CD10/neutral endopeptidase 24.11 in developing human fetal lung. Patterns of expression and modulation of peptide-mediated proliferation.

The cell membrane-associated enzyme CD10/neutral endopeptidase 24.11 (CD10/NEP) functions in multiple organ systems to downregulate responses to peptide hormones. Recently, CD10/NEP was found to hydrolyze bombesin-like peptides (BLP), which are mitogens for normal bronchial epithelial cells and small cell lung carcinomas. Growth of BLP-responsive small cell lung carcinomas was potentiated by CD10/NEP inhibition, implicating CD10/NEP in regulation of BLP-mediated tumor growth. BLP are also likely to participate in normal lung development because high BLP levels are found in fetal lung, and bombesin induces proliferation and maturation of human fetal lung in organ cultures and murine fetal lung in utero. To explore potential roles for CD10/NEP in regulating peptide-mediated human fetal lung development, we have characterized temporal and cellular patterns of CD10/NEP expression and effects of CD10/NEP inhibition in organ cultures. Peak CD10/NEP transcript levels are identified at 11-13 wk gestation by Northern blots and localized to epithelial cells and mesenchyme of developing airways by in situ hybridization. CD10/NEP immunostaining is most intense in undifferentiated airway epithelium. In human fetal lung organ cultures, inhibition of CD10/NEP with either phosphoramidon or SCH32615 increases thymidine incorporation by 166-182% (P < 0.025). The specific BLP receptor antagonist, [Leu13-psi(CH2NH)Leu14]bombesin abolishes these effects on fetal lung growth, suggesting that CD10/NEP modulates BLP-mediated proliferation. CD10/NEP expression in the growing front of airway epithelium and the effects of CD10/NEP inhibitors in lung explants implicate the enzyme in the regulation of peptide-mediated fetal lung growth.

CD10/NEP in non-small cell lung carcinomas. Relationship to cellular proliferation.

The cell surface metalloproteinase CD10/neutral endopeptidase 24.11 (NEP) hydrolyzes a variety of peptide substrates and reduces cellular responses to specific peptide hormones. Because CD10/NEP modulates peptide-mediated proliferation of small cell carcinomas of the lung (SCLC) and normal fetal bronchial epithelium, we evaluated the enzyme's expression in non-small cell lung carcinomas (NSCLC). Bronchoalveolar and large cell carcinoma cell lines had low levels of CD10/NEP expression whereas squamous, adenosquamous, and adenocarcinoma cell lines had higher and more variable levels of the cell surface enzyme. Regional variations in CD10/NEP immunostaining in primary NSCLC specimens prompted us to correlate CD10/NEP expression with cell growth. In primary carcinomas of the lung, clonal NSCLC cell lines and SV40-transformed fetal airway epithelium, subsets of cells expressed primarily CD10/NEP or the proliferating cell nuclear antigen (PCNA). Cultured airway epithelial cells had the lowest levels of CD10/NEP expression when the highest percentage of cells were actively dividing; in addition, these cells grew more rapidly when cell surface CD10/NEP was inhibited. NSCLC cell lines had receptors for a variety of mitogenic peptides known to be CD10/NEP substrates, underscoring the functional significance of growth-related variability in CD10/NEP expression.

CD10/neutral endopeptidase 24.11 regulates fetal lung growth and maturation in utero by potentiating endogenous bombesin-like peptides.

