Inhibitors of cholesterol biosynthesis. 2. 3,5-Dihydroxy-7-(N-pyrrolyl)-6-heptenoates, a novel series of HMG-CoA reductase inhibitors.

A series of 7-[2,3-diaryl-5-(1-methylethyl)-1H-pyrrol-1-yl]-3,5- dihydroxy-6-heptenoates was prepared and evaluated for its ability to inhibit the enzyme HMG-CoA reductase in vitro. Maintaining a 5-(1-methylethyl) substituent found to be optimal in related studies, structure-activity relationships were established for compounds modified at positions 2, 3, and 4 of the pyrrole ring. The 4-fluorophenyl group was preferred at the pyrrole 2-position, while incorporation of a range of substituted phenyl groups and pyridyl substituents at the 3-position provided compounds with equivalent enzyme inhibitory activities and widely different lipophilicities. Pentasubstituted pyrrole 3h was found to have a 10-fold greater potency than lovastatin.

Conformationally constrained tachykinin analogues: potent and highly selective neurokinin NK-2 receptor agonists.

The design and synthesis of potent and selective neurokinin NK-2 receptor agonists 12 (GR64349) and 31 are described, together with structure-activity relationships for related analogues. Compound 12 (EC50 = 3.7 nM at NK-2 receptors in the rat colon; selectivity > 1000- and > 300-fold with respect to NK-1 and NK-3 receptors, respectively) was derived by incorporation of a Gly-Leu gamma-lactam conformational constraint into the C-terminal region of the neurokinin A octapeptide analogue [Lys3]-NKA(3-10). Compound 31 (EC50 = 15 nM in rat colon) contains a novel fused-bicyclic constraint at the corresponding site in the substance P hexapeptide analogue [Ava6]-SP(6-11).

Bromobenzofuran-based non-peptide antagonists of angiotensin II: GR138950, a potent antihypertensive agent with high oral bioavailability.

We have identified GR138950, a potent antagonist of the angiotensin II receptor with high oral bioavailability, as our second drug candidate to GR117289. Using GR117289, a compound with moderate bioavailability (20%) in man as a lead, we pursued a strategy aimed at enhancing bioavailability. The strategy was based on SAR established around the diacid GR117289, and from this, it was proposed that a monoacid, in particular a trifluoromethanesulfonamide, should be better absorbed after oral administration and have enhanced oral bioavailability. This led to the identification of GR138950, a potent antihypertensive agent in the renal hypertensive rat, causing sustained falls in blood pressure after oral administration. Oral bioavailability of GR138950 in rats and dogs is high, confirming that GR138950 is well absorbed after oral administration. Moreover, the low plasma clearance and long plasma half-life suggest that this compound will be suitable for once a day administration. Furthermore, the preliminary data indicate that the high bioavailability of GR138950 seen in rats and dogs translates to man. These results demonstrate clearly that GR138950 has the potential to be a clinically effective antihypertensive agent. Further studies are in progress to evaluate GR138950 in the treatment of hypertension.

Highly potent and selective heptapeptide antagonists of the neurokinin NK-2 receptor.

Incorporation of D-Pro9 into substance P related peptides is known to enhance neurokinin NK-2 receptor agonist potency and selectivity with respect to other neurokinin receptors. We now report that replacement of D-Trp9 by D-Pro9 in the nonselective neurokinin antagonist [Arg5,D-Trp7,9, Nle11]-SP(5-11) gave a partial agonist with NK-2 receptor selectivity. Further incorporation of Pro10 provided the weak but selective NK-2 antagonist Arg-Ala-D-Trp-Phe-D-Pro-Pro-Nle-NH2 (compound 4; NK-2 pKB = 5.9; NK-1 pKB = 4.7; NK-3 pKB less than 4.6). Addition of a suitable lipophilic N-terminal substituent (e.g. Boc, PhCO, cyclohexylcarbonyl) to this compound greatly enhanced NK-2 antagonist activity (compound 10, GR 83074; NK-2 pKB = 8.2), and combined with further optimization of the N-terminal amino acids, provided the extremely potent and selective NK-2 antagonist PhCO-Ala-Ala-D-Trp-Phe-D-Pro-Pro-Nle-NH2 (compound 34, GR 94800; NK-2 pKB = 9.6; NK-1 pKB = 6.4; NK-3 pKB = 6.0). Compounds of this class produced a potent inhibition of NK-2 agonist-induced bronchoconstriction in the anaesthetized guinea-pig.

The squalestatins: decarboxy and 4-deoxy analogues as potent squalene synthase inhibitors.

