Vitamin D3 mitigates autoimmune inflammation caused by activation of myeloid dendritic cells in SLE.

Systemic lupus erythematosus (SLE) is an autoimmune disease in which defective T cells, immune complex deposition and other immune system alterations contribute to pathological changes of multiple organ systems. The vitamin D metabolite c is a critical immunomodulator playing pivotal roles in the immune system. Epidemiological evidence indicates that vitamin D deficiency is correlated with the severity of SLE. Our aim is to investigate the effects of 1,25(OH)2D3 (VitD3) on the activation of myeloid dendritic cells (mDCs) by autologous DNA-containing immune complex (DNA-ICs), and the effects of VitD3 on immune system balance during SLE. We purified DNA-ICs from the serum of SLE patients and isolated mDCs from normal subjects. In vitro studies showed that DNA-ICs were internalized and consumed by mDCs. VitD3 blocked the effects of DNA-ICs on RelB, IL-10 and TNF-α in mDCs. Further analysis indicated that DNA-ICs stimulated histone acetylation in the RelB promoter region, which was inhibited by VitD3. Knockdown of the histone deacetylase 3 gene (HDAC3) blocked these VitD3-mediated effects. Co-culture of mDCs and CD4+ T cells showed that VitD3 inhibited multiple processes mediated by DNA-ICs, including proliferation, downregulation of IL-10, TGF-ß and upregulation of TNF-α. Moreover, VitD3 could also reverse the effects of DNA-IC-induced imbalance of CD4+ CD127- Foxp3+ T cells and CD4+ IL17+ T cells. Taken together, our results indicated that autologous DNA-ICs stimulate the activation of mDCs in the pathogenesis of SLE, and VitD3 inhibits this stimulatory effects of DNA-ICs by negative transcriptional regulation of RelB gene and maintaining the Treg/Th17 immune cell balance. These results suggest that vitamin D may have therapeutic value for the treatment of SLE.

Biomarkers of Autologous Whole Blood Injection Efficacy in Patients with Chronic Spontaneous Urticaria with Autoreactivity: A Preliminary Study.

INTRODUCTION: Chronic spontaneous urticaria (CSU) with autoreactivity is often resistant to antihistamines. Autologous whole blood injection (AWBI) has shown potential efficacy in the treatment of this disease, but it is controversial. It is necessary to screen patients who are suitable for this therapy in advance. This study aimed to identify biomarkers that predict the efficacy of AWBI treatment in CSU patients with autoreactivity. METHODS: A total of 30 patients with autologous serum skin test-positive CSU treated with AWBI were included in this study; urticaria activity score (UAS7) was recorded and the treatment response was judged based on it. Levels of total serum IgE, anti-high-affinity IgE receptor (FcεRI) IgG, and basophils CD63 and FcεRI expressions, and D-dimer of all patients were determined and analyzed. RESULTS: Baseline levels of total IgE, D-dimer, basophil FcεRI and CD63 expressions showed good correlations with UAS7 variations. D-dimer, basophil FcεRI and CD63 expressions changed significantly before and after AWBI treatment in AWBI responders, and the basophil FcεRI and CD63 expressions consistently and dynamically decreased in AWBI responders during the treatment. Baseline levels of total IgE, D-dimer, basophil FcεRI and CD63 expressions showed certain predictive values for AWBI response. CONCLUSIONS: Baseline levels of total IgE, D-dimer, basophil FcεRI and CD63 expressions could be biomarkers of predicting AWBI efficacy in patients with CSU with autoreactivity.

Atopy Does Not Influence the Clinical Outcome of Acute Urticaria: A Retrospective Study.

BACKGROUND: Acute urticaria (AU) may be associated with atopy, but the relationship between atopic status and the clinical features of the disease has not been fully described. OBJECTIVES: The aim of the study was to determine the proportion of atopy in AU patients and to see whether atopy is related to the clinical characteristics of AU and whether it has an impact on the outcome of the disease. MATERIALS AND METHOD: A retrospective analysis of patients with AU was performed. Demographic data, clinical features, and laboratory results were compared and analyzed between the atopic and non-atopic AU (napAU). RESULTS: In total, 139 participants were included. 54 (38.8%) patients were atopic AU (apAU) and 85 (61.2%) were napAU. Compared with napAU patients, apAU patients were more likely to have anaphylaxis, higher levels of C4, and lower levels of antistreptolysin. There were no significant differences between the two groups in terms of other clinical features, laboratory tests, the natural course of the disease, or disease outcomes. CONCLUSION: Atopy does exist in some patients with AU, and AU patients with an atopic background are at higher risk for anaphylaxis. Atopy does not influence the clinical outcome of AU and is not correlated with other clinical features and laboratory results of AU.