Bombesin-like peptides (BLPs) are mitogens for bronchial epithelial cells and small cell lung carcinomas, and increase fetal lung growth and maturation in utero and in organ cultures. BLPs are hydrolyzed by the enzyme CD10/neutral endopeptidase 24.11 (CD10/NEP) which is expressed in bronchial epithelium and functions to inhibit BLP-mediated growth of small cell lung carcinomas. To determine whether CD10/NEP regulates peptide-mediated lung development, we administered a specific CD10/NEP inhibitor, SCH32615, to fetal mice in utero from gestational days e15-17. Fetal lung tissues were evaluated on e18 for: (a) growth using [3H]thymidine incorporation into nuclear DNA; and (b) maturation using: [3H]-choline incorporation into surfactant phospholipids, electron microscopy for type II pneumocytes, and Northern blot analyses for surfactant apoproteins A, B, and C. Inhibition of CD10/NEP stimulated [3H]thymidine incorporation into DNA (70% above baseline, P < 0.005), [3H]choline incorporation into surfactant phospholipids (38% above baseline, P < 0.005), increased numbers of type II pneumocytes (36% above baseline, P = 0.07), and fivefold higher surfactant protein A transcripts (P < 0.05). CD10/NEP-mediated effects were completely blocked by the specific bombesin receptor antagonist, [D-Phe12, Leu14]bombesin. These observations suggest that CD10/NEP regulates fetal lung growth and maturation mediated by endogenous BLPs.

Combination therapy including a gelatinase inhibitor and cytotoxic agent reduces local invasion and metastasis of murine Lewis lung carcinoma.

The efficacy of combination therapy including an oral gelatinase inhibitor (CT1746) and cytotoxic agent was analyzed using the murine Lewis lung carcinoma model. Primary tumors, pulmonary metastases, and sera from tumor-bearing animals had increased gelatinase B activity that was inhibited by CT1746 levels achievable in vivo. The combination of CT1746 and cyclophosphamide (CTX) was significantly more effective than either single agent in delaying local tumor growth (CT1746/CTX, 30.9 +/- 1.7 days; CT1746, 2.6 +/- 0.3 days; CTX, 19.5 +/- 1.1 days; P < .001) and reducing the number and size of pulmonary metastases [CT1746/CTX, 5 +/- 2 (15% metastases > 3 mm); CT1746, 15 +/- 4 (55% > 3 mm); CTX, 11 +/- 3 (63% > 3 mm); no treatment, 24 +/- 5 (62% > 3 mm); P < .001]. These data support the notion of combining matrix metalloproteinase inhibitors and cytotoxic agents to treat certain epithelial malignancies.

The angiogenic factor interleukin 8 is induced in non-small cell lung cancer/pulmonary fibroblast cocultures.

The interactions between tumor cells and surrounding stromal elements may promote the release of angiogenic factors. Although interleukin 8 (IL-8) is a major angiogenic factor in non-small cell lung cancer (NSCLC), the stromal contribution to IL-8 expression in primary NSCLC remains to be defined. To elucidate the role of stromal elements in NSCLC IL-8 production, normal pulmonary fibroblasts were cocultured with six representative NSCLC lines in direct and transwell assays. IL-8 transcripts and protein were consistently induced in fibroblasts and a subset of NSCLCs as a consequence of tumor/stromal coculture. In these cocultures, IL-8 was induced by IL-1alpha and an additional, as yet unidentified, soluble factor. These data underscore the importance of tumor/stromal interaction in the production of angiogenic peptides such as IL-8 in NSCLC.

Stromelysin-3 is overexpressed by stromal elements in primary non-small cell lung cancers and regulated by retinoic acid in pulmonary fibroblasts.

Stromelysin-3 (STR-3) is a recently characterized matrix metalloproteinase (MMP) that was cloned on the basis of differential expression in benign and malignant breast tumors. This MMP has a unique processing mechanism and substrate specificity. Unlike previously characterized MMPs that are secreted as inactive zymogens, STR-3 is processed within the constitutive secretory pathway and secreted as an active enzyme. Although STR-3 has a characteristic MMP structure, the enzyme does not hydrolyze many of the extracellular matrix components that are substrates for other MMPs. However, STR-3 cleaves certain serine protease inhibitors (serpins), including the alpha 1 proteinase inhibitor (alpha 1 anti-trypsin). Because alpha 1 proteinase inhibitor deficiency has a known pathogenetic role in pulmonary disease, the role of STR-3 in non-small cell lung carcinomas (NSCLC) is of great interest. STR-3 transcripts and protein were significantly more abundant in primary NSCLC than in adjacent normal lung specimens in an extensive panel of stage I-III squamous cell and adenocarcinomas. The major form of STR-3 detectable in the primary NSCLC was the mature fully processed active enzyme. STR-3 transcripts and protein were primarily localized to NSCLC stromal elements, prompting analysis of STR-3 induction in normal pulmonary fibroblasts. Although STR-3 could be induced in normal pulmonary fibroblasts with growth factors (basic fibroblast growth factor and platelet-derived growth factor) and/or 12-O-tetradecanoylphorbol-13-acetate, STR-3 induction was inhibited by all-trans retinoic acid, a commonly used chemopreventive agent for aerodigestive tract malignancies. Taken together, these data suggest that STR-3 may be a novel marker and potential therapeutic target in NSCLC.