Squalestatins without either the hydroxy group at C-4 or the carboxylic acid at C-3 or C-4 were prepared and evaluated for their ability to inhibit rat liver microsomal squalene synthase (SQS) in vitro. These modifications were well tolerated for compounds with the 4,6-dimethyloctenoate ester at C-6 (S1 series). However in analogues without the C-6 ester (H1 series), removal of the C-4 hydroxy group gave compounds with reduced potency, whereas decarboxylation at C-3 resulted in a dramatic loss of SQS inhibitory activity. In comparison with S1 1, C-4 deoxyS1 3 and C-3 decarboxyS1 10 have shorter in vivo durations of action on the inhibition of hepatic cholesterol biosynthesis in rats. C-4 deoxyS1 3 retains good serum cholesterol-lowering ability in marmosets, while C-3 decarboxyS1 10 showed only a marginal effect even at high dose.

Cardiovascular effects of GR117289, a novel angiotensin AT1 receptor antagonist.

1. The effect of GR117289, an angiotensin AT1 receptor antagonist, on diastolic blood pressure (DBP) was determined in angiotensin-dependent and angiotensin-independent models of hypertension in rats. In addition, the antagonist profile of GR117289 at angiotensin AT1 receptors was determined in conscious renal hypertensive rats and conscious normotensive rats, dogs and marmosets. 2. Intra-arterial and oral administration of GR117289 (0.3-3 mg kg-1, i.a.; 1-10 mg kg-1, p.o.) to 6-day left renal artery ligated hypertensive (RALH) rats (DBP > 140 mmHg) produced significant, dose-related reductions in DBP with little apparent effect on heart rate (< 15%). The antihypertensive effect of GR117289 developed progressively over several hours and with some doses persisted for 24-48 h after administration. 3. Administration of GR117289 (1 mg kg-1, i.a.) on 5 consecutive days to RALH rats reduced DBP on each day. The antihypertensive effect of GR117289 was not cumulative as DBP had almost returned to base-line values, 24 h after administration of each dose. 4. A dose of GR117289 (3 mg kg-1, i.a.), which produced a substantial reduction in DBP (about 70 mmHg) in RALH rats, was administered to rats in which blood pressure was elevated either by unilateral renal artery clipping, sustained infusion of angiotensin II (AII), DOCA-salt administration or genetic inbreeding. GR117289 reduced DBP in rats in which the renin-angiotensin system was activated by renal artery clipping or AII infusion but had little effect in normotensive rats, DOCA-salt rats and SHR. 5. Systemic administration of All to RALH rats and to normotensive rats, dogs and marmosets elicited reproducible pressor responses in all species. Systemic or oral administration of GR1 17289 (3 mg kg-1)inhibited the pressor responses produced by All, resulting in parallel, rightward displacements of All dose-response curves.6. Maximal displacements of All dose-response curves occurred 1 h and 1-7 h after systemic and oral administration, respectively. GR1 17289 produced a 32-246 fold displacement after systemic administration and a 4-12 fold displacement after oral administration. The effect in dogs was short lasting after systemic administration but the effect of GRI17289 lasted for up to 24 h in rats and marmosets and for up to 24 h after oral administration in all species. The antagonist activity appeared specific for angiotensin receptors as GRi17289 did not inhibit pressor responses to phenylephrine or vasopressin.7. These experiments demonstrate that GRI 17289 reduces blood pressure in conscious hypertensive rats after both systemic and oral administration, and is an effective antagonist at angiotensin AT1 receptors in conscious rats, dogs and marmosets.

Pharmacological profile of GR117289 in vitro: a novel, potent and specific non-peptide angiotensin AT1 receptor antagonist.