Application of cefuroxime in the eradication therapy of Helicobacter pylori infection: A review article.

BACKGROUND: Helicobacter pylori infection and its associated diseases represent a significant global health concern. Patients who cannot use amoxicillin pose a therapeutic challenge and necessitate alternative medications. Preliminary research indicates that cefuroxime demonstrates promising potential for eradicating H. pylori infection, and there is a lack of comprehensive review articles on the use of cefuroxime. MATERIALS AND METHODS: This study conducts a thorough systematic literature review and synthesis. A comprehensive systematic search was conducted in PubMed, Web of Science, EMBASE, China National Knowledge Infrastructure, China Biology Medicine disc, and Wanfang Data up to January 13, 2024. The search strategy utilized the following keywords: (Cefuroxime) AND (Helicobacter pylori OR Helicobacter nemestrinae OR Campylobacter pylori OR Campylobacter pylori subsp. pylori OR Campylobacter pyloridis OR H. pylori OR Hp) for both English and Chinese language publications. Sixteen studies from five different countries or regions were included in final literature review. RESULTS: Analysis results indicate that H. pylori is sensitive to cefuroxime, with resistance rates similar to amoxicillin being relatively low. Regimens containing cefuroxime have shown favorable eradication rates, which were comparable to those of the regimens containing amoxicillin. Regarding safety, the incidence of adverse reactions in cefuroxime-containing eradication regimens was comparable to that of amoxicillin-containing regimens or other bismuth quadruple regimens, with no significant increase in allergic reactions in penicillin-allergic patients. Regarding compliance, studies consistently report high compliance rates for regimens containing cefuroxime. CONCLUSION: Cefuroxime can serve as an alternative to amoxicillin for the patients allergic to penicillin with satisfactory efficacies, safety, and compliance.

Ferroptosis in peripheral blood mononuclear cells of systemic lupus erythematosus.

OBJECTIVES: To investigate the evidence of ferroptosis in peripheral blood mononuclear cells (PBMCs) from patients with systemic lupus erythematosus (SLE). METHODS: PBMCs were collected from 30 patients diagnosed as SLE and without any standardised treatment previously and 10 healthy controls. Meanwhile the clinical and laboratory data were collected. The intracellular Fe2+, reactive oxygen species (ROS) and lipid peroxidation (LPO) were detected by fluorescence probe and flow cytometry. The morphology of cells and intracellular organelles were observed by transmission electron microscopy. RT-qPCR and Western blot were applied to compare the expression of GPX4 in PBMCs. RESULTS: The concentration of Fe2+, levels of ROS and LPO in PBMCs from SLE patients were significantly higher than those in healthy controls (p<0.05), and significant differences between the two groups were observed in CD14+ monocytes, CD19+B cells, and CD56+ NK cells respectively. The more prominent differences were observed in SLE patients with renal involvement, liver injury and higher disease activity score. There was no significant difference in GPX4 mRNA expression between SLE patients and healthy controls, however GPX4 protein expression was significantly lower in SLE patients compared to healthy controls, with a negative correlation with the SLE disease activity index. Transmission electron microscopy revealed typical morphological features of ferroptosis such as decreased mitochondrial volume, increased mitochondrial membrane density, and disappearance of mitochondrial cristas. CONCLUSIONS: Ferroptosis occurred more frequently in PBMCs of SLE patients than healthy controls, including CD14+ monocytes, CD19+B cells, CD56+ NK cells, and so on, with negative association with SLE disease activity, which indicated the correlation between ferroptosis with the pathogenesis of SLE.

Efficacy and safety of topical minocycline foam (FMX101 4%) in treatment of Chinese subjects with moderate-to-severe facial acne vulgaris: A phase 3, multi-centre, randomized, double-blind, vehicle-controlled study.