Value of follow-up procedures in patients with large-cell lymphoma who achieve a complete remission.

Salvage therapy for relapsed large-cell lymphoma (LCL) is more effective in patients with minimal disease, suggesting that early detection of relapse might increase the chance of long-term survival. To determine whether current follow-up procedures are effective in identifying preclinical disease, we analyzed patterns of relapse in 139 LCL patients who achieved a complete remission (CR) with high/moderate-dose methotrexate with leucovorin, bleomycin, doxorubicin, cyclophosphamide, vincristine, and dexamethasone (M/m-BACOD). The timing and results of all posttreatment follow-up tests were examined in the 36 patients who relapsed from complete remission (CR) and 46 controls who remain in CR. Despite conscientious posttreatment follow-up, only two of the 36 relapses (6%) were detected before the development of symptoms. Sixty-seven percent of patients relapsed in new disease sites (42% in new and old sites, and 25% in new sites only). Consistent with this observation, the tests most sensitive to clinical relapse were those not targeted to specific sites of disease: gallium scan (sensitivity, 90%), physical examination (80%), and lactate dehydrogenase (LDH) (65%). Of screening tests performed, only LDH was successful in detecting preclinical relapse, with a sensitivity of 42% and specificity of 85% for impending symptomatic relapse. These results indicate that conventional screening was ineffective in detecting preclinical relapse in LCL patients. We recommend prospective evaluation of a strategy that (1) screens with a frequency appropriate to a patient's risk of relapse, (2) uses sensitive test(s) not targeted to specific sites, and (3) limits aggressive screening to those high-risk patients eligible for potentially curative salvage therapy.

High-dose CHOP as initial therapy for patients with poor-prognosis aggressive non-Hodgkin's lymphoma: a dose-finding pilot study.

PURPOSE: To purpose of this study was to develop a more effective approach to the treatment of patients with poor-prognosis aggressive non-Hodgkin's lymphoma (NHL). PATIENTS AND METHODS: Thirty newly diagnosed patients with bulky (> or = 10 cm) advanced-stage aggressive NHL were enrolled onto a pilot study. The study was designed to determine the maximum-tolerated dosages (MTD) of cyclophosphamide and doxorubicin that could be used in a high-dose cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) regimen with granulocyte colony-stimulating factor (G-CSF) support and to assess preliminarily the efficacy of the regimen. RESULTS: In the initial dose-finding portion of the study, cumulative thrombocytopenia was the dose-limiting toxicity. At the MTD, the regimen included four 21-day cycles of cyclophosphamide 4 gm/m2, doxorubicin 70 mg/m2, vincristine 2 mg, and prednisone 100 mg for 5 days with mesna and G-CSF support. At the MTD, 65% of treatment cycles were complicated by febrile neutropenia, 84% of patients received at least one platelet transfusion for platelet counts less than 20,000/microL, and there was one treatment-related death. Nineteen of 22 (86%; 90% confidence interval [CI], 68 to 96) patients treated at the MTD achieved an initial complete response (CR), and 79% (90% CI, 58 to 92) of the complete responders and 69% of all patients remain progression-free with 20 months median follow-up. CONCLUSION: The high-dose CHOP regimen may be an effective alternative for patients with poor-prognosis aggressive NHL.

Early restaging gallium scans predict outcome in poor-prognosis patients with aggressive non-Hodgkin's lymphoma treated with high-dose CHOP chemotherapy.

