNγ responses and warrant further studies in additional cohorts in order to confirm these findings.

Genetic variation in IL18R1 and IL18 genes and Inteferon γ ELISPOT response to smallpox vaccination: an unexpected relationship.

BACKGROUND: Genetic association studies demonstrated a role for cytokine proteins and cytokine or cytokine receptor gene polymorphisms in smallpox vaccine-induced adaptive immunity. METHODS: We examined the association of genetic polymorphisms with cellular (interferon [IFN] γ enzyme-linked immunospot assay [ELISPOT]) immune response to smallpox vaccine in 1076 immunized individuals. RESULTS: The majority of significant associations were discovered between single-nucleotide polymorphisms/haplotypes in IL18R1 and IL18 genes, in which we previously reported an association with vaccinia virus-induced neutralizing antibody titers in this study cohort. A functional coding IL18R1 polymorphism (rs1035130/Phe251Phe; P = .01) was significantly associated with an allele dose-related increase in IFN-γ production and was also associated with vaccinia-specific neutralizing antibody titers. Significant associations were also found between IL18R1 haplotypes and variations in IFN-γ ELISPOT responses (global P < .0001). CONCLUSIONS: Our data suggest the importance of variants in the IL18R1 and IL18 genetic loci for broad-based smallpox vaccine-induced adaptive immunity.

Immunogenicity of a peptide-based vaccine for measles: a pilot evaluation in a mouse model.

Although neutralizing antibody is an established correlate of protection for measles, T cell-mediated responses play at least two critical roles in immunity to measles: first, through provision of 'help' enabling robust humoral immune responses; and second, through clearance of measles virus-infected cells. Previously, we identified 13 measles-derived peptides that bound to human leukocyte antigen (HLA) molecules in Priess cells infected with measles virus. In this study, we evaluated the immunogenicity of these peptides in a transgenic mouse model. Our results demonstrated that these peptides induced Th1-biased immune responses at varying levels. Of the 13 peptides, the top four immunogenic peptides were further selected for a viral challenge study in mice. A vaccine based on a combination of these four peptides reduced morbidity and weight loss after viral challenge compared to placebo. Our results emphasize the potential of T cell-mediated, peptide-based vaccines against measles.