BACKGROUND: FMX101 4%, as a topical foam formulation of minocycline, has been approved by US Food and Drug Administration for the treatment of moderate-to-severe acne vulgaris (AV). OBJECTIVE: To evaluate the efficacy and safety of FMX101 4% in treating Chinese subjects with moderate-to-severe facial AV. METHODS: This was a multi-centre, randomized, double-blind, vehicle-controlled phase 3 study in Chinese subjects with moderate-to-severe AV. Eligible subjects were randomized 2:1 to receive either FMX101 4% or vehicle foam treatment for 12 weeks. The primary efficacy endpoint was the change in inflammation lesion count (ILC) from baseline at week 12. The key secondary endpoint was the treatment success rate according to Investigator's Global Assessment (IGA) at week 12. RESULTS: In total, 372 subjects were randomized into two groups (FMX101 4% group, n = 248; vehicle group, n = 124). After 12 weeks treatment, the reduction in ILC from baseline was statistically significant in favour of FMX101 4%, compared with vehicle foam (-21.0 [0.08] vs. -12.3 [1.14]; LSM [SE] difference, -8.7 [1.34]; 95% CI [-11.3, -6.0]; p < 0.001). FMX101 4% treatment yielded significantly higher IGA treatment success rate at week 12 as compared to the control treatment (8.06% vs. 0%). Applying FMX101 4% also resulted in significant reduction in noninflammatory lesion count (nILC) versus vehicle foam at week 12 (-19.4 [1.03] vs. -14.9 [1.47]; LSM [SE] difference, -4.5 [1.74]; 95% CI [-8.0, -1.1]; p = 0.009). Most treatment-emergent adverse events (TEAEs) were mild-to-moderate in severity, and no treatment-related treatment-emergent serious adverse event (TESAE) occurred. Thus, FMX101 4% was considered to be a safe and well-tolerated product during the 12-week treatment period. CONCLUSION: FMX101 4% treatment for 12 weeks could lead to significantly reduced ILC and nILC, and improved IGA treatment success rate in Chinese subjects with moderate-to-severe facial AV. It also showed a well acceptable safe and tolerability profile.

The impact of the COVID-19 pandemic on SLE.

Little is known about the association between coronavirus disease 2019 (COVID-19) and autoimmune diseases, especially in the case of systemic lupus erythematosus (SLE). SLE patients met with many questions during the pandemic in COVID-19, such as how to minimize risk of infection, the complex pathological features and cytokine profiles, diagnosis and treatment, rational choice of drugs and vaccine, good nursing, psychological supervision, and so on. In this study, we review and discuss the multifaceted effects of the COVID-19 pandemic on patients living with SLE using the available literature. Cross-talk in implicated inflammatory pathways/mechanisms exists between SLE and severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, and SARS-CoV-2 displays similar clinical characteristics and immuno-inflammatory responses to SLE. Current epidemiological data inadequately assess the risk and severity of COVID-19 infection in patients with SLE. More evidence has shown that hydroxychloroquine and chloroquine cannot prevent COVID-19. During the pandemic, patients with SLE had a higher rate of hospitalization. Vaccination helps to reduce the risk of infection. Several therapies for patients with SLE infected with COVID-19 are discussed. The cases in the study can provide meaningful information for clinical diagnosis and management. Our main aim is to help preventing infection and highlight treatment options for patients with SLE infected with COVID-19.

Hemophagocytic lymphohistiocytosis and disseminated intravascular coagulation are underestimated, but fatal adverse events in chimeric antigen receptor T-cell therapy.

Hematotoxicity is the most common long-term adverse event (AE) after chimeric antigen receptor T-cell (CAR T) therapy. However, patients who receive CAR T therapy in pivotal clinical trials are subjected to restrictive selection criteria, and this means that rare but fatal toxicities are underestimated. Here, we systematically analyzed CAR T-associated hematologic AE using the US Food and Drug Administration Adverse Event Reporting System (FAERS) between January 2017 and December 2021. Disproportionality analyses were performed using reporting odds ratios (ROR) and information component (IC); the lower limit of the ROR and IC 95% confidence interval (CI) (ROR025 and IC025) exceeding one and zero was considered significant, respectively. Among the 105,087,611 reports in FAERS, 5,112 CAR T-related hematotoxicity reports were identified. We found 23 significant over-reporting hematologic AE (ROR025 >1) compared to the full database, of which hemophagocytic lymphohistiocytosis (HLH; n=136 [2.7%], ROR025 = 21.06), coagulopathy (n=128 [2.5%], ROR025 = 10.43), bone marrow failure (n=112 [2.2%], ROR025 = 4.88), disseminated intravascular coagulation (DIC; n=99 [1.9%], ROR025 = 9.64), and B-cell aplasia (n=98 [1.9%], ROR025 = 118.16, all IC025 > 0) were highly under-reported AE in clinical trials. Importantly, HLH and DIC led to mortality rates of 69.9% and 59.6%, respectively. Lastly, hematotoxicity-related mortality was 41.43%, and 22 death-related hematologic AE were identified using LASSO regression analysis. These findings could help clinicians in the early detection of those rarely reported but lethal hematologic AE, thus reducing the risk of severe toxicities for CAR T recipients.

Zoledronate Promotes Peri-Implant Osteogenesis in Diabetic Osteoporosis by the AMPK Pathway.