PURPOSE: This prospective study assessed the predictive value of early restaging gallium (Ga) and computed tomographic (CT) scans in poor-prognosis patients with aggressive non-Hodgkin's lymphoma (NHL) who were treated with high-dose cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) chemotherapy. PATIENTS AND METHODS: Thirty newly diagnosed patients with bulky (> or = 10 cm) advanced-stage aggressive NHL were treated with a four-cycle high-dose CHOP regimen (22 patients at maximum-tolerated dose [MTD]: cyclophosphamide 4 g/m2, doxorubicin 70 mg/m2, vincristine 2 mg, and prednisone 100 mg orally for 5 days). All patients had chest/abdominal/pelvic CT scans and 10-mCi Ga scans at baseline and following two and four cycles of therapy. Scans were reviewed in a blinded manner for CT-documented rates of response and sizes of residual masses and Ga avidity of residual masses. The results of early (post-cycle 2) and final (post-cycle 4) restaging were subsequently associated with clinical outcome. RESULTS: CT-documented rates of response and residual mass sizes were indistinguishable in complete responders who remained continuously disease-free (CR-Cont), complete responders who subsequently relapsed (CR-Rel), and partial responders who then progressed (PR/Prog). In marked contrast, early restaging (post-cycle 2) Ga scans accurately delineated these three categories of patients: CR-Cont 90% Ga-negative (18 of 20 patients) versus CR-Rel 25% Ga-negative (one of four patients) versus PR/Prog 0% Ga-negative (zero of six patients) (P = .000014). At a median follow-up duration of 31 months (range, 21 to 46), 94% of patients who had negative early restaging Ga scans remain free from progression (FFP), whereas only 18% of patients who had positive early restaging Ga scans remain FFP (P = .000007). Early restaging Ga scans were more predictive for FFP than final restaging Ga scans because patients who required four full cycles of therapy to become Ga-negative were more likely to develop recurrent disease. CONCLUSION: Early restaging Ga scans delineate patients who are likely to have prolonged disease-free survival from those who fail to respond to intensive induction therapy. Patients whose tumors remain Ga-positive midway through high-dose CHOP therapy have a poor outcome and may be candidates for alternative treatment.

The m-BACOD combination chemotherapy regimen in large-cell lymphoma: analysis of the completed trial and comparison with the M-BACOD regimen.

One hundred thirty-four assessable patients with stage II-IV large-cell lymphoma (LCL) were treated with the combination chemotherapy regimen methotrexate with leucovorin, bleomycin, doxorubicin, cyclophosphamide, vincristine, and dexamethasone (m-BACOD) between July 1981 and May 1986. The m-BACOD regimen substituted moderate-dose methotrexate (200 mg/m2 x 2) for the high-dose methotrexate used in the preceding M-BACOD regimen; all other drugs were administered as with m-BACOD. Eighty-two patients (61%) in the completed m-BACOD trial achieved a complete response (CR). With a median follow-up of 3.6 years, 62 patients (76%) continue in CR. Predicted survivals of 1, 3, and 5 years for the entire m-BACOD group are 80%, 63%, and 60%, respectively, with a 5-year disease-free survival (DFS) of 74% for the patients who achieve CR. The results obtained with m-BACOD are comparable with those obtained in the preceding M-BACOD trial, which now has a median follow-up of 8.0 years. The reduction in methotrexate dosage in m-BACOD patients was not associated with an increased incidence of CNS relapse. Long-term follow-up of the 215 M/m-BACOD patients indicates that the regimens are not associated with an increased incidence of secondary malignancy. Prolonged follow-up also indicates that advanced-stage patients have a persistent rate of late relapse of about 7.0% per year for years 2 to 5 of their follow-up and that stage II patients have an approximate 2.1% per year rate of late relapse. Application of the previously described prognostic factor model to the 215 M/m-BACOD patients from the completed trials identifies a high-risk group of patients with a CR rate and predicted 5-year survival (38% and 24%, respectively) that are significantly worse than those of the group as a whole (65% and 57%, respectively).