1. This paper describes the effects of GR117289 (1-[[3-bromo-2-[2-(1H-tetrazol-5-yl)phenyl]-5-benzo-furanyl]methyl ]-2-butyl-4-chloro-1H-imidazole-5-carboxylic acid) at angiotensin receptors and binding sites in rabbit aorta, rat liver and bovine cerebellum preparations in vitro. 2. In rabbit isolated aortic strips, GR117289 (0.3, 1 and 3 nM) caused a concentration-related, insurmountable suppression of the concentration-response curve to angiotensin II (AII). When the contact time was increased, a greater degree of antagonism of AII was observed, suggesting that GR117289 is slow to reach equilibrium. A pKB of 9.8 +/- 0.1 was calculated for GR117289 after 3 h incubation. GR117289 (1 microM) did not affect contractile responses to phenylephrine or 5-hydroxytryptamine (5-HT) in the rabbit aorta. 3. GR117289 (1 nM) alone caused a marked suppression and a slight rightward displacement of the AII concentration-response curve. Co-incubation with the competitive, surmountable AT1 receptor antagonist, losartan (10 nM, 100 nM and 1 microM), resulted in a concentration-related upward and rightward displacement of the concentration-response curve to subsequently administered AII. In separate experiments in which preparations were pre-incubated with GR117289 (1 nM), subsequent addition of losartan (1 microM) for 2, 15 or 45 min caused a further, but similar, rightward displacement of the concentration-response curve to subsequently administered AII with a time-dependent increase in the maximum response.4. Suppression of All-induced contractile responses, caused by superfusion with GRI17289 (0.3, 1 or 3 nM) was not reversed by continuously washing the tissues for 3 h; in fact, the potency of GRI 17289 was slightly enhanced after this period.5. In rat liver membranes, GRI17289 was a potent competitor with [3H]-AII for AT, binding sites(pKi = 8.7 +/- 0.1) but in bovine cerebellum membranes, it was a very weak competitor for AT2 binding sites (pKi<6). Pre-incubation of rat liver membranes with GRI17289 had little effect on its affinity(pKi = 9.1 +/- 0.21), but increasing the concentration of bovine serum albumen in the assay buffer from 0.001% to 0.1% w/v decreased affinity (pKi= 7.5 +/- 0.1).6. In saturation binding experiments in rat liver membranes, GRI 17289 (12 nM) increased the Kd of[3H]-AII from 0.28 +/- 0.06 nM to 0.37 +/- 0.02 nM, and decreased Bm. from 10.0 +/- 0.1 to 5.6 +/-0.3 fmol mg' tissue. In other experiments, GR1 17289 (1 jIM) did not alter the rate of dissociation of[3H]-AII from AT1 binding sites, following addition of excess unlabelled All.7. In rabbit aorta vascular smooth muscle membranes, GR1 17289 competed with ['25I]-Sar'1le8 All for binding to AT, binding sites. In the presence of 0.1% w/v bovine serum albumen, a pIC50 of 7.6 +/- 0.1 was calculated. Under the same conditions, but with rat liver membranes, a pIC50 of 7.8 +/- 0.1 was determined.8. Taken together, these results show that GRI17289 is a potent, specific, selective and insurmountable antagonist at angiotensin AT, receptors. Its profile in the rabbit aorta is consistent with the proposalthat GRI17289 is a slowly reversible (pseudo-irreversible) antagonist at these receptors.

Disseminated, multiclonal Epstein-Barr virus-associated lymphoproliferative disease in a patient with hematological and immunological anomalies. Molecular analysis correlates with morphological appearance.

We report a case of a 21-year-old woman with hematopoietic, immunological, and congenital dysmorphic abnormalities, who died following rapidly progressive, disseminated Epstein-Barr virus (EBV)-associated lymphoproliferative disease (LPD). Polymerase chain reaction (PCR) amplification of formalin-fixed paraffin-embedded tissue showed differences in the clonality of each separate lymphoproliferative lesion examined, as determined by immunoglobulin heavy chain (IgH) gene rearrangement. PCR analysis also demonstrated that all lesions contained EBV genome. Since DNA had been extracted from paraffin blocks, a direct comparison of morphology and clonality could be made in each individual lesion. The evidence from this study indicates that the monoclonal tumors arose de novo in multiple sites and that the polyclonal background observed in some lesions reflected a substantial concomitant inflammatory response.

Characterization of hepatitis A virus capsid proteins with antisera raised to recombinant antigens.

The capsid proteins of hepatitis A virus (HAV) were expressed as fusion proteins of beta-galactosidase in E. coli using the expression vector lambda gt11. Four fusion proteins were stably expressed and used to immunize rabbits to obtain mono-specific antisera. The antisera were unable to neutralize viral infectivity or react with HAV by radioimmunoassay. Three of the antisera were able to recognize HAV antigens in infected BS-C-1 cells by immunofluorescence and denatured capsid proteins by immunoblot analysis. The antisera were used to investigate the migration of the capsid proteins in gels by immunoblot analysis using standard SDS-PAGE conditions and in gels containing urea. The migration of VP1 and VP3 correlated with their molecular weights predicted from the nucleotide sequence and was consistent in either the presence or absence of urea. However, VP2 migrated with an apparent molecular weight significantly higher than the predicted value and, in gels containing urea, migrated as a doublet. It is proposed that the upper band of this doublet represents VP0, the proteolytic precursor of VP2 and VP4. The relative molecular mass (Mr) of VP4 was estimated to be less than 1 kDa, which is substantially lower than the 2.5 kDa predicted from the nucleotide sequence.

In vitro histamine H2-antagonist activity of the novel compound HUK 978.

Histamine stimulated adenylate cyclase from guinea-pig fundic mucosa and 3H-tiotidine binding in guinea-pig cerebral cortex were used to assess the in-vitro histamine H2-activity of the novel H2-antagonist HUK 978. The results showed that HUK 978 was a more potent H2-antagonist than either cimetidine or ranitidine. HUK 978 was also shown to be devoid of activity at the histamine H1-receptor, the muscarinic receptor and the alpha and beta-adrenergic receptors.

Anti-secretory activity of the novel H2-antagonist, HUK 978, in rat, guinea-pig and dog.