Together with diabetic osteoporosis (DOP), diabetes patients experience poor peri-implant osteogenesis following implantation for dentition defects. Zoledronate (ZOL) is widely used to treat osteoporosis clinically. To evaluate the mechanism of ZOL for the treatment of DOP, experiments with DOP rats and high glucose-grown MC3T3-E1 cells were used. The DOP rats treated with ZOL and/or ZOL implants underwent a 4-week implant-healing interval, and then microcomputed tomography, biomechanical testing, and immunohistochemical staining were performed to elucidate the mechanism. In addition, MC3T3-E1 cells were maintained in an osteogenic medium with or without ZOL to confirm the mechanism. The cell migration, cellular actin content, and osteogenic differentiation were evaluated by a cell activity assay, a cell migration assay, as well as alkaline phosphatase, alizarin red S, and immunofluorescence staining. The mRNA and protein expression of adenosine monophosphate-activated protein kinase (AMPK), phosphorylated AMPK (p-AMPK), osteoprotegerin (OPG), receptor activator of nuclear factor kappa B ligand (RANKL), bone morphogenetic protein 2 (BMP2), and collagen type I (Col-I) were detected using real-time quantitative PCRs and western blot assays, respectively. In the DOP rats, ZOL markedly improved osteogenesis, enhanced bone strength and increased the expression of AMPK, p-AMPK, and Col-I in peri-implant bones. The in vitro findings showed that ZOL reversed the high glucose-induced inhibition of osteogenesis via the AMPK signaling pathway. In conclusion, the ability of ZOL to promote osteogenesis in DOP by targeting AMPK signaling suggests that therapy with ZOL, particularly simultaneous local and systemic administration, may be a unique approach for future implant repair in diabetes patients.

Higher House Dust Mite-Specific IgE Levels among Chronic Spontaneous Urticaria Patients May Implicate Higher Basophil Reactivity.

INTRODUCTION: Allergen-specific IgE (sIgE) sensitization exists in a considerable fraction of chronic spontaneous urticaria (CSU) patients. Basophils have been implicated in the pathogenesis of CSU. This paper aimed to explore the relationship between allergic sensitization and basophil reactivity in CSU and the possible underlying mechanism. METHODS: Basophil-enriched leukocytes were isolated from the peripheral blood of 76 CSU patients and 9 healthy controls. Basophil CD63 and FcεRIα (the alpha subunit of the high-affinity IgE receptor) expression in the blood samples with various house dust mite (HDM)-sIgE levels were determined by flow cytometry. Basophil reactivity and SHIP-1 (a molecule related to the IgE/FcεRI signaling pathway) expression were analyzed after stimulation with an HDM allergen or other stimuli. RESULTS: HDM-sIgEstrong positive (≥3.5 kU/L) CSU patients had a significantly higher mean percentage of basophil CD63 and higher baseline levels of FcεRIα expressed by basophils than HDM-sIgEnormal (<0.35 kU/L) CSU patients and healthy controls; the same went for total serum IgE. After stimulation with Dermatophagoides pteronyssinus peptidase 1 (Derp1) alone or together with Derp1-sIgE, the stimulation index of CD63 and levels of FcεRIα expressed by basophils in HDM-sIgEstrong positive CSU patients were significantly higher than those in HDM-sIgEnormal CSU patients and healthy controls. Significantly more SHIP-1 mRNA expression in HDM-sIgEstrong positive CSU patients was induced after the combined stimulation in comparison to other subjects. CONCLUSION: CSU patients with higher HDM-sIgE levels (≥3.5 kU/L) may have higher CD63 and FcεRIα expression on peripheral blood basophils. Peripheral blood basophils in these CSU patients are more responsive to HDM allergen stimulation. Higher HDM-sIgE levels among CSU patients may implicate higher basophil reactivity.

Validation of diagnostic criteria for atopic dermatitis and proposal of novel diagnostic criteria for adult and elderly Chinese populations: a multicentre, prospective, clinical setting-based study.

BACKGROUND: A previous validation study showed a very low sensitivity and higher specificity associated with Hanifin and Rajka criteria (H&R) and the UK Working Party criteria (UKWP) in diagnosing AD vs. the Chinese criteria of atopic dermatitis (AD) for children (CCAD). However, their diagnostic efficacy in adult and elderly Chinese populations remains unknown. OBJECTIVES: To validate the diagnostic efficacy of three sets of AD criteria in adult and elderly Chinese populations in a hospital setting. METHODS: A total of 1034 patients (aged 19-95 years) from five university hospital dermatological clinics were recruited. Medical history, dermatological examination, AD diagnosis and evaluation of AD severity were done by dermatologists. Each patient was investigated by two dermatologist panels, one to establish a clinical diagnosis, and the other to identify and record the major or minor signs of H&R criteria, UKWP criteria and CCAD. Taking clinical diagnosis as the reference, the diagnostic efficacy of three sets of diagnostic criteria was evaluated. The χ2 test or rank sum test were used for between-groups comparisons. RESULTS: CCAD had a higher sensitivity (84.0%), especially among mild and moderate cases of AD (72.7% and 90.3%, respectively), than the H&R (58.0%; P < 0.001) and UKWP criteria (56.0%; P < 0.001) in diagnosing AD. The specificity of CCAD (92.7%) was slightly lower than the H&R (97.3%; P < 0.001) or UKWP criteria (97.4%; P < 0.001). The CCAD had the highest Youden index (0.77), accuracy rate (0.90) and Kappa value (0.76) of the three sets of diagnostic criteria. CONCLUSIONS: Consistent with results in a population of Chinese children, although the H&R and UKWP criteria had a high specificity for diagnosing AD, their low sensitivity limited their use in adult and elderly Chinese patients. Based on the high sensitivity and favourable diagnostic efficacy, the CCAD is proposed for AD diagnosis in adult and elderly Chinese populations, especially for cases of mild and moderate AD.