Patterns of relapse in large-cell lymphoma patients with bulk disease: implications for the use of adjuvant radiation therapy.

In patients with large-cell lymphoma (LCL) treated with combination chemotherapy, the presence of bulk disease has consistently been associated with a poorer response rate and a shortened survival. The optimal therapy for patients with bulk disease (greater than or equal to 10 cm) will depend on whether treatment failures result from inadequate tumor eradication in prior bulk sites or from distant dissemination. To address this issue, we have evaluated patterns of relapse in patients with bulk disease who relapsed after achieving a complete remission with methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, and dexamethasone (M- or m-BACOD). Eighty-one II, III, or IV patients with disease greater than or equal to 10 cm were identified; 45 of the 81 patients achieved a confirmed complete response (CR) and are included in the analysis. The 45 complete responders included 21 patients with localized (stage II) disease and 24 patients with advanced (stage III/IV) disease. Six of the 21 stage II complete responders and three of the 24 stage II/IV complete responders also received adjuvant radiation therapy following completion of M- or m-BACOD. Only one of the 21 patients with stage II disease relapsed, doing so in the site of prior bulk involvement. In contrast, nine of 24 patients with stage III/IV disease relapsed, although no patient failed solely in the site of prior bulk disease. Stage III/IV patients recurred in either a new site (one patient), a new and old site (five), an old non-bulk site (two), or both old non-bulk and bulk sites (one). These results indicate that advanced-stage bulk-disease patients do not consistently relapse in sites of prior bulk disease; therefore, this group of patients is unlikely to benefit from adjuvant radiation therapy administered following completion of combination chemotherapy. Although the low relapse rate and the addition of adjuvant radiation therapy in a subgroup of the stage II bulk-disease patients precludes a definitive analysis, our results further suggest that these patients may be effectively treated with combination chemotherapy alone.

Large-cell and immunoblastic lymphoma of the mediastinum: prognostic features and treatment outcome in 57 patients.

PURPOSE: A retrospective study was performed to define clinical characteristics and therapeutic outcome for patients with large-cell and immunoblastic lymphoma of the mediastinum. PATIENTS AND METHODS: Fifty-seven patients who presented with primary, mediastinal large-cell and immunoblastic lymphoma were retrospectively studied to determine initial sites of disease, radiologic characteristics, treatment, outcome, and factors that have prognostic significance for progression-free and overall survival. RESULTS: Fifty-six of the 57 patients had disease that was confined to sites above the diaphragm. Bulky disease and extensive intrathoracic infiltration were common in these patients. All patients were treated with intensive chemotherapy regimens, and 44% of patients received chest irradiation. The overall 5-year survival by Kaplan-Meier estimation was 50% with a freedom-from-relapse rate of 45%. Predictors of disease relapse after chemotherapy included the presence of a pleural effusion (P = .015), a number of involved extranodal sites (P < .01), and a lactic dehydrogenase (LDH) ratio > 3.0 (LDH value/upper limit of assay; P = .04) as well as an incomplete treatment response as evidenced by residual mass on chest radiograph (P = .02) or persistent gallium 67 avidity (P = .01) after chemotherapy. Predictors of decreased survival included the presence of pleural effusion (P = .001), the number of involved extranodal sites (P = .022), and a positive posttreatment 67Ga scan (P = .027). CONCLUSION: Patients with primary mediastinal large-cell and immunoblastic lymphoma have an approximate 50% chance of surviving disease-free after initial therapy. The presence of pleural effusion at presentation was associated with an extremely poor outcome. Bulk disease per se was a negative predictive factor only in patients without pleural effusions when compared with patients who did not have bulk disease. In addition, all patients with involvement of two or more extranodal sites relapsed when treated with standard chemotherapy.

Report of an international workshop to standardize response criteria for non-Hodgkin's lymphomas. NCI Sponsored International Working Group.