The anti-secretory activity of the competitive H2-antagonist HUK 978 was determined in rat, guinea-pig and dog. In all systems examined, HUK 978 was more potent than cimetidine and ranitidine both intravenously and orally. In addition, the compound at approximately equipotent doses as these established H2-antagonists exhibited a significantly longer inhibitory profile following oral and systemic administration. Data from these pharmacological studies and the in vitro investigations previously reported, suggest that HUK 978 is a highly specific H2-antagonist and inhibits acid secretion for longer periods than other competitive compounds.

Comparison of Pneumocystis carinii detection by toluidine blue O staining, direct immunofluorescence and DNA amplification in sputum specimens from HIV positive patients.

Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be amplified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base-pair sequence being amplified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii; the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a non-resolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.

The diagnostic use of the polymerase chain reaction for the detection of Mycobacterium tuberculosis.

Detection of Mycobacterium tuberculosis by microscopy is difficult in specimens containing fewer than 10(4) bacteria/mL and growth in culture can take up to 6 wks. In this study the Polymerase Chain Reaction (PCR) was investigated as a rapid diagnostic technique for the detection of M. tuberculosis. The presence of DNA polymerase inhibitors in sputum specimens poses a potentially serious problem as false negative results can occur. In this study polymerase inhibitors were detected by inclusion of an internal plasmid control in each test. DNA from specimens in which the internal control failed to amplify was purified with a DNA binding matrix before retesting by PCR. A total of 169 sputum specimens were examined and 4 were found to have inhibitors. The correlation between detection of M. tuberculosis by PCR with a combination of culture, Ziehl-Neelsen (ZN) staining and patient history was 97.6%. This study confirms that PCR offers a more sensitive and rapid alternative for the detection of M. tuberculosis to ZN staining and culture, with results being available within 24 hrs of a specimen being received in the laboratory.

Use of a repetitive element isolated from Mycobacterium tuberculosis in hybridization studies with Mycobacterium bovis: a new tool for epidemiological studies of bovine tuberculosis.

Typing of M. bovis isolates for epidemiological purposes is possible using restriction endonuclease analysis (REA). However, the DNA fragment patterns obtained are complex and difficult to analyse due to the large number of bands produced. In an attempt to develop a less complicated typing scheme two DNA probes were used in hybridization studies to detect restriction fragment length polymorphisms (RFLP) in M. bovis. An oligonucleotide probe which matches part of the insertion sequence IS6110 produced few bands and failed to discriminate between bovine isolates of M. bovis. A probe prepared from a highly repeated DNA sequence, cloned from M. tuberculosis when used on southern blots of AluI digested M. bovis DNA, resulted in a discriminating typing scheme which was easier to perform and analyse than the REA. The RFLP typing scheme identified 27 different strains from a total of 36 isolates of M. bovis and 7 reference strains from the M. tuberculosis complex. Using REA, 24 types were identified using BclI and PvuII digests and 23 different types using BstEII digests. When results of all 3 enzyme digests were combined, the REA identified 27 types from the same strains. Ten isolates of M. bovis from 5 properties involved in an outbreak of bovine tuberculosis were all identified as the same type with both techniques.

Synthesis and antibacterial activities of 1-N [(S)-omega-amino-2-hydroxyalkyl] kanamycin A derivatives.

Four 1-N-aminohydroxy-alkyl derivatives of kanamycin A were prepared and their in vitro activities against aminoglycoside-sensitive and aminoglycoside-resistant organisms were compared with amikacin. 1-N-[(S)-4-Amino-2-hydroxybutyl] kanamycin A (Fig. 1, compound 2, code no. UK-18,892) was equipotent to amikacin in all these tests and in mouse protection studies.

Candida albicans: a review of its history, taxonomy, epidemiology, virulence attributes, and methods of strain differentiation.

The dimorphic yeast Candida albicans has been recognized as an increasingly important human pathogen particularly in immunocompromised hosts because of advanced age, infection or immunosuppressive therapy. This review outlines the history, taxonomy and epidemiology of this medically important yeast as well as discussing some of characteristics which are purported to be related to its virulence. Methods utilized for strain differentiation in the study of the epidemiologic relationship of members of this species are discussed.

Noise exposure of motorcyclists.

This study was designed to evaluate noise exposure of motorcyclists at work. Open and full face safety helmets were compared and the effects of helmet design and the contribution of radio intercoms investigated. Special measuring equipment is described and hearing protection discussed. Previous studies concentrated mainly on the attenuation of noise by safety helmets, and were made under conditions untypical of day-to-day motorcycling. During town driving the sample equivalent continuous noise level (s.leq) ranged from 63 to 90 dB(A), the intercom giving the highest peak levels. On the open road s.leq was up to 105 dB(A); exposure to this level for only 15 min would exceed the present recommended maximum of 90 dB(A) for an 8 h working day.