Individualized diagnosis and eradication therapy for Helicobacter pylori infection based on gene detection of clarithromycin resistance in stool specimens: A systematic review and meta-analysis.

BACKGROUND: Empiric therapy for Helicobacter pylori infection results in significantly increased antibiotic resistance and decreased eradication efficacy. The genotypic testing of clarithromycin resistance from stool specimens is a promising method for individualized diagnosis and treatment. This study aimed to determine the status of research and application on this method through a systematic review and meta-analysis. METHODS: PubMed, Embase, MEDLINE, and WAN FANG database were searched for relevant literature. The quality of included diagnostic articles was evaluated using the quality Assessment of Diagnostic Accuracy Studies-2 tool. A bivariate random-effect model was conducted to calculate the diagnostic accuracy of genotypic testing of clarithromycin resistance. RESULTS: A total of 16 diagnostic-related were included and analyzed after exclusions. The pooled sensitivity and specificity of diagnostic meta-analysis were 0.93 (95% confidence interval [CI]: 0.90-0.96) and 0.98 (95% CI: 0.93-1.00), respectively. The area under the curve (AUC) of the summary receiver operating characteristic was 0.97 (95% CI: 0.95-0.98). The genotypic testing in stool samples had heterogeneous sensitivity (Q = 37.82, p < .01, I2  = 37.82) and specificity (Q = 60.34, p < .01, I2  = 93.72) in detecting clarithromycin resistance. Purification method, stool sample weight, real-time PCR, and antimicrobial susceptibility testing as reference accounted for the heterogeneity of pooled sensitivity, while patient age, purification method, stool sample weight, and real-time PCR for the heterogeneity of pooled specificity. CONCLUSION: The genotypic testing of clarithromycin resistance from stool specimens is an accurate, convenient, noninvasive, and rapid detection technology, providing a definitive diagnosis of clarithromycin resistance and guiding the rational antibiotic selection.

New regimens as first-line eradication therapy for Helicobacter pylori infection in patients allergic to penicillin: A randomized controlled trial.

BACKGROUND: Helicobacter pylori eradication in penicillin-allergic patients is challenging. The effective regimen is lacking in areas with high antibiotic resistance and tetracycline unavailable. Minocycline, cefuroxime, and full-dose metronidazole are promising drugs. AIMS: To compare the eradication rate, safety, and compliance among three new bismuth quadruple therapies for first-line H. pylori eradication in penicillin-allergic patients. METHODS: This randomized trial was conducted on 450 naive patients with H. pylori infection and penicillin allergy. The 14-day minocycline-metronidazole-containing (minocycline 100 mg twice daily and metronidazole 400 mg four times/day), minocycline-cefuroxime-containing (minocycline 100 mg twice daily and cefuroxime 500 mg twice daily), and cefuroxime-metronidazole-containing (cefuroxime 500 mg twice daily and metronidazole 400 mg four times/day) bismuth quadruple therapies were randomly assigned to the participants. Safety and compliance were assessed within 3 days after eradication. Urea breath test was performed 4-8 weeks after eradication to evaluate outcome. RESULTS: The differences of eradication rates in either intention-to-treat (84.0%, 82.7%, and 23 82.0%, p = .896) or per-protocol (91.7%, 90.9%, and 88.2%, p = .599) analysis among minocycline-metronidazole, minocycline-cefuroxime, and cefuroxime-metronidazole-containing bismuth quadruple therapies were statistically insignificant. The incidence of adverse events (35.1%, 22.6%, and 28.9%) and compliance (90.5%, 91.8%, and 91.9%) were similar. Taste distortion, nausea, and anorexia were more common in metronidazole-containing regimens, and dizziness was more common in minocycline-containing regimens. The allergy was rare (~3%). CONCLUSIONS: The efficacies of three bismuth quadruple therapies containing minocycline, cefuroxime, and full-dose metronidazole (pairwise) for first-line H. pylori eradication in penicillin-allergic patients were similarly satisfactory with relatively good safety and compliance. The study was registered in the Chinese Clinical Trials Registration (ChiCTR1900023702).