Standardized guidelines for response assessment are needed to ensure comparability among clinical trials in non-Hodgkin's lymphomas (NHL). To achieve this, two meetings were convened among United States and international lymphoma experts representing medical hematology/oncology, radiology, radiation oncology, and pathology to review currently used response definitions and to develop a uniform set of criteria for assessing response in clinical trials. The criteria that were developed include anatomic definitions of response, with normal lymph node size after treatment of 1.5 cm in the longest transverse diameter by computer-assisted tomography scan. A designation of complete response/unconfirmed was adopted to include patients with a greater than 75% reduction in tumor size after therapy but with a residual mass, to include patients-especially those with large-cell NHL-who may not have residual disease. Single-photon emission computed tomography gallium scans are encouraged as a valuable adjunct to assessment of patients with large-cell NHL, but such scans require appropriate expertise. Flow cytometric, cytogenetic, and molecular studies are not currently included in response definitions. Response rates may be the most important objective in phase II trials where the activity of a new agent is important and may provide support for approval by regulatory agencies. However, the goals of most phase III trials are to identify therapies that will prolong the progression-free survival, if not the overall survival, of the treated patients. We hope that these guidelines will serve to improve communication among investigators and comparability among clinical trials until clinically relevant laboratory and imaging studies are identified and become more widely available.

Phorbol ester-mediated regulation of CD10/neutral endopeptidase transcripts in acute lymphoblastic leukemias.

The cell-surface zinc metalloproteinase CD10/neutral endopeptidase 24.11 (CD10/NEP) hydrolyzes a variety of peptide substrates and regulates related peptide-mediated cellular responses. Because the enzyme functions as part of a peptide regulatory loop, the fact that CD10/NEP itself varies with cellular activation is of considerable interest. In hematopoietic and nonhematopoietic cell types, the levels of CD10/NEP protein and enzymatic activity correlate with transcript abundance. For these reasons, we investigated the regulation of CD10/NEP transcripts in the phorbol ester-treated acute lymphoblastic leukemia cell line, REH. When REH cells are treated with phorbol myristate acetate (PMA), CD10/NEP transcripts rapidly decrease in a labile protein-dependent manner. PMA has a modest effect on CD10/NEP transcription and significantly reduces CD10/NEP mRNA stability. Of note, the predicted secondary structure of the CD10/NEP 3' untranslated region includes several stem loop structures that may affect the stability of CD10/NEP transcripts.

The m-BACOD combination chemotherapy regimen in the treatment of diffuse large cell lymphoma.

The m-BACOD regimen attempted to lower the dose of methotrexate in the M-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone) program. Between July 1981 and January 1985, 87 previously untreated or minimally treated patients with diffuse large cell lymphoma were treated with the m-BACOD regimen (methotrexate 200 mg/m2 on days 8 and 15, bleomycin 4.0 mg/m2 on day 1, doxorubicin 45 mg/m2 on day 1, cyclophosphamide 600 mg/m2 on day 1, vincristine 1.0 mg/m2 on day 1, and dexamethasone 6 mg/m2 on days 1 to 5; leucovorin was given 24 hours after methotrexate at 10 mg/m2 every six hours for eight doses orally). Of 86 evaluable patients, 59 (68.5%) had a complete remission (CR). Partial response was seen in 21 patients with six still surviving (5 to over 15 months). Of the seven patients who had no change, all have died. The median duration of follow-up for the entire series was 30 months (range, 2 to 61). Relapse from CR occurred in 15 of 59 (25%). Currently, 56 of 87 patients (64%) survive; all but 12 are in their first remission. Overall survival was 84% for those achieving an apparent CR. The major toxic effect of the m-BACOD regimen was myelosuppression with severe leukopenia and fever, which required hospitalization for about 33% of patients. Mucositis occurred in 39 patients; 19 had severe mucositis. No significant difference in overall survival was seen between the high-dose methotrexate M-BACOD and the low-dose m-BACOD regimens.

High-dose cytosine arabinoside. Active agent in treatment of non-Hodgkin's lymphoma.