Bismuth, esomeprazole, metronidazole and amoxicillin or tetracycline as a first-line regimen for Helicobacter pylori eradication: A randomized controlled trial.

BACKGROUND: Due to general unavailability and common side effects of tetracycline, the clinical application of bismuth quadruple therapy (BQT) is greatly limited. Whether amoxicillin can replace tetracycline in BQT remains unknown. This study aimed to compare the eradication rate, safety and compliance between amoxicillin-containing and tetracycline-containing BQT as a first-line regimen for Helicobacter pylori eradication. METHODS: This randomized trial was conducted on 404 naïve patients for H. pylori eradication. The participants were randomly assigned to 14-day amoxicillin-containing (bismuth potassium citrate 110 mg four times/day, esomeprazole 20 mg twice daily, metronidazole 400 mg four times/day and amoxicillin 500 mg four times/day) and tetracycline-containing (tetracycline 500 mg four times/day and the other three drugs used as above) BQT. Safety and compliance were assessed within 3 days after eradication. Urea breath test was performed 4-8 weeks after eradication to evaluate outcome. RESULTS: As for the eradication rates of amoxicillin-containing and tetracycline-containing BQT, the results of both intention-to-treat and per-protocol analyses showed that the difference rate of the lower limit of 95% confidence interval was above -10.0% (intention-to-treat analysis: 81.7% vs. 83.2%, with a rate difference of -1.5% [-6.3% to 9.3%]; per-protocol analysis: 89.0% vs. 91.6%, -2.6% [-4.1% to 9.3%]). The incidence of adverse events in amoxicillin-containing BQT was significantly lower than tetracycline-containing BQT (29.5% vs. 39.7%). Both groups achieved relatively good compliance (92.0% vs. 89.9%). CONCLUSION: The eradication efficacy of amoxicillin-containing BQT was non-inferior to tetracycline-containing BQT as a first-line regimen for H. pylori eradication with better safety and similar compliance.

Melatonin attenuates lung ischemia-reperfusion injury through SIRT3 signaling-dependent mitophagy in type 2 diabetic rats.

Background: Lung ischemia-reperfusion injury (LIRI) remains the major cause of primary lung dysfunction after lung transplantation. Diabetes mellitus (DM) is an independent risk factor for morbidity and mortality following lung transplantation. Mitochondrial dysfunction is recognized as a key mediator in the pathogenesis of diabetic LIRI. Melatonin has been reported to be a safe and potent preserving mitochondrial function agent. This study aimed at investigating the potential therapeutic effect and mechanisms of melatonin on diabetic LIRI. Methods: High-fat-diet-fed streptozotocin-induced type 2 diabetic rats were exposed to melatonin, with or without administration of the SIRT3 short hairpin ribonucleic acid (shRNA) plasmid following a surgical model of ischemia-reperfusion injury of the lung. Lung function, inflammation, oxidative stress, cell apoptosis, and mitochondrial function were examined. Results: The SIRT3 signaling and mitophagy were suppressed following diabetic LIRI. Treatment with melatonin markedly induced mitophagy and restored SIRT3 expression. Melatonin treatment also attenuated subsequent diabetic LIRI by improving lung functional recovery, suppressing inflammation, decreasing oxidative damage, diminishing cell apoptosis, and preserving mitochondrial function. However, either administration of SIRT3 shRNA or an autophagy antagonist 3-methyladenine (3-MA) suppressing mitophagy, and compromised the protective action of melatonin. Conclusion: Data indicated that melatonin attenuates diabetic LIRI through activation of SIRT3 signaling-mediated mitophagy.

Hollow manganese dioxide-chitosan hydrogel for the treatment of atopic dermatitis through inflammation-suppression and ROS scavenging.

Atopic dermatitis (AD) is a chronic inflammatory disease associated with immune dysfunction. High levels of reactive oxygen species (ROS) can lead to oxidative stress, release of pro-inflammatory cytokines, and T-cell differentiation, thereby promoting the onset and worsening of AD. In this study, we innovatively used quaternary ammonium chitosan (QCS) and tannic acid (TA) as raw materials to design and prepare a therapeutic hydrogel(H-MnO2-Gel) loaded with hollow manganese dioxide nanoparticles (H-MnO2 NPs). In this system, the hydrogel is mainly cross-linked by dynamic ion and hydrogen bonding between QCS and TA, resulting in excellent moisture retention properties. Moreover, due to the inherent antioxidant properties of QCS/TA, as well as the outstanding H2O2 scavenging ability of H-MnO2 NPs, the hydrogel exhibits significant ROS scavenging capability. In vitro experiments have shown that H-MnO2-Gel exhibits good cellular biocompatibility. Importantly, in an AD-induced mouse model, H-MnO2-Gel significantly enhanced therapeutic effects by reducing epidermal thickness, mast cell number, and IgE antibodies. These findings suggest that H-MnO2-Gel, by effectively clearing ROS and regulating the inflammatory microenvironment, provides a promising approach for the treatment of AD.

Single-cell RNA-seq reveals abnormal differentiation of keratinocytes and increased inflammatory differentiated keratinocytes in atopic dermatitis.

BACKGROUND: Atopic dermatitis (AD) is a chronic and recurrent inflammatory skin disease characterized by severe pruritus and eczematous lesions. Heterogeneity of AD has been reported among different racial groups according to clinical, molecular and genetic differences. OBJECTIVE: This study aimed to conduct an in-depth transcriptome analysis of AD in Chinese population. METHODS: We performed single-cell RNA sequencing (scRNA-seq) analysis of skin biopsies from five Chinese adult patients with chronic AD and from four healthy controls, combined with multiplexed immunohistochemical analysis in whole-tissue skin biopsies. We explored the functions of IL19 in vitro. RESULTS: ScRNA-seq analysis was able to profile a total of 87,853 cells, with keratinocytes (KCs) in AD manifesting highly expressed keratinocyte activation and pro-inflammatory genes. KCs demonstrated a novel IL19+ IGFL1+ subpopulation that increased in AD lesions. Inflammatory cytokines IFNG, IL13, IL26 and IL22 were highly expressed in AD lesions. In vitro, IL19 directly downregulated KRT10 and LOR in HaCaT cells and activated HaCaT cells to produce TSLP. CONCLUSION: Abnormal proliferation and differentiation of keratinocytes contribute immensely to the pathogenesis of AD, whereas AD chronic lesions have witnessed significant presence of IL19+ IGFL1+ KCs, which may be involved in the disruption of the skin barrier, the connection and magnification of Th2 and Th17 inflammatory responses, and mediation of skin pruritus. Furthermore, progressive activation of multiple immune axes dominated by Type 2 inflammatory reaction occur in AD chronic lesions.

Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd (Luffa cylindrica) in Yunnan Province, China.

Sponge gourd (Luffa cylindrica) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes (Rotylenchulus) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 µm (352.8 to 436.7 µm), stylet = 18.6 ± 0.5 µm (17.6 to 19.4 µm), tail length= 25.9 ± 2.2 µm (20.1 to 29.9 µm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 µm (368.1 to 463.9 µm), stylet = 12.8 ± 0.8 µm (11.2 to 14.1 µm), tail length= 26.3 ± 1.8 µm (24.3 to 29.4 µm), spicule = 20.6 ± 0.9 µm (19.6 to 22.7 µm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for R. reniformis (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) and D2-D3 region of the 28S rRNA gene sequence (787 bp, MT328542) showed more than 99% identity with several R. reniformis sequences deposited in the GenBank database (e.g., MT209977, KP018557, GU003947; KJ755184, MT225542, HM131858). In greenhouse pathogenicity tests, 12 two-leaf stage sponge gourd seedlings (cv. Zaoxiu 6) maintained in 14-cm-diameter and 12-cm-height pots with sterilized commercial soil (pH 5.5-7.0; organic matter 35%), were inoculated with 500 mixed vermiform stage nematodes of R. reniformis extracted from the infested field soil samples per plant. Eight non-inoculated seedlings were used as controls. After 60 days, all inoculated plants exhibited slight symptoms of root browning compared with the control. The nematode reproduction factor (final population/initial population) was 12.4. No nematodes and root browning were observed on control plants. R. reniformis has been reported on sponge gourd in Shanghai, Fujian, Guangdong, and Hainan provinces of China (Ding et al., 2015). To our knowledge, this is the first report of R. reniformis infecting sponge gourd in Yunnan Province, China. Yunnan Province is one of the biggest sponge gourd producing areas in China. Since R. reniformis is a highly pathogenic nematode and damages sponge gourd, control measures should be taken to avoid its spread to other regions or host crops in China.

First report of leaf spot caused by Botrytis cinerea on Bletilla striata in Anhui province, China.