Seventeen extensively pre-treated patients with non-Hodgkin's lymphoma in relapse were treated with high-dose cytosine arabinoside given at a dose of 3 g/m2 on a 12-hour basis for two to eight doses per course. Seventy percent of patients (12 of 17) showed response with this regimen, including three patients who achieved a complete response. The time to response was quite rapid, occurring between three and 14 days, with median duration of complete responses of 12 weeks and of all responses, five weeks. Toxicity was acceptable, including predictable myelosuppression and thrombocytopenia, occasional drug fever, infrequent conjunctivitis and dermatitis, and no central nervous system toxicity. The dramatic, albeit short-lived, responses to high-dose cytosine arabinoside in this refractory population suggest that it is an active agent against non-Hodgkin's lymphoma and should be further evaluated.

A possible immunoregulatory function for [Met]-enkephalin-Arg6-Phe7 involving human and invertebrate granulocytes.

Opioid peptides and their analogs have been shown to stimulate adherence, conformational changes and locomotory activity in human as well as invertebrate granulocytes. The present study demonstrates that [Met]-enkephalin-Arg6-Phe7, an opioid substance thus far not included in these immunological tests, exhibits stimulatory effects comparable to those of [Met]-enkephalin in this regard. Furthermore, since neutral endopeptidase 24.11 (enkephalinase; CD10/NEP) exists in invertebrate immunocyte membranes, we demonstrate that its specific inhibitor, phosphoramidon, potentiates the effects of the heptapeptide in inducing conformational change in both human and invertebrate granulocytes. Additionally, the major metabolic products of NEP activity, Phe-Met-Arg-Phe and Tyr-Gly-Gly, appear to be potent antagonists of this enzyme activity, especially the tetrapeptide. The effects of heptapeptide stimulation showed a major difference between vertebrate and invertebrate immunocytes with respect to their time course, namely, the speed of their onset. [Met]-enkephalin-Arg6-Phe7 markedly stimulated the locomotory activity of these cells which becomes most noticeable within 15-45 min for Mytilus cells and in a 5-15 min period for human cells. It also enhanced the mobility and velocity of the responsive human (5 microns/min) and invertebrate cells (2.1 microns/min).

A new polymorphic determinant on HLA-DQ molecules.

In man, the immune response genes are located within the HLA-D/DR region, and the gene products, the Ia antigens, are expressed on B lymphocytes, monocytes, and a percentage of null cells and activated T lymphocytes. We recently identified a human Ia antigen, K19, which appeared to be limited in its expression to B lymphocytes, and to be preferentially expressed on the more mature cells within this population. This work was facilitated by a monoclonal antibody. HK-19, which recognized a monomorphic determinant of this Ia molecule. We now report the characterization of a second monoclonal antibody, HK-13, which recognized the same molecule as HK-19, but only on cells from some individuals. The greater affinity of HK-13 allowed more complete characterization of the K19/K13 molecule. This characterization included cytofluorography, two-dimensional gel electrophoresis, tryptic peptide mapping, and partial N-terminal amino acid sequencing, and indicated that K19 and K13 were epitopes on HLA-DQ (DC) molecules. The pattern of reactivity of HK-13 on a panel of typing cells did not correlate with any of the known HLA-DQ polymorphic determinants. Thus, HK-13 is a new polymorphic determinant of the HLA-DQ series.

Identification and characterization of two androgen response regions in the human neutral endopeptidase gene.

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.

Four patients with myelodysplastic syndrome with translocation (1;7)(p11;p11) including one patient with independent clones del(7)q22) [corrected] and t(1;7)(q21;q11)

A translocation involving the short arm of chromosome #1 and the short arm of chromosome #7, [t(1;7)(p11;p11)] was present in four patients with myelodysplastic syndrome (MDS). Two of these patients had prior lymphoproliferative disorders and developed MDS following prolonged therapy with alkylating agents. One of the patients with prior therapy history has two additional independent abnormal clones: one with a partial deletion of the long arm of #7 and the other with t(1;7)(q21;q11). A third patient had a family history of leukemia in both the father and a brother, both of whom developed acute nonlymphocytic leukemia following an MDS phase. The last patient was an elderly woman with no predisposing features.