Bletilla striata (Thunb.) is a perennial herb plant of the orchidaceous family and is used as an ornamental plant in Europe and the United States. Furthermore, it is important as traditional Chinese medicine (TCM) in East Asian countries, such as China, Japan, Korea, Mongolia, and Myanmar (Gou et al. 2022). In April 2023, a severe disease similar to gray mold occurred in a B. striata plantation in Anqing, Anhui province, China (N30°27'15″, E116°18'32″), causing disease on about 20% of the plants in the field. Early symptoms were characterized by brown spots or stripes on the leaves of B. striata, and as the disease progressed, large brown irregular spots appeared. Eventually disease spots coalesced, covering the entire leaf surface and causing leaf death. A gray mildew layer was observed on the senescent leaves. To investigate the causal agent, 10 plants with typical symptoms were collected from the field. Leaf pieces (5 × 5 mm) from the border of infected areas were soaked in 75% ethanol for 10 seconds, and then transferred into 0.1% mercury bichloride for three min, rinsed three times with sterile water, and transferred to PDA at 25 °C for three days. Pure cultures were obtained by single spore isolation, and the resulting colonies were morphologically similar, indicating a single pathogen, of which the representative BSFC-7 was selected for further study. BSFC-7 colonies were initially white to gray-brown, and cottony aerial hyphae grew over the entire petri dish after five days of incubation. Grayish, branched conidiophores and their terminal unicellular conidia were observed under a microscope after additional two days at 25 °C. Conidia were colorless or gray, elliptical or oval, and 7.06-12.54 × 8.33-13.55 µm (n=30). Sclerotia appeared in BSFC-7 culture up to about two weeks and were black, hard, and round or irregularly shaped (0.81-4.32 × 0.97-5.68 mm, n=20). The morphological characteristics fit the description of Botrytis cinerea (Li et al. 2016). To further identify the species, genomic DNA of BSFC-7 was extracted. PCR analysis was performed with species-specific primer pairs C729+/C729- and two nuclear genes G3PDH and RPB2 with their corresponding primer pairs G3PDH-F/G3PDH-R and RPB2-F/RPB2-R (Rigotti et al. 2002; Aktaruzzaman et al. 2018). The sequences for all three PCR products of C729, G3PDH, and RPB2 (GenBank accession nos. OR287069, OR255923, and OR255924 respectively) exhibited 99 to 100% similarity with other B. cinerea isolates. In the pathogenicity test, detached leaves of B. striata were inoculated with the BSFC-7 isolate. The leaves were soaked in sodium hypochlorite (1%) for two min, washed with sterile distilled water, and then inoculated with 10 µl of conidial suspension (106 conidia/ml). Sterile water was used as control and samples were incubated at 25 °C. After three days, all leaves inoculated with conidia showed dark brown water-soaked lesions similar to those observed in the field, while the control leaves remained healthy. The pathogen was re-isolated from the affected leaves, fulfilling Koch's postulates. B. cinerea is a common pathogen on a wide range of host plant species worldwide and has been reported to infect B. striata in Yunnan province, China (Romanazzi and Feliziani 2014; Zhang et al. 2020). To our knowledge, this is the first report of B. cinerea causing leaf spots on B. striata in Anhui province, China. This study will provide a basis for controlling the prevalence and economic losses of gray mold on B. striata.

Exploring factors that influence the behavioural intention of medical students to use 3D gastroscopic model to learn how to operate gastroscope using UTAUT Model.

BACKGROUND: The application of virtual reality (VR) in gastroscopic operation teaching can be safe and effective, but the advantages can be realized only when students accept and use it. This study aims to identify the factors influencing Chinese clinical medical postgraduates on their intention to use the 3D gastroscopic model constructed based on VR technology using Unified Theory of Acceptance and Use of Technology (UTAUT) model. Students' demographic factors are also taken into consideration. METHODS: All methods were carried out in accordance with relevant guidelines. Data were collected from clinical medical postgraduates students in China using stratified sampling. A total of 292 questionnaires including valid responses were used in this study. Data were processed using Amos 24.0 and SPSS 26.0 software and the statistical analysis technique was based on structural equation modeling (SEM). RESULTS: The results showed that different from the mediator of home location and year of clinical learning, mediator of gender, university kind and graduate degree did not affect the behavioral intention. In addition, performance expectancy, facilitating condition, and social influence directly and indirectly have effect on behavioral intention. Also, the significance between social influence and performance expectancy, social influence and effort expectancy were verified. CONCLUSIONS: This study manifested that the proposed framework based on the UTAUT had explanatory power to identify the factors influencing the students' behavioral intention to use the 3D gastroscopic model constructed based on VR technology. Whereas, an important variable of effort expectancy in the frame of the SEM were not certified, thereby indicating that particular attention should be paid to this variable by universities and teachers before applying 3D gastroscopic model constructed based on VR technology in teaching. Added preparatory work is required such as explaining the basic knowledge of the operating steps of VR model and make students adequately understand its accessibility, which can probably improve the intentions of them to use it. The positive effects of social influence on performance expectancy and effort expectancy we proposed was also verified in this study, which provided a direction for